Sequence input/output and complex DNA sequences

More complex sequences (like plasmids) have many annotated pieces and benefit from other methods. sequence.DNA has many methods for accessing and modifying complex sequences.

The following sequence is a plasmid that integrates at the S. cerevisiae HO locus via ends-out integration, inserting the GEV transactivator from McIsaac et al. 2011:


In [1]:
import coral as cor

In [2]:
pKL278 = cor.seqio.read_dna('./files_for_tutorial/maps/pMODKan-HO-pACT1GEV.ape')

Sequences have .name and .id attributes that are empty string by default. By convention, you should fill them with appropriate strings for your use case - the name is a human-readable name while id should be a unique number or string.


In [3]:
pKL278.name  # Raw genbank name field - truncated due to genbank specifications


Out[3]:
'pMODKan_HO_pACT1GE'

Large sequences have summary representations, useful for getting a general idea of which sequence you're manipulating


In [4]:
pKL278  # The sequence representation - shows ~40 bases on each side.


Out[4]:
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACAT ... TTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
AGCGCGCAAAGCCACTACTGCCACTTTTGGAGACTGTGTA ... AATTGGATATTTTTATCCGCATAGTGCTCCGGGAAAGCAG

Complex sequences usually have annotations to categorize functional or important elements. This plasmid has a lot of features - it's a yeast shuttle vector, so it has sequences for propagating in E. coli, sequences for integrating into the S. cerevisiae genome, sequences for selection after transformation, and an expression cassette (promoter, gene, terminator). In addition, it has common primer sites and annotated subsequences.


In [5]:
pKL278.features  # Man that's way too many features


Out[5]:
[pGEX_3_primer 'misc_feature' feature (28 to 51) on strand 1,
 pMOD_t1pre 'misc_feature' feature (132 to 154) on strand 0,
 PmeI(1) 'misc_feature' feature (154 to 162) on strand 0,
 HO Targeting 1 'misc_feature' feature (162 to 725) on strand 0,
 pMOD_t1suf 'misc_feature' feature (725 to 755) on strand 0,
 KANMX Wach et al 1994 (genome del. project) 'misc_feature' feature (755 to 1152) on strand 0,
 KanMX CDS 'misc_feature' feature (1152 to 1962) on strand 0,
 KanMX terminator 'misc_feature' feature (1962 to 2200) on strand 0,
 M13 Forward (-47) primer 'primer_bind' feature (2200 to 2224) on strand 0,
 pACT1 'misc_feature' feature (2224 to 2885) on strand 0,
 Extra sequence not found in Gottschling map 'misc_feature' feature (2921 to 2932) on strand 0,
 GAL4(1-93) DBD 'misc_feature' feature (2940 to 3218) on strand 0,
 Differs from Gottschling map (backbone) 'misc_feature' feature (3218 to 3219) on strand 0,
 hER HBD 'misc_feature' feature (3255 to 4140) on strand 0,
 HSV1 VP16 'misc_feature' feature (4140 to 4344) on strand 0,
 Differs from Gottschling Map 'misc_feature' feature (4235 to 4236) on strand 0,
 stop codon 'misc_feature' feature (4344 to 4347) on strand 0,
 L2 'misc_feature' feature (4347 to 4377) on strand 0,
 T + pBluescript KS linker 'misc_feature' feature (4377 to 4399) on strand 0,
 CYC1 'terminator' feature (4403 to 4643) on strand 0,
 pYESTrp_rev primer 'primer_bind' feature (4412 to 4431) on strand 1,
 T7 EEV primer 'primer_bind' feature (4643 to 4665) on strand 0,
 upstream HO targeting 'misc_feature' feature (4665 to 5571) on strand 0,
 PmeI 'misc_feature' feature (5571 to 5579) on strand 0,
 PmeI site 'misc_feature' feature (5571 to 5579) on strand 0,
 M13R 'misc_feature' feature (5579 to 5619) on strand 0,
 origin-extended 'misc_feature' feature (5804 to 5889) on strand 0,
 ori 'misc_feature' feature (5889 to 6744) on strand 0,
 is a g in normal maps. 'misc_feature' feature (6426 to 6427) on strand 0,
 bla 'misc_feature' feature (6744 to 7605) on strand 0,
 AmpR promoter 'misc_feature' feature (7605 to 7684) on strand 0,
 New Feature 'misc_feature' feature (7684 to 7704) on strand 0]

With all of these features, manual slicing is inconvenient. The .extract() method makes it easy to isolate features from a complex sequence:


In [6]:
# The beta-lactamase coding sequence, essential for propagation in *E. coli* on Amp/Carb media.
# Note that it is transcribed in the direction of the bottom strand (right to left on this sequence)
bla = [f for f in pKL278.features if f.name == 'bla'][0]
pKL278.extract(bla)


Out[6]:
TTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATC ... AAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT
AATGGTTACGAATTAGTCACTCCGTGGATAGAGTCGCTAG ... TTTTCCCTTATTCCCGCTGTGCCTTTACAACTTATGAGTA

The .features attribute is just a list of sequence.Feature objects - you can add or remove them at will using standard python list methods (like .pop and .append). The use of sequence.Feature will be covered in a different tutorial.

In addition, you can efficiently match patterns in your sequence using .locate(), which searches for a string on both the top and bottom strands, returning a tuple containing the indexes of the matches (top and bottom strands). In the following case, there are 8 matches for the top strand and 5 for the bottom strand. In the case of a palindromic query, only the top strand is reported.


In [7]:
pKL278.locate('atgcc')  # All occurrences of the pattern atgcc on the top and bottom strands (both 5'->3')


Out[7]:
[[78, 286, 1380, 2431, 4177, 4315, 7261, 7556], [737, 3718, 3828, 4131, 6939]]

Other methods

There are additional methods that can't be (easily) demonstrated in this tutorial.

The .ape() method will launch ApE with your sequence if it is found in your PATH environment variable. This enables some convenient analyses that are faster with a GUI like simulating a digest or viewing the general layout of annotations.