GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCCGGCAUCGAUAGCCGCCCGCCUGGGC
# cmscan :: search sequence(s) against a CM database
# INFERNAL 1.1.2 (July 2016)
# Copyright (C) 2016 Howard Hughes Medical Institute.
# Freely distributed under a BSD open source license.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query sequence file: /tmp/ss.fa
# target CM database: Rfam.cm
# sequence reporting threshold: E-value <= 1
# number of worker threads: 4
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Query: test [L=71]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
(1) ! 1.3e-06 44.6 0.1 pfl 1 71 + cm 5'&3' 0.72 -
Hit alignments:
>> pfl
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(1) ! 1.3e-06 44.6 0.1 cm 6 84 ~~ 1 71 + ~~ 0.97 5'&3' 0.72
??? ?? NC
~~~~~(((((((,,,,,,,,,,,,,<<<___>>>,,<<<<_____>>>>.,,,,,))))))))))---...<<<<<_________>>>~~~~~ CS
pfl 1 <[5]*cccgcgcgACUGGCGaaaacggcuuagccguGUGGAucuACCAC.GGGgAgcgcgggggguaa...cuGCCGauCGCCUGGGC*[7]> 91
::::CG:GACUGGCGAA A GUGG ++ ACCAC GGGGA:CG:::: GG A+ GCCG +CGCCUGGGC
test 1 <[0]*GGGUCGUGACUGGCGAACAG-----------GUGGGAA-ACCACcGGGGAGCGACCCCGGCAUcgaUAGCCGCCCGCCUGGGC*[0]> 71
.....*****************966...........******9.*********************888********************..... PP
Internal HMM-only pipeline statistics summary: (run for model(s) with zero basepairs)
--------------------------------------------------------------------------------------
Query sequence(s): 1 (142 residues searched)
Target model(s): 347 (40911 consensus positions)
Windows passing local HMM SSV filter: 5 (0.007205); expected (0.02)
Windows passing local HMM MSV bias filter: 3 (0.004323); expected (0.02)
Windows passing local HMM Viterbi filter: 0 (0); expected (0.001)
Windows passing local HMM Forward filter: 0 (0); expected (1e-05)
Total HMM hits reported: 0 (0)
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (142 residues searched)
Query sequences re-searched for truncated hits: 1 (410.5 residues re-searched, avg per model)
Target model(s): 2126 (267652 consensus positions)
Windows passing local HMM SSV filter: 1029 (0.05685); expected (0.35)
Windows passing local HMM Viterbi filter: (off)
Windows passing local HMM Viterbi bias filter: (off)
Windows passing local HMM Forward filter: 414 (0.02386); expected (0.02)
Windows passing local HMM Forward bias filter: 350 (0.02025); expected (0.02)
Windows passing glocal HMM Forward filter: 104 (0.005853); expected (0.02)
Windows passing glocal HMM Forward bias filter: 92 (0.005128); expected (0.02)
Envelopes passing glocal HMM envelope defn filter: 86 (0.004435); expected (0.02)
Envelopes passing local CM CYK filter: 11 (0.0004274); expected (0.0001)
Total CM hits reported: 1 (0.0001209); includes 1 truncated hit(s)
Total CM and HMM hits reported: 1
# CPU time: 4.04u 0.58s 00:00:04.62 Elapsed: 00:00:03.25
//
[ok]