The largest challenge facing the usage of metagenomic approaches in microbiology is the need to extend traditional microbiology training to include metagenomic or sequencing data analysis. Sean Eddy (a compuational biologist at the Howard Hughes Medical Institute) nicely describes the impacts of high throughput sequencing on biology and its training in his keynote address (http://cryptogenomicon.org/2014/11/01/high-throughput-sequencing-for-neuroscience/#more-858).
To facilitate the barriers to microbiologists for metagenomic assembly, we have complemented this review with a tutorial of how to estimate the abundance of reference sequences (e.g., genes, contigs, etc.) in a metagenome. We include approaches that include using references that are both (i) available genome references or (ii) assembled from the metagenome. In general, to complete this tutorial and most metagenomic assembly, one would need:
The first step in this tutorial is to provide all users access to a server for which these instructions can be used, regardless of what computer you may be on. To do this, we'll be using cloud computing. More specifically, Amazon Web Services Elastic Compute Cloud. To rent compute time off of Amazon Web Services, you'll have to sign up and pay with a credit card. The cost is pretty manageable, http://aws.amazon.com/ec2/pricing/. You should be able to complete this tutorial in less than four hours, which comes out to < $1.
Once you are signed up for Amazon Web Services, you need to follow some instructions to launch a cloud "instance" or server. For this tutorial, we suggest you use the instructions from the Data Science Toolbox, http://datasciencetoolbox.org/#bundles. A couple things to note prior to running through those instructions:
If you have trouble logging into your instance and you are on a Mac or Linux OS:
Once you are logged into the instance, for example, you've successfully run the following command (except you'll have your own security file uniquely named and your own special EC2 address):
$ ssh -i MyKeyPair.pem ubuntu@ec2-XX-XX-XX-XXX.compute-1.amazonaws.com
And you now have a command line that looks like:
ubuntu@ip-10-181-106-120:
You need to do a couple things to get this tutorial running:
Copy and paste the following commands one by one into your command line and press ENTER after each one:
cd /mnt
sudo git clone https://github.com/germs-lab/frontiers-review-2015.git
Next, copy and paste the following command and enter a notebook password of your choice when prompted:
dst setup base
Then, copy and paste this command:
sudo ipython notebook --profile=dst --notebook-dir=/mnt/frontiers-review-2015
This will start up an IPython Notebook for this tutorial. Leave the terminal screen open and find your internet browser, preferablly Google Chrome. You'll also need the address for your EC2 instance public DNS that you used to log in above "e.g., ec2-XX-XX-XX-XXX". If you don't know it, you can always check on your AWS EC2 dashboard (see running instances) here, https://console.aws.amazon.com/ec2/v2/.
On your web browser, navigate to https://ec2-XX-XX-XX-XXX:8888 (except with your specific EC2 public DNS). Almost all web browsers will have a message that says you're heading to an unsafe place. Don't be alarmed. On Chrome, you can hit the "Advanced" options link and hit "Proceed anyways". Then, type in the password (password is the one you chose above), and voila, you'll see a notebook that contains this text called "frontiers-nb-2015".
IPython notebooks are very useful to collaboratively train bioinformatics. These notebooks have recently been featured in Nature News (http://www.nature.com/news/interactive-notebooks-sharing-the-code-1.16261 and http://www.nature.com/news/programming-pick-up-python-1.16833)
In using these notebooks, there are a few imporant things to note. There are two types of content in this tutorial: text and code. This content is placed in this notebook as "cells". If you click around on this page, you'll see different cells highlighted. To execute each cell (regardless of content), you hit on your keyboard SHIFT+ENTER. If the cell contains text, the content will be displayed directly. If the cell contains code, the code will then execute. Also, you can execute all cells in the notebook by going to the Cell tab where "File, Edit, View, Insert, Cell..." are in the top left of this webpage and selecting Run all.
We will begin this tutorial by downloading the HMP mock metagenome from the NCBI Short Read Archives (SRA). Many public metagenomes are stored as SRA files in the NCBI. The easiest way to get these SRA files is to use a special set of tools called the sratoolkit. If you have your dataset SRA run ID (in this case SRR172903), you can download the dataset and convert it to the standard "fasta" or "fastq" sequencing format is to use a special program to convert the file.
In [1]:
!wget http://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/2.4.5-2/sratoolkit.2.4.5-2-ubuntu64.tar.gz
--2015-06-26 13:48:38-- http://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/2.4.5-2/sratoolkit.2.4.5-2-ubuntu64.tar.gz
Resolving ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)... 130.14.250.11, 2607:f220:41e:250::10
Connecting to ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)|130.14.250.11|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 62432226 (60M) [application/x-gzip]
Saving to: ‘sratoolkit.2.4.5-2-ubuntu64.tar.gz’
100%[======================================>] 62,432,226 73.7MB/s in 0.8s
2015-06-26 13:48:39 (73.7 MB/s) - ‘sratoolkit.2.4.5-2-ubuntu64.tar.gz’ saved [62432226/62432226]
In [2]:
!tar -xvf sratoolkit.2.4.5-2-ubuntu64.tar.gz
sratoolkit.2.4.5-2-ubuntu64/
sratoolkit.2.4.5-2-ubuntu64/README
sratoolkit.2.4.5-2-ubuntu64/README-blastn
sratoolkit.2.4.5-2-ubuntu64/README-vdb-config
sratoolkit.2.4.5-2-ubuntu64/bin/
sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/
sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/default.kfg
sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/vdb-copy.kfg
sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump
sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/abi-load
sratoolkit.2.4.5-2-ubuntu64/bin/abi-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/abi-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/align-info
sratoolkit.2.4.5-2-ubuntu64/bin/align-info.2
sratoolkit.2.4.5-2-ubuntu64/bin/align-info.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/bam-load
sratoolkit.2.4.5-2-ubuntu64/bin/bam-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/bam-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb
sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb.2
sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb.2.2.30-2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr
sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr.2
sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/cg-load
sratoolkit.2.4.5-2-ubuntu64/bin/cg-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/cg-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load
sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/kar
sratoolkit.2.4.5-2-ubuntu64/bin/kar.2
sratoolkit.2.4.5-2-ubuntu64/bin/kar.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta
sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta.2
sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/latf-load
sratoolkit.2.4.5-2-ubuntu64/bin/latf-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/latf-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load
sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/prefetch
sratoolkit.2.4.5-2-ubuntu64/bin/prefetch.2
sratoolkit.2.4.5-2-ubuntu64/bin/prefetch.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain
sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain.2
sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser
sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser.2
sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump
sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump
sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sff-load
sratoolkit.2.4.5-2-ubuntu64/bin/sff-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/sff-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar
sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar.2
sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup
sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup.2
sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort
sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort.2
sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat
sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat.2
sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/srapath
sratoolkit.2.4.5-2-ubuntu64/bin/srapath.2
sratoolkit.2.4.5-2-ubuntu64/bin/srapath.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/srf-load
sratoolkit.2.4.5-2-ubuntu64/bin/srf-load.2
sratoolkit.2.4.5-2-ubuntu64/bin/srf-load.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb
sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb.2
sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb.2.2.30-2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/test-sra
sratoolkit.2.4.5-2-ubuntu64/bin/test-sra.2
sratoolkit.2.4.5-2-ubuntu64/bin/test-sra.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock.2.4.5
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate.2
sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate.2.4.5
sratoolkit.2.4.5-2-ubuntu64/example/
sratoolkit.2.4.5-2-ubuntu64/example/perl/
sratoolkit.2.4.5-2-ubuntu64/example/perl/base-stats.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/dump-reference.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/gene-lookup.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/mismatch-stats.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/quality-stats.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/simplefastq.pl
sratoolkit.2.4.5-2-ubuntu64/example/perl/splitfastq.pl
sratoolkit.2.4.5-2-ubuntu64/schema/
sratoolkit.2.4.5-2-ubuntu64/schema/align/
sratoolkit.2.4.5-2-ubuntu64/schema/align/align.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/align/mate-cache.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/align/qstat.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/align/refseq.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/align/seq.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/insdc/
sratoolkit.2.4.5-2-ubuntu64/schema/insdc/insdc.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/insdc/seq.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/insdc/sra.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/clip.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/ncbi.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/pnbrdb.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/seq-graph.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/seq.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/spotname.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/sra.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/stats.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/varloc.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/wgs-contig.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/
sratoolkit.2.4.5-2-ubuntu64/schema/sra/454.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/abi.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/helicos.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/illumina.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/ion-torrent.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/pacbio.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/sra/pevents.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/vdb/
sratoolkit.2.4.5-2-ubuntu64/schema/vdb/built-in.vschema
sratoolkit.2.4.5-2-ubuntu64/schema/vdb/vdb.vschema
You can see that we now have a file containing the software with the "ls" command. You'll also see this notebook in the list of files in the present location we are working in.
In [3]:
!ls
assemstats3.py khmer-install.sh
bowtie.sh kmer-count-plot.py
fastx_install.sh LICENSE.md
fetch-genomes-fasta.py ncbi_acc.txt
fraggenescan-install.sh README.md
frontiers-nb-2015.bu.ipynb remove_output.py
frontiers-nb-2015.ipynb sratoolkit.2.4.5-2-ubuntu64
install-megahit.sh sratoolkit.2.4.5-2-ubuntu64.tar.gz
ipython_notebook_config.py unique-kmers.py
khmer
Now we'll use the installed sratoolkit program to download the HMP mock dataset in "fastq" format. (This takes a minute or two. You'll find that patience is require for working with metagenomes. The nice thing about working in the cloud is that you are "renting" the computational power so it is not using your personal computer's memory -- freeing it up for things you can do while waiting. You'll note that you can see that "Kernel busy" will be shown on the top-right corner of the screen below "Logout" button.)
In [4]:
!sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump SRR172903
Read 7932819 spots for SRR172903
Written 7932819 spots for SRR172903
There are a number of methods to determine the quality of the sequencing data that you will assemble. First, one can look at the quality scores of your sequencing reads and if desired, trim reads with quality scores that are not sufficient for your needs. A vast number of tools are available to perform quality trimming of sequencing reads, including tools with nice tutorials including FastX Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/ and http://khmer-protocols.readthedocs.org/en/v0.8-1/metagenomics/1-quality.html), FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ and http://ged.msu.edu/angus/tutorials-2013/short-read-quality-evaluation.html) and Sickle (https://github.com/najoshi/sickle and http://2014-5-metagenomics-workshop.readthedocs.org/en/latest/assembly/qtrim.html).
The sequencing data file you have downloaded is a "fastq" text file, where data describing each sequencing read is shown on four lines. Let's take a quick look:
In [5]:
!head -n 4 SRR172903.fastq
@SRR172903.1 USI-EAS376:2:1:2:1414 length=75
CTTACCACCAGGAACNAACTTTGAGATTCCAAAAGATCGAGTACCAGAGGGATGGACAGTAACAGTAGATCCAGA
+SRR172903.1 USI-EAS376:2:1:2:1414 length=75
BB@BBBABB????<=%04@@>A?6><<AB@7:@A?@>A@AA8@>59==???887905<?6>25=###########
For this tutorial, we will be removing reads that have more than 50% of the read length with a Phred score of less than 33. We will be using Fastx-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/commandline.html) which can be used for many types of quality control (e.g., adapter trimming). First, we will download, uncompress, and then install this program.
In [6]:
!wget https://github.com/agordon/fastx_toolkit/releases/download/0.0.14/fastx_toolkit-0.0.14.tar.bz2
!wget https://github.com/agordon/libgtextutils/releases/download/0.7/libgtextutils-0.7.tar.gz
--2015-06-26 13:49:56-- https://github.com/agordon/fastx_toolkit/releases/download/0.0.14/fastx_toolkit-0.0.14.tar.bz2
Resolving github.com (github.com)... 192.30.252.131
Connecting to github.com (github.com)|192.30.252.131|:443... connected.
HTTP request sent, awaiting response... 302 Found
Location: https://s3.amazonaws.com/github-cloud/releases/14233196/f0821c9e-764e-11e3-99f0-a5603899c05f.bz2?response-content-disposition=attachment%3B%20filename%3Dfastx_toolkit-0.0.14.tar.bz2&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=Djr691B6%2B06IT0vVIfSLO%2FT1PF8%3D [following]
--2015-06-26 13:49:56-- https://s3.amazonaws.com/github-cloud/releases/14233196/f0821c9e-764e-11e3-99f0-a5603899c05f.bz2?response-content-disposition=attachment%3B%20filename%3Dfastx_toolkit-0.0.14.tar.bz2&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=Djr691B6%2B06IT0vVIfSLO%2FT1PF8%3D
Resolving s3.amazonaws.com (s3.amazonaws.com)... 54.231.13.104
Connecting to s3.amazonaws.com (s3.amazonaws.com)|54.231.13.104|:443... connected.
HTTP request sent, awaiting response... 200 OK
Length: 543018 (530K) [application/octet-stream]
Saving to: ‘fastx_toolkit-0.0.14.tar.bz2’
100%[======================================>] 543,018 --.-K/s in 0.01s
2015-06-26 13:49:56 (35.1 MB/s) - ‘fastx_toolkit-0.0.14.tar.bz2’ saved [543018/543018]
--2015-06-26 13:49:56-- https://github.com/agordon/libgtextutils/releases/download/0.7/libgtextutils-0.7.tar.gz
Resolving github.com (github.com)... 192.30.252.131
Connecting to github.com (github.com)|192.30.252.131|:443... connected.
HTTP request sent, awaiting response... 302 Found
Location: https://s3.amazonaws.com/github-cloud/releases/14094273/4a8d6664-764d-11e3-8b5c-5a4aa996a4a9.gz?response-content-disposition=attachment%3B%20filename%3Dlibgtextutils-0.7.tar.gz&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=q1YeK9XyC4UMf3nD0Xuu0NvBxvE%3D [following]
--2015-06-26 13:49:56-- https://s3.amazonaws.com/github-cloud/releases/14094273/4a8d6664-764d-11e3-8b5c-5a4aa996a4a9.gz?response-content-disposition=attachment%3B%20filename%3Dlibgtextutils-0.7.tar.gz&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=q1YeK9XyC4UMf3nD0Xuu0NvBxvE%3D
Resolving s3.amazonaws.com (s3.amazonaws.com)... 54.231.13.104
Connecting to s3.amazonaws.com (s3.amazonaws.com)|54.231.13.104|:443... connected.
HTTP request sent, awaiting response... 200 OK
Length: 358602 (350K) [application/octet-stream]
Saving to: ‘libgtextutils-0.7.tar.gz’
100%[======================================>] 358,602 --.-K/s in 0.01s
2015-06-26 13:49:56 (28.4 MB/s) - ‘libgtextutils-0.7.tar.gz’ saved [358602/358602]
In [7]:
!tar -xvf fastx_toolkit-0.0.14.tar.bz2
!tar -xvf libgtextutils-0.7.tar.gz
fastx_toolkit-0.0.14/
fastx_toolkit-0.0.14/Makefile.in
fastx_toolkit-0.0.14/m4/
fastx_toolkit-0.0.14/m4/Makefile.in
fastx_toolkit-0.0.14/m4/ax_cxx_header_stdcxx_tr1.m4
fastx_toolkit-0.0.14/m4/libtool.m4
fastx_toolkit-0.0.14/m4/ax_c_long_long.m4
fastx_toolkit-0.0.14/m4/Makefile.am
fastx_toolkit-0.0.14/m4/ax_cxx_compile_stdcxx_11.m4
fastx_toolkit-0.0.14/m4/lt~obsolete.m4
fastx_toolkit-0.0.14/m4/ltsugar.m4
fastx_toolkit-0.0.14/m4/ltversion.m4
fastx_toolkit-0.0.14/m4/ltoptions.m4
fastx_toolkit-0.0.14/doc/
fastx_toolkit-0.0.14/doc/Makefile.in
fastx_toolkit-0.0.14/doc/Makefile.am
fastx_toolkit-0.0.14/config.h.in
fastx_toolkit-0.0.14/Makefile.am
fastx_toolkit-0.0.14/install_galaxy_files.sh
fastx_toolkit-0.0.14/src/
fastx_toolkit-0.0.14/src/Makefile.in
fastx_toolkit-0.0.14/src/fastq_quality_converter/
fastx_toolkit-0.0.14/src/fastq_quality_converter/Makefile.in
fastx_toolkit-0.0.14/src/fastq_quality_converter/fastq_quality_converter.c
fastx_toolkit-0.0.14/src/fastq_quality_converter/Makefile.am
fastx_toolkit-0.0.14/src/fastq_quality_filter/
fastx_toolkit-0.0.14/src/fastq_quality_filter/Makefile.in
fastx_toolkit-0.0.14/src/fastq_quality_filter/Makefile.am
fastx_toolkit-0.0.14/src/fastq_quality_filter/fastq_quality_filter.c
fastx_toolkit-0.0.14/src/libfastx/
fastx_toolkit-0.0.14/src/libfastx/Makefile.in
fastx_toolkit-0.0.14/src/libfastx/fastx_args.c
fastx_toolkit-0.0.14/src/libfastx/Makefile.am
fastx_toolkit-0.0.14/src/libfastx/sequence_alignment.h
fastx_toolkit-0.0.14/src/libfastx/fastx_args.h
fastx_toolkit-0.0.14/src/libfastx/fastx.h
fastx_toolkit-0.0.14/src/libfastx/fastx.c
fastx_toolkit-0.0.14/src/libfastx/sequence_alignment.cpp
fastx_toolkit-0.0.14/src/libfastx/chomp.h
fastx_toolkit-0.0.14/src/libfastx/chomp.c
fastx_toolkit-0.0.14/src/fastx_trimmer/
fastx_toolkit-0.0.14/src/fastx_trimmer/Makefile.in
fastx_toolkit-0.0.14/src/fastx_trimmer/Makefile.am
fastx_toolkit-0.0.14/src/fastx_trimmer/fastx_trimmer.c
fastx_toolkit-0.0.14/src/Makefile.am
fastx_toolkit-0.0.14/src/fastx_reverse_complement/
fastx_toolkit-0.0.14/src/fastx_reverse_complement/Makefile.in
fastx_toolkit-0.0.14/src/fastx_reverse_complement/Makefile.am
fastx_toolkit-0.0.14/src/fastx_reverse_complement/fastx_reverse_complement.c
fastx_toolkit-0.0.14/src/fastx_collapser/
fastx_toolkit-0.0.14/src/fastx_collapser/Makefile.in
fastx_toolkit-0.0.14/src/fastx_collapser/fastx_collapser.cpp
fastx_toolkit-0.0.14/src/fastx_collapser/Makefile.am
fastx_toolkit-0.0.14/src/fastx_collapser/std_hash.h
fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/
fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/Makefile.in
fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/fasta_nucleotide_changer.c
fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/Makefile.am
fastx_toolkit-0.0.14/src/fastx_uncollapser/
fastx_toolkit-0.0.14/src/fastx_uncollapser/Makefile.in
fastx_toolkit-0.0.14/src/fastx_uncollapser/Makefile.am
fastx_toolkit-0.0.14/src/fastx_uncollapser/fastx_uncollapser.cpp
fastx_toolkit-0.0.14/src/fastq_quality_trimmer/
fastx_toolkit-0.0.14/src/fastq_quality_trimmer/Makefile.in
fastx_toolkit-0.0.14/src/fastq_quality_trimmer/Makefile.am
fastx_toolkit-0.0.14/src/fastq_quality_trimmer/fastq_quality_trimmer.c
fastx_toolkit-0.0.14/src/fastq_to_fasta/
fastx_toolkit-0.0.14/src/fastq_to_fasta/Makefile.in
fastx_toolkit-0.0.14/src/fastq_to_fasta/Makefile.am
fastx_toolkit-0.0.14/src/fastq_to_fasta/fastq_to_fasta.c
fastx_toolkit-0.0.14/src/fastx_renamer/
fastx_toolkit-0.0.14/src/fastx_renamer/Makefile.in
fastx_toolkit-0.0.14/src/fastx_renamer/fastx_renamer.c
fastx_toolkit-0.0.14/src/fastx_renamer/Makefile.am
fastx_toolkit-0.0.14/src/fastx_artifacts_filter/
fastx_toolkit-0.0.14/src/fastx_artifacts_filter/Makefile.in
fastx_toolkit-0.0.14/src/fastx_artifacts_filter/Makefile.am
fastx_toolkit-0.0.14/src/fastx_artifacts_filter/fastx_artifacts_filter.c
fastx_toolkit-0.0.14/src/fastq_masker/
fastx_toolkit-0.0.14/src/fastq_masker/Makefile.in
fastx_toolkit-0.0.14/src/fastq_masker/Makefile.am
fastx_toolkit-0.0.14/src/fastq_masker/fastq_masker.c
fastx_toolkit-0.0.14/src/fastx_quality_stats/
fastx_toolkit-0.0.14/src/fastx_quality_stats/Makefile.in
fastx_toolkit-0.0.14/src/fastx_quality_stats/Makefile.am
fastx_toolkit-0.0.14/src/fastx_quality_stats/fastx_quality_stats.c
fastx_toolkit-0.0.14/src/seqalign_test/
fastx_toolkit-0.0.14/src/seqalign_test/Makefile.in
fastx_toolkit-0.0.14/src/seqalign_test/Makefile.am
fastx_toolkit-0.0.14/src/seqalign_test/seqalign_test.cpp
fastx_toolkit-0.0.14/src/fastx_clipper/
fastx_toolkit-0.0.14/src/fastx_clipper/Makefile.in
fastx_toolkit-0.0.14/src/fastx_clipper/fastx_clipper.cpp
fastx_toolkit-0.0.14/src/fastx_clipper/Makefile.am
fastx_toolkit-0.0.14/src/fasta_formatter/
fastx_toolkit-0.0.14/src/fasta_formatter/Makefile.in
fastx_toolkit-0.0.14/src/fasta_formatter/Makefile.am
fastx_toolkit-0.0.14/src/fasta_formatter/sequence_writers.h
fastx_toolkit-0.0.14/src/fasta_formatter/fasta_formatter.cpp
fastx_toolkit-0.0.14/NEWS
fastx_toolkit-0.0.14/README
fastx_toolkit-0.0.14/configure.ac
fastx_toolkit-0.0.14/ChangeLog
fastx_toolkit-0.0.14/scripts/
fastx_toolkit-0.0.14/scripts/Makefile.in
fastx_toolkit-0.0.14/scripts/fastx_barcode_splitter.pl
fastx_toolkit-0.0.14/scripts/fastx_nucleotide_distribution_line_graph.sh
fastx_toolkit-0.0.14/scripts/fastx_nucleotide_distribution_graph.sh
fastx_toolkit-0.0.14/scripts/Makefile.am
fastx_toolkit-0.0.14/scripts/fasta_clipping_histogram.pl
fastx_toolkit-0.0.14/scripts/fastq_quality_boxplot_graph.sh
fastx_toolkit-0.0.14/build_scripts/
fastx_toolkit-0.0.14/build_scripts/Makefile.in
fastx_toolkit-0.0.14/build_scripts/build_on_opensolaris_2009.6.sh
fastx_toolkit-0.0.14/build_scripts/Makefile.am
fastx_toolkit-0.0.14/build_scripts/build_on_linux.sh
fastx_toolkit-0.0.14/COPYING
fastx_toolkit-0.0.14/galaxy/
fastx_toolkit-0.0.14/galaxy/Makefile.in
fastx_toolkit-0.0.14/galaxy/static/
fastx_toolkit-0.0.14/galaxy/static/Makefile.in
fastx_toolkit-0.0.14/galaxy/static/Makefile.am
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/Makefile.in
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/barcode_splitter_output_example.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/Makefile.am
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_3.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_line_graph.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_4.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastx_clipper_illustration.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastx_clipper_example.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png
fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png
fastx_toolkit-0.0.14/galaxy/test-data/
fastx_toolkit-0.0.14/galaxy/test-data/fastx_rev_comp2.fastq
fastx_toolkit-0.0.14/galaxy/test-data/Makefile.in
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer2.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_stats1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_stats1.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1a.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts2.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_reverse_complement1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2n.out
fastx_toolkit-0.0.14/galaxy/test-data/fasta_collapser1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fasta_collapser1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1b.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer2.fastq
fastx_toolkit-0.0.14/galaxy/test-data/Makefile.am
fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer2.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1b.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts2.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.txt
fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_reverse_complement2.out
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1a.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1a.out
fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_clipper1a.out
fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer2.out
fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter2.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_rev_comp1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter1.out
fastx_toolkit-0.0.14/galaxy/test-data/fastx_clipper1.fastq
fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter1.fasta
fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.fastq
fastx_toolkit-0.0.14/galaxy/Makefile.am
fastx_toolkit-0.0.14/galaxy/README
fastx_toolkit-0.0.14/galaxy/tools/
fastx_toolkit-0.0.14/galaxy/tools/Makefile.in
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/Makefile.in
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_barcode_splitter_galaxy_wrapper.sh
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_trimmer.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_clipper.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution_line.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/Makefile.am
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_masker.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_uncollapser.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_renamer.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_trimmer.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_trimmer_from_end.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/seqid_uncollapser.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_collapser.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_formatter.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml
fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_nucleotide_changer.xml
fastx_toolkit-0.0.14/galaxy/tools/Makefile.am
fastx_toolkit-0.0.14/galaxy/tool-data/
fastx_toolkit-0.0.14/galaxy/tool-data/Makefile.in
fastx_toolkit-0.0.14/galaxy/tool-data/fastx_clipper_sequences.txt
fastx_toolkit-0.0.14/galaxy/tool-data/Makefile.am
fastx_toolkit-0.0.14/galaxy/fastx_toolkit_conf.xml
fastx_toolkit-0.0.14/INSTALL
fastx_toolkit-0.0.14/aclocal.m4
fastx_toolkit-0.0.14/AUTHORS
fastx_toolkit-0.0.14/reconf
fastx_toolkit-0.0.14/THANKS
fastx_toolkit-0.0.14/config/
fastx_toolkit-0.0.14/config/install-sh
fastx_toolkit-0.0.14/config/compile
fastx_toolkit-0.0.14/config/missing
fastx_toolkit-0.0.14/config/depcomp
fastx_toolkit-0.0.14/config/config.guess
fastx_toolkit-0.0.14/config/ltmain.sh
fastx_toolkit-0.0.14/config/config.sub
fastx_toolkit-0.0.14/configure
libgtextutils-0.7/
libgtextutils-0.7/Makefile.in
libgtextutils-0.7/m4/
libgtextutils-0.7/m4/Makefile.in
libgtextutils-0.7/m4/libtool.m4
libgtextutils-0.7/m4/Makefile.am
libgtextutils-0.7/m4/lt~obsolete.m4
libgtextutils-0.7/m4/ltsugar.m4
libgtextutils-0.7/m4/ltversion.m4
libgtextutils-0.7/m4/ltoptions.m4
libgtextutils-0.7/doc/
libgtextutils-0.7/doc/Makefile.in
libgtextutils-0.7/doc/Makefile.am
libgtextutils-0.7/gtextutils.pc.in
libgtextutils-0.7/config.h.in
libgtextutils-0.7/Makefile.am
libgtextutils-0.7/src/
libgtextutils-0.7/src/Makefile.in
libgtextutils-0.7/src/gtextutils/
libgtextutils-0.7/src/gtextutils/Makefile.in
libgtextutils-0.7/src/gtextutils/outbuf3.hpp
libgtextutils-0.7/src/gtextutils/text_line_reader.h
libgtextutils-0.7/src/gtextutils/pipe_fitter.c
libgtextutils-0.7/src/gtextutils/stream_wrapper.cpp
libgtextutils-0.7/src/gtextutils/tuple_parser.h
libgtextutils-0.7/src/gtextutils/Makefile.am
libgtextutils-0.7/src/gtextutils/string_tokenize.h
libgtextutils-0.7/src/gtextutils/pipe_fitter.h
libgtextutils-0.7/src/gtextutils/stream_wrapper.h
libgtextutils-0.7/src/gtextutils/strnatcmp.h
libgtextutils-0.7/src/gtextutils/exit_manip.h
libgtextutils-0.7/src/gtextutils/inbuf1.hpp
libgtextutils-0.7/src/gtextutils/text_line_reader.cpp
libgtextutils-0.7/src/gtextutils/strnatcmp.c
libgtextutils-0.7/src/gtextutils/container_join.h
libgtextutils-0.7/src/gtextutils/natsort.h
libgtextutils-0.7/src/Makefile.am
libgtextutils-0.7/NEWS
libgtextutils-0.7/README
libgtextutils-0.7/configure.ac
libgtextutils-0.7/ChangeLog
libgtextutils-0.7/COPYING
libgtextutils-0.7/INSTALL
libgtextutils-0.7/aclocal.m4
libgtextutils-0.7/tests/
libgtextutils-0.7/tests/test_string_tokenize.cpp
libgtextutils-0.7/tests/Makefile.in
libgtextutils-0.7/tests/test_tuple_parser.cpp
libgtextutils-0.7/tests/test_tuple_parser_file.cpp
libgtextutils-0.7/tests/test_fd_inbuf.cpp
libgtextutils-0.7/tests/test_text_reader_unget.cpp
libgtextutils-0.7/tests/test_container_join.cpp
libgtextutils-0.7/tests/Makefile.am
libgtextutils-0.7/tests/test_pipe_fitter.c
libgtextutils-0.7/tests/test_natural_sort.cpp
libgtextutils-0.7/tests/tests_assertion.h
libgtextutils-0.7/tests/test_text_reader.cpp
libgtextutils-0.7/tests/test_in_out_buf.cpp
libgtextutils-0.7/tests/test_input_stream_wrapper.cpp
libgtextutils-0.7/tests/test_fd_outbuf.cpp
libgtextutils-0.7/AUTHORS
libgtextutils-0.7/reconf
libgtextutils-0.7/THANKS
libgtextutils-0.7/config/
libgtextutils-0.7/config/install-sh
libgtextutils-0.7/config/compile
libgtextutils-0.7/config/missing
libgtextutils-0.7/config/test-driver
libgtextutils-0.7/config/depcomp
libgtextutils-0.7/config/config.guess
libgtextutils-0.7/config/ltmain.sh
libgtextutils-0.7/config/config.sub
libgtextutils-0.7/configure
In [16]:
!bash fastx_install.sh
g++ is already the newest version.
gcc is already the newest version.
pkg-config is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 14 not upgraded.
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
/mnt/frontiers-review-2015/libgtextutils-0.7/config/missing: Unknown `--is-lightweight' option
Try `/mnt/frontiers-review-2015/libgtextutils-0.7/config/missing --help' for more information
configure: WARNING: 'missing' script is too old or missing
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking whether make supports nested variables... yes
checking for gcc... gcc
checking whether the C compiler works... yes
checking for C compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking whether gcc understands -c and -o together... yes
checking for style of include used by make... GNU
checking dependency style of gcc... gcc3
checking for g++... g++
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking dependency style of g++... gcc3
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for a sed that does not truncate output... /bin/sed
checking for grep that handles long lines and -e... /bin/grep
checking for egrep... /bin/grep -E
checking for fgrep... /bin/grep -F
checking for ld used by gcc... /usr/bin/ld
checking if the linker (/usr/bin/ld) is GNU ld... yes
checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B
checking the name lister (/usr/bin/nm -B) interface... BSD nm
checking whether ln -s works... yes
checking the maximum length of command line arguments... 1572864
checking whether the shell understands some XSI constructs... yes
checking whether the shell understands "+="... yes
checking for /usr/bin/ld option to reload object files... -r
checking for objdump... objdump
checking how to recognize dependent libraries... pass_all
checking for ar... ar
checking for strip... strip
checking for ranlib... ranlib
checking command to parse /usr/bin/nm -B output from gcc object... ok
checking how to run the C preprocessor... gcc -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking for dlfcn.h... yes
checking whether we are using the GNU C++ compiler... (cached) yes
checking whether g++ accepts -g... (cached) yes
checking dependency style of g++... (cached) gcc3
checking how to run the C++ preprocessor... g++ -E
checking for objdir... .libs
checking if gcc supports -fno-rtti -fno-exceptions... no
checking for gcc option to produce PIC... -fPIC -DPIC
checking if gcc PIC flag -fPIC -DPIC works... yes
checking if gcc static flag -static works... yes
checking if gcc supports -c -o file.o... yes
checking if gcc supports -c -o file.o... (cached) yes
checking whether the gcc linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking whether -lc should be explicitly linked in... no
checking dynamic linker characteristics... GNU/Linux ld.so
checking how to hardcode library paths into programs... immediate
checking whether stripping libraries is possible... yes
checking if libtool supports shared libraries... yes
checking whether to build shared libraries... yes
checking whether to build static libraries... yes
checking for ld used by g++... /usr/bin/ld -m elf_x86_64
checking if the linker (/usr/bin/ld -m elf_x86_64) is GNU ld... yes
checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking for g++ option to produce PIC... -fPIC -DPIC
checking if g++ PIC flag -fPIC -DPIC works... yes
checking if g++ static flag -static works... yes
checking if g++ supports -c -o file.o... yes
checking if g++ supports -c -o file.o... (cached) yes
checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking dynamic linker characteristics... GNU/Linux ld.so
checking how to hardcode library paths into programs... immediate
checking that generated files are newer than configure... done
configure: creating ./config.status
config.status: creating Makefile
config.status: creating doc/Makefile
config.status: creating m4/Makefile
config.status: creating src/Makefile
config.status: creating src/gtextutils/Makefile
config.status: creating gtextutils.pc
config.status: creating tests/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
config.status: executing libtool commands
make all-recursive
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
Making all in m4
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
Making all in src
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
Making all in gtextutils
make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[3]: Nothing to be done for `all-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
Making all in doc
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
Making all in tests
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
Making install in m4
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
make[2]: Nothing to be done for `install-exec-am'.
/bin/mkdir -p '/usr/local/share/aclocal'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'
Making install in src
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
Making install in gtextutils
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
/bin/mkdir -p '/usr/local/lib'
/bin/bash ../../libtool --mode=install /usr/bin/install -c libgtextutils.la '/usr/local/lib'
libtool: install: /usr/bin/install -c .libs/libgtextutils-0.7.so.0.0.0 /usr/local/lib/libgtextutils-0.7.so.0.0.0
libtool: install: (cd /usr/local/lib && { ln -s -f libgtextutils-0.7.so.0.0.0 libgtextutils-0.7.so.0 || { rm -f libgtextutils-0.7.so.0 && ln -s libgtextutils-0.7.so.0.0.0 libgtextutils-0.7.so.0; }; })
libtool: install: (cd /usr/local/lib && { ln -s -f libgtextutils-0.7.so.0.0.0 libgtextutils.so || { rm -f libgtextutils.so && ln -s libgtextutils-0.7.so.0.0.0 libgtextutils.so; }; })
libtool: install: /usr/bin/install -c .libs/libgtextutils.lai /usr/local/lib/libgtextutils.la
libtool: install: /usr/bin/install -c .libs/libgtextutils.a /usr/local/lib/libgtextutils.a
libtool: install: chmod 644 /usr/local/lib/libgtextutils.a
libtool: install: ranlib /usr/local/lib/libgtextutils.a
libtool: finish: PATH="/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/sbin" ldconfig -n /usr/local/lib
----------------------------------------------------------------------
Libraries have been installed in:
/usr/local/lib
If you ever happen to want to link against installed libraries
in a given directory, LIBDIR, you must either use libtool, and
specify the full pathname of the library, or use the `-LLIBDIR'
flag during linking and do at least one of the following:
- add LIBDIR to the `LD_LIBRARY_PATH' environment variable
during execution
- add LIBDIR to the `LD_RUN_PATH' environment variable
during linking
- use the `-Wl,-rpath -Wl,LIBDIR' linker flag
- have your system administrator add LIBDIR to `/etc/ld.so.conf'
See any operating system documentation about shared libraries for
more information, such as the ld(1) and ld.so(8) manual pages.
----------------------------------------------------------------------
/bin/mkdir -p '/usr/local/include/gtextutils/gtextutils'
/usr/bin/install -c -m 644 container_join.h text_line_reader.h stream_wrapper.h natsort.h strnatcmp.h outbuf3.hpp inbuf1.hpp tuple_parser.h exit_manip.h string_tokenize.h pipe_fitter.h '/usr/local/include/gtextutils/gtextutils'
make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'
Making install in doc
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
make[2]: Nothing to be done for `install-exec-am'.
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'
Making install in tests
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[2]: Nothing to be done for `install-exec-am'.
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'
make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
make[2]: Nothing to be done for `install-exec-am'.
/bin/mkdir -p '/usr/local/lib/pkgconfig'
/usr/bin/install -c -m 644 gtextutils.pc '/usr/local/lib/pkgconfig'
make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking whether make supports nested variables... yes
checking for gcc... gcc
checking whether the C compiler works... yes
checking for C compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking whether gcc understands -c and -o together... yes
checking for style of include used by make... GNU
checking dependency style of gcc... gcc3
checking for g++... g++
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking dependency style of g++... gcc3
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for a sed that does not truncate output... /bin/sed
checking for grep that handles long lines and -e... /bin/grep
checking for egrep... /bin/grep -E
checking for fgrep... /bin/grep -F
checking for ld used by gcc... /usr/bin/ld
checking if the linker (/usr/bin/ld) is GNU ld... yes
checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B
checking the name lister (/usr/bin/nm -B) interface... BSD nm
checking whether ln -s works... yes
checking the maximum length of command line arguments... 1572864
checking whether the shell understands some XSI constructs... yes
checking whether the shell understands "+="... yes
checking for /usr/bin/ld option to reload object files... -r
checking for objdump... objdump
checking how to recognize dependent libraries... pass_all
checking for ar... ar
checking for strip... strip
checking for ranlib... ranlib
checking command to parse /usr/bin/nm -B output from gcc object... ok
checking how to run the C preprocessor... gcc -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking for dlfcn.h... yes
checking whether we are using the GNU C++ compiler... (cached) yes
checking whether g++ accepts -g... (cached) yes
checking dependency style of g++... (cached) gcc3
checking how to run the C++ preprocessor... g++ -E
checking for objdir... .libs
checking if gcc supports -fno-rtti -fno-exceptions... no
checking for gcc option to produce PIC... -fPIC -DPIC
checking if gcc PIC flag -fPIC -DPIC works... yes
checking if gcc static flag -static works... yes
checking if gcc supports -c -o file.o... yes
checking if gcc supports -c -o file.o... (cached) yes
checking whether the gcc linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking whether -lc should be explicitly linked in... no
checking dynamic linker characteristics... GNU/Linux ld.so
checking how to hardcode library paths into programs... immediate
checking whether stripping libraries is possible... yes
checking if libtool supports shared libraries... yes
checking whether to build shared libraries... yes
checking whether to build static libraries... yes
checking for ld used by g++... /usr/bin/ld -m elf_x86_64
checking if the linker (/usr/bin/ld -m elf_x86_64) is GNU ld... yes
checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking for g++ option to produce PIC... -fPIC -DPIC
checking if g++ PIC flag -fPIC -DPIC works... yes
checking if g++ static flag -static works... yes
checking if g++ supports -c -o file.o... yes
checking if g++ supports -c -o file.o... (cached) yes
checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes
checking dynamic linker characteristics... GNU/Linux ld.so
checking how to hardcode library paths into programs... immediate
checking for long long int... yes
checking for ISO C++ TR1 include files... yes
checking whether g++ supports C++11 features by default... no
checking whether g++ supports C++11 features with -std=c++11... yes
checking for pkg-config... /usr/bin/pkg-config
checking pkg-config is at least version 0.9.0... yes
checking for GTEXTUTILS... yes
checking that generated files are newer than configure... done
configure: creating ./config.status
config.status: creating Makefile
config.status: creating doc/Makefile
config.status: creating m4/Makefile
config.status: creating src/Makefile
config.status: creating src/libfastx/Makefile
config.status: creating src/fastx_clipper/Makefile
config.status: creating src/fastq_to_fasta/Makefile
config.status: creating src/fastx_quality_stats/Makefile
config.status: creating src/fastq_quality_converter/Makefile
config.status: creating src/fastx_trimmer/Makefile
config.status: creating src/fastq_quality_filter/Makefile
config.status: creating src/fastq_quality_trimmer/Makefile
config.status: creating src/fastx_artifacts_filter/Makefile
config.status: creating src/fastx_reverse_complement/Makefile
config.status: creating src/fastx_collapser/Makefile
config.status: creating src/fastx_uncollapser/Makefile
config.status: creating src/seqalign_test/Makefile
config.status: creating src/fasta_formatter/Makefile
config.status: creating src/fasta_nucleotide_changer/Makefile
config.status: creating src/fastx_renamer/Makefile
config.status: creating src/fastq_masker/Makefile
config.status: creating galaxy/Makefile
config.status: creating galaxy/tools/Makefile
config.status: creating galaxy/tools/fastx_toolkit/Makefile
config.status: creating galaxy/test-data/Makefile
config.status: creating galaxy/static/Makefile
config.status: creating galaxy/static/fastx_icons/Makefile
config.status: creating galaxy/tool-data/Makefile
config.status: creating scripts/Makefile
config.status: creating build_scripts/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
config.status: executing libtool commands
make all-recursive
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
Making all in m4
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
Making all in src
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
Making all in libfastx
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
Making all in fastx_clipper
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
Making all in fastx_trimmer
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
Making all in fastx_quality_stats
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
Making all in fastq_quality_converter
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
Making all in fastq_to_fasta
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
Making all in fastq_quality_filter
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
Making all in fastq_quality_trimmer
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
Making all in fastx_artifacts_filter
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
Making all in fastx_reverse_complement
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
Making all in fastx_collapser
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
Making all in fastx_uncollapser
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
g++ -DHAVE_CONFIG_H -I. -I../.. -I/usr/local/include/gtextutils -I../../src/libfastx -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -MT fastx_uncollapser.o -MD -MP -MF .deps/fastx_uncollapser.Tpo -c -o fastx_uncollapser.o fastx_uncollapser.cpp
mv -f .deps/fastx_uncollapser.Tpo .deps/fastx_uncollapser.Po
/bin/bash ../../libtool --tag=CXX --mode=link g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fastx_uncollapser fastx_uncollapser.o -L/usr/local/lib -lgtextutils ../libfastx/libfastx.a
libtool: link: g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fastx_uncollapser fastx_uncollapser.o -L/usr/local/lib /usr/local/lib/libgtextutils.so ../libfastx/libfastx.a
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
Making all in seqalign_test
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
Making all in fasta_formatter
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
g++ -DHAVE_CONFIG_H -I. -I../.. -I/usr/local/include/gtextutils -I../../src/libfastx -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -MT fasta_formatter.o -MD -MP -MF .deps/fasta_formatter.Tpo -c -o fasta_formatter.o fasta_formatter.cpp
mv -f .deps/fasta_formatter.Tpo .deps/fasta_formatter.Po
/bin/bash ../../libtool --tag=CXX --mode=link g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fasta_formatter fasta_formatter.o -L/usr/local/lib -lgtextutils ../libfastx/libfastx.a
libtool: link: g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fasta_formatter fasta_formatter.o -L/usr/local/lib /usr/local/lib/libgtextutils.so ../libfastx/libfastx.a
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
Making all in fasta_nucleotide_changer
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
Making all in fastx_renamer
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
Making all in fastq_masker
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[3]: Nothing to be done for `all-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
Making all in doc
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
Making all in galaxy
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
Making all in tools
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
Making all in fastx_toolkit
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[4]: Nothing to be done for `all'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[4]: Nothing to be done for `all-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
Making all in test-data
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
Making all in static
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
Making all in fastx_icons
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[4]: Nothing to be done for `all'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[4]: Nothing to be done for `all-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
Making all in tool-data
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[3]: Nothing to be done for `all'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[3]: Nothing to be done for `all-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
Making all in scripts
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
Making all in build_scripts
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
Making install in m4
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
make[2]: Nothing to be done for `install-exec-am'.
/bin/mkdir -p '/usr/local/share/aclocal'
/usr/bin/install -c -m 644 ax_c_long_long.m4 ax_cxx_compile_stdcxx_11.m4 ax_cxx_header_stdcxx_tr1.m4 '/usr/local/share/aclocal'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'
Making install in src
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
Making install in libfastx
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'
Making install in fastx_clipper
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_clipper '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_clipper /usr/local/bin/fastx_clipper
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'
Making install in fastx_trimmer
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_trimmer '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_trimmer /usr/local/bin/fastx_trimmer
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'
Making install in fastx_quality_stats
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_quality_stats '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_quality_stats /usr/local/bin/fastx_quality_stats
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'
Making install in fastq_quality_converter
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastq_quality_converter '/usr/local/bin'
libtool: install: /usr/bin/install -c fastq_quality_converter /usr/local/bin/fastq_quality_converter
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'
Making install in fastq_to_fasta
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastq_to_fasta '/usr/local/bin'
libtool: install: /usr/bin/install -c fastq_to_fasta /usr/local/bin/fastq_to_fasta
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'
Making install in fastq_quality_filter
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastq_quality_filter '/usr/local/bin'
libtool: install: /usr/bin/install -c fastq_quality_filter /usr/local/bin/fastq_quality_filter
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'
Making install in fastq_quality_trimmer
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastq_quality_trimmer '/usr/local/bin'
libtool: install: /usr/bin/install -c fastq_quality_trimmer /usr/local/bin/fastq_quality_trimmer
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'
Making install in fastx_artifacts_filter
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_artifacts_filter '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_artifacts_filter /usr/local/bin/fastx_artifacts_filter
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'
Making install in fastx_reverse_complement
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_reverse_complement '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_reverse_complement /usr/local/bin/fastx_reverse_complement
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'
Making install in fastx_collapser
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_collapser '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_collapser /usr/local/bin/fastx_collapser
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'
Making install in fastx_uncollapser
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_uncollapser '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_uncollapser /usr/local/bin/fastx_uncollapser
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'
Making install in seqalign_test
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'
Making install in fasta_formatter
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fasta_formatter '/usr/local/bin'
libtool: install: /usr/bin/install -c fasta_formatter /usr/local/bin/fasta_formatter
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'
Making install in fasta_nucleotide_changer
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fasta_nucleotide_changer '/usr/local/bin'
libtool: install: /usr/bin/install -c fasta_nucleotide_changer /usr/local/bin/fasta_nucleotide_changer
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'
Making install in fastx_renamer
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastx_renamer '/usr/local/bin'
libtool: install: /usr/bin/install -c fastx_renamer /usr/local/bin/fastx_renamer
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'
Making install in fastq_masker
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
/bin/mkdir -p '/usr/local/bin'
/bin/bash ../../libtool --mode=install /usr/bin/install -c fastq_masker '/usr/local/bin'
libtool: install: /usr/bin/install -c fastq_masker /usr/local/bin/fastq_masker
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'
Making install in doc
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
make[2]: Nothing to be done for `install-exec-am'.
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'
Making install in galaxy
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
Making install in tools
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
Making install in fastx_toolkit
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[4]: Nothing to be done for `install-exec-am'.
make[4]: Nothing to be done for `install-data-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[4]: Nothing to be done for `install-exec-am'.
make[4]: Nothing to be done for `install-data-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'
Making install in test-data
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'
Making install in static
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
Making install in fastx_icons
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[4]: Nothing to be done for `install-exec-am'.
make[4]: Nothing to be done for `install-data-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[4]: Nothing to be done for `install-exec-am'.
make[4]: Nothing to be done for `install-data-am'.
make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'
Making install in tool-data
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[3]: Nothing to be done for `install-exec-am'.
make[3]: Nothing to be done for `install-data-am'.
make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'
Making install in scripts
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
/bin/mkdir -p '/usr/local/bin'
/usr/bin/install -c fastx_barcode_splitter.pl fastx_nucleotide_distribution_graph.sh fastx_nucleotide_distribution_line_graph.sh fastq_quality_boxplot_graph.sh fasta_clipping_histogram.pl '/usr/local/bin'
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'
Making install in build_scripts
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[2]: Nothing to be done for `install-exec-am'.
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'
make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
make[2]: Nothing to be done for `install-exec-am'.
make[2]: Nothing to be done for `install-data-am'.
make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'
Now, we will perform the quality filtering saving the quality-filtered file as SRR172903.qc.fastq:
FASTQ Quality Filter
$ fastq_quality_filter -h usage: fastq_quality_filter [-h] [-v] [-q N] [-p N] [-z] [-i INFILE] [-o OUTFILE]
version 0.0.6
[-h] = This helpful help screen.
[-q N] = Minimum quality score to keep.
[-p N] = Minimum percent of bases that must have [-q] quality.
[-z] = Compress output with GZIP.
[-i INFILE] = FASTA/Q input file. default is STDIN.
[-o OUTFILE] = FASTA/Q output file. default is STDOUT.
[-v] = Verbose - report number of sequences.
If [-o] is specified, report will be printed to STDOUT.
If [-o] is not specified (and output goes to STDOUT),
report will be printed to STDERR.
In [17]:
!fastq_quality_filter -q 33 -p 50 -i SRR172903.fastq > SRR172903.qc.fastq
An advantage of metagenomic sequencing is the ability to quantify microbial diversity in an environment without the need to first cultivate cells. Typically, most studies access taxonomic diversity (especially with the usage of targeted sequencing of the 16S rRNA gene*). Diversity can also be measured in the representation of specific sequence patterns in a metagenome. For example, one can quantify the abundance of unique nucleotide "words" of length K, or k-mers, in a metagenome. These k-mers can also be used in the assembly of metagenomes where overlapping k-mers are indicative of reads that should be connected together. The diversity of these k-mers can give you insight into the the diversity of your sample. Further, since assembly compares each k-mer against all k-mers, larger numbers of k-mers present will require more computational memory. A nice review on k-mers and assembly is Miller et al.
(*Note that 16S rRNA amplicon sequencing is a targeted approach and not considered metagenomics in this review. Shotgun metagenomic sequencing uses DNA extracted from all cells in a community and sequenced. Targeted sequencing amplifies a specific genomic locus and independently sequenced. A great review on metagenome analysis is Sharpton et al.)
The first thing we will do is install khmer (www.github.com/ged-lab/khmer) -- it contains a suite of khmer and pre-assembly tools. We will use it for k-mer counting here. Once you run the script below, you can use khmer's many tools.
In [18]:
!ls
assemstats3.py kmer-count-plot.py
bowtie.sh libgtextutils-0.7
fastx_install.sh libgtextutils-0.7.tar.gz
fastx_toolkit-0.0.14 LICENSE.md
fastx_toolkit-0.0.14.tar.bz2 ncbi_acc.txt
fetch-genomes-fasta.py README.md
fraggenescan-install.sh remove_output.py
frontiers-nb-2015.bu.ipynb sratoolkit.2.4.5-2-ubuntu64
frontiers-nb-2015.ipynb sratoolkit.2.4.5-2-ubuntu64.tar.gz
install-megahit.sh SRR172903.fastq
ipython_notebook_config.py SRR172903.qc.fastq
khmer unique-kmers.py
khmer-install.sh
In [19]:
!bash khmer-install.sh
Cloning into 'khmer'...
remote: Counting objects: 33672, done.
remote: Compressing objects: 100% (153/153), done.
remote: Total 33672 (delta 82), reused 0 (delta 0), pack-reused 33519
Receiving objects: 100% (33672/33672), 107.68 MiB | 4.25 MiB/s, done.
Resolving deltas: 100% (22993/22993), done.
Checking connectivity... done
running install
Checking .pth file support in /usr/local/lib/python2.7/dist-packages/
/usr/bin/python -E -c pass
TEST PASSED: /usr/local/lib/python2.7/dist-packages/ appears to support .pth files
running bdist_egg
running egg_info
creating khmer.egg-info
writing requirements to khmer.egg-info/requires.txt
writing khmer.egg-info/PKG-INFO
writing top-level names to khmer.egg-info/top_level.txt
writing dependency_links to khmer.egg-info/dependency_links.txt
writing entry points to khmer.egg-info/entry_points.txt
writing manifest file 'khmer.egg-info/SOURCES.txt'
reading manifest file 'khmer.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no previously-included files found matching 'third-party/zlib/Makefile'
warning: no previously-included files found matching 'third-party/zlib/zconf.h'
warning: no previously-included files matching '*.orig' found anywhere in distribution
warning: no previously-included files matching '*.pyc' found anywhere in distribution
writing manifest file 'khmer.egg-info/SOURCES.txt'
installing library code to build/bdist.linux-x86_64/egg
running install_lib
running build_py
creating build
creating build/lib.linux-x86_64-2.7
creating build/lib.linux-x86_64-2.7/khmer
copying khmer/kfile.py -> build/lib.linux-x86_64-2.7/khmer
copying khmer/khmer_args.py -> build/lib.linux-x86_64-2.7/khmer
copying khmer/thread_utils.py -> build/lib.linux-x86_64-2.7/khmer
copying khmer/utils.py -> build/lib.linux-x86_64-2.7/khmer
copying khmer/__init__.py -> build/lib.linux-x86_64-2.7/khmer
copying khmer/_version.py -> build/lib.linux-x86_64-2.7/khmer
creating build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_scripts.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_threaded_sequence_processor.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_functions.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_hll.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_counting_single.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_read_aligner.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_labelhash.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_normalize_by_median.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_subset_graph.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/__init__.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_counting_hash.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_hashbits.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_hashbits_obj.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_version.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_graph.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_filter.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/khmer_tst_utils.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_script_arguments.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_sandbox_scripts.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_read_parsers.py -> build/lib.linux-x86_64-2.7/khmer/tests
copying tests/test_lump.py -> build/lib.linux-x86_64-2.7/khmer/tests
creating build/lib.linux-x86_64-2.7/oxli
copying oxli/functions.py -> build/lib.linux-x86_64-2.7/oxli
copying oxli/build_graph.py -> build/lib.linux-x86_64-2.7/oxli
copying oxli/__init__.py -> build/lib.linux-x86_64-2.7/oxli
copying khmer/_khmer.cc -> build/lib.linux-x86_64-2.7/khmer
copying tests/.gitignore -> build/lib.linux-x86_64-2.7/khmer/tests
creating build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/100-reads.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/100-reads.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/100-reads.fq.truncated.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/100-reads.fq.truncated.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/all-A.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/badversion-k12.ct -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/badversion-k12.ht -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/badversion-k32.stoptags -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/badversion-k32.tagset -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/biglump-random-20-a.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/casava_18-pe.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/combine_parts_1.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/dn-test-all-paired-all-keep.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/dn-test-none-paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/dn-test-some-paired-all-keep.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/empty-file -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/fakelump.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/fakelump.fa.stoptags.txt -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/filter-test-A.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/filter-test-B.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/goodversion-k12.ht -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/goodversion-k12.ht.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/goodversion-k32.stoptags -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/goodversion-k32.tagset -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/normC20k20.ct -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/old-style-format-w-comments.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/overlap.out -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken2.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken2.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken3.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-broken3.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed-2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed-broken.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fa.pe -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fa.se -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fq.pe -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired-mixed.fq.se -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fa.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fa.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/paired_one.base.dif.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-X2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.even.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fa.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fa.part -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-a.odd.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-20-b.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/random-31-c.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/real-partition-small.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/real-partition-tiny.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/single-read.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.fa.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-2.paired2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-3.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-impaired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read-paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-abund-read.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-empty.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-empty.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-error-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-fastq-n-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-fastq-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-filter-abund-Ns.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-graph.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-graph2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-graph5.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-labels.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-large.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-output-partitions.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-overlap1.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-overlap2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-reads.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-reads.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-reads.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-short.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-sweep-contigs.fp -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-sweep-reads.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-sweep-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/test-transcript.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
copying tests/test-data/truncated.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data
running build_ext
bash -c cd third-party/zlib && ( test Makefile -nt configure || bash ./configure --static ) && make -f Makefile.pic PIC
Checking for gcc...
Building static library libz.a version 1.2.8 with gcc.
Checking for off64_t... Yes.
Checking for fseeko... Yes.
Checking for strerror... Yes.
Checking for unistd.h... Yes.
Checking for stdarg.h... Yes.
Checking whether to use vs[n]printf() or s[n]printf()... using vs[n]printf().
Checking for vsnprintf() in stdio.h... Yes.
Checking for return value of vsnprintf()... Yes.
Checking for attribute(visibility) support... Yes.
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/adler32.o adler32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/crc32.o crc32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/deflate.o deflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/infback.o infback.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inffast.o inffast.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inflate.o inflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inftrees.o inftrees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/trees.o trees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/zutil.o zutil.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/compress.o compress.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/uncompr.o uncompr.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzclose.o gzclose.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzlib.o gzlib.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzread.o gzread.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzwrite.o gzwrite.c
bash -c cd third-party/bzip2 && make -f Makefile-libbz2_so all
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c blocksort.c
In function ‘mainSort’:
blocksort.c:347:6: warning: inlining failed in call to ‘mainGtU.part.0’: call is unlikely and code size would grow [-Winline]
Bool mainGtU ( UInt32 i1,
^
cc1: warning: called from here [-Winline]
blocksort.c:347:6: warning: inlining failed in call to ‘mainGtU.part.0’: call is unlikely and code size would grow [-Winline]
Bool mainGtU ( UInt32 i1,
^
cc1: warning: called from here [-Winline]
blocksort.c:347:6: warning: inlining failed in call to ‘mainGtU.part.0’: call is unlikely and code size would grow [-Winline]
Bool mainGtU ( UInt32 i1,
^
cc1: warning: called from here [-Winline]
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c huffman.c
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c crctable.c
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c randtable.c
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c compress.c
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c decompress.c
gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c bzlib.c
#gcc -shared -Wl,-soname -Wl,libbz2.so.1.0 -o libbz2.so.1.0.6 blocksort.o huffman.o crctable.o randtable.o compress.o decompress.o bzlib.o
#gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -o bzip2-shared bzip2.c libbz2.so.1.0.6
#rm -f libbz2.so.1.0
#ln -s libbz2.so.1.0.6 libbz2.so.1.0
building 'khmer._khmer' extension
creating build/temp.linux-x86_64-2.7
creating build/temp.linux-x86_64-2.7/khmer
creating build/temp.linux-x86_64-2.7/lib
creating build/temp.linux-x86_64-2.7/third-party
creating build/temp.linux-x86_64-2.7/third-party/smhasher
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c khmer/_khmer.cc -o build/temp.linux-x86_64-2.7/khmer/_khmer.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/trace_logger.cc -o build/temp.linux-x86_64-2.7/lib/trace_logger.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/perf_metrics.cc -o build/temp.linux-x86_64-2.7/lib/perf_metrics.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/read_parsers.cc -o build/temp.linux-x86_64-2.7/lib/read_parsers.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/kmer_hash.cc -o build/temp.linux-x86_64-2.7/lib/kmer_hash.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hashtable.cc -o build/temp.linux-x86_64-2.7/lib/hashtable.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hashbits.cc -o build/temp.linux-x86_64-2.7/lib/hashbits.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/labelhash.cc -o build/temp.linux-x86_64-2.7/lib/labelhash.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/counting.cc -o build/temp.linux-x86_64-2.7/lib/counting.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/subset.cc -o build/temp.linux-x86_64-2.7/lib/subset.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/read_aligner.cc -o build/temp.linux-x86_64-2.7/lib/read_aligner.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hllcounter.cc -o build/temp.linux-x86_64-2.7/lib/hllcounter.o -O3 -fopenmp
x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c third-party/smhasher/MurmurHash3.cc -o build/temp.linux-x86_64-2.7/third-party/smhasher/MurmurHash3.o -O3 -fopenmp
c++ -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -Wstrict-prototypes -D_FORTIFY_SOURCE=2 -g -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security build/temp.linux-x86_64-2.7/khmer/_khmer.o build/temp.linux-x86_64-2.7/lib/trace_logger.o build/temp.linux-x86_64-2.7/lib/perf_metrics.o build/temp.linux-x86_64-2.7/lib/read_parsers.o build/temp.linux-x86_64-2.7/lib/kmer_hash.o build/temp.linux-x86_64-2.7/lib/hashtable.o build/temp.linux-x86_64-2.7/lib/hashbits.o build/temp.linux-x86_64-2.7/lib/labelhash.o build/temp.linux-x86_64-2.7/lib/counting.o build/temp.linux-x86_64-2.7/lib/subset.o build/temp.linux-x86_64-2.7/lib/read_aligner.o build/temp.linux-x86_64-2.7/lib/hllcounter.o build/temp.linux-x86_64-2.7/third-party/smhasher/MurmurHash3.o third-party/zlib/adler32.lo third-party/zlib/compress.lo third-party/zlib/crc32.lo third-party/zlib/deflate.lo third-party/zlib/gzclose.lo third-party/zlib/gzlib.lo third-party/zlib/gzread.lo third-party/zlib/gzwrite.lo third-party/zlib/infback.lo third-party/zlib/inffast.lo third-party/zlib/inflate.lo third-party/zlib/inftrees.lo third-party/zlib/trees.lo third-party/zlib/uncompr.lo third-party/zlib/zutil.lo third-party/bzip2/blocksort.o third-party/bzip2/huffman.o third-party/bzip2/crctable.o third-party/bzip2/randtable.o third-party/bzip2/compress.o third-party/bzip2/decompress.o third-party/bzip2/bzlib.o -o build/lib.linux-x86_64-2.7/khmer/_khmer.so -fopenmp
creating build/bdist.linux-x86_64
creating build/bdist.linux-x86_64/egg
creating build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/_khmer.cc -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/kfile.py -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/khmer_args.py -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/thread_utils.py -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/utils.py -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/__init__.py -> build/bdist.linux-x86_64/egg/khmer
creating build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_scripts.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_threaded_sequence_processor.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/.gitignore -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_functions.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_hll.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_counting_single.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_read_aligner.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_labelhash.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_normalize_by_median.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_subset_graph.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/__init__.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_counting_hash.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_hashbits.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_hashbits_obj.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_version.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_graph.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_filter.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/khmer_tst_utils.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_script_arguments.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_sandbox_scripts.py -> build/bdist.linux-x86_64/egg/khmer/tests
creating build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k32.tagset -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k32.tagset -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.truncated.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k32.stoptags -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-all-paired-all-keep.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/biglump-random-20-a.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-3.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k12.ht -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/fakelump.fa.stoptags.txt -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa.se -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/overlap.out -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k12.ht.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken3.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.odd.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph5.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-fastq-n-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-contigs.fp -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-output-partitions.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq.se -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-some-paired-all-keep.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/combine_parts_1.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed-broken.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/filter-test-A.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-reads.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-X2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-overlap2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/normC20k20.ct -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k12.ht -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/old-style-format-w-comments.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-empty.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-fastq-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-filter-abund-Ns.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-none-paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.part -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken2.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/single-read.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-labels.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-empty.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq.pe -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/empty-file -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.truncated.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/real-partition-tiny.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-large.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/real-partition-small.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-transcript.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-overlap1.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-impaired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/casava_18-pe.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken3.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/fakelump.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired_one.base.dif.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed-2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.paired2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-short.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-b.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-error-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k12.ct -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/all-A.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/filter-test-B.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k32.stoptags -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.even.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/truncated.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa.pe -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken2.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-31-c.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data
copying build/lib.linux-x86_64-2.7/khmer/tests/test_read_parsers.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/tests/test_lump.py -> build/bdist.linux-x86_64/egg/khmer/tests
copying build/lib.linux-x86_64-2.7/khmer/_khmer.so -> build/bdist.linux-x86_64/egg/khmer
copying build/lib.linux-x86_64-2.7/khmer/_version.py -> build/bdist.linux-x86_64/egg/khmer
creating build/bdist.linux-x86_64/egg/oxli
copying build/lib.linux-x86_64-2.7/oxli/functions.py -> build/bdist.linux-x86_64/egg/oxli
copying build/lib.linux-x86_64-2.7/oxli/build_graph.py -> build/bdist.linux-x86_64/egg/oxli
copying build/lib.linux-x86_64-2.7/oxli/__init__.py -> build/bdist.linux-x86_64/egg/oxli
byte-compiling build/bdist.linux-x86_64/egg/khmer/kfile.py to kfile.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/khmer_args.py to khmer_args.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/thread_utils.py to thread_utils.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/utils.py to utils.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/__init__.py to __init__.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_scripts.py to test_scripts.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_threaded_sequence_processor.py to test_threaded_sequence_processor.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_functions.py to test_functions.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hll.py to test_hll.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_counting_single.py to test_counting_single.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_read_aligner.py to test_read_aligner.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_labelhash.py to test_labelhash.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_normalize_by_median.py to test_normalize_by_median.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_subset_graph.py to test_subset_graph.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/__init__.py to __init__.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_counting_hash.py to test_counting_hash.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hashbits.py to test_hashbits.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hashbits_obj.py to test_hashbits_obj.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_version.py to test_version.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_graph.py to test_graph.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_filter.py to test_filter.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/khmer_tst_utils.py to khmer_tst_utils.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_script_arguments.py to test_script_arguments.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_sandbox_scripts.py to test_sandbox_scripts.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_read_parsers.py to test_read_parsers.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_lump.py to test_lump.pyc
byte-compiling build/bdist.linux-x86_64/egg/khmer/_version.py to _version.pyc
byte-compiling build/bdist.linux-x86_64/egg/oxli/functions.py to functions.pyc
byte-compiling build/bdist.linux-x86_64/egg/oxli/build_graph.py to build_graph.pyc
byte-compiling build/bdist.linux-x86_64/egg/oxli/__init__.py to __init__.pyc
creating stub loader for khmer/_khmer.so
byte-compiling build/bdist.linux-x86_64/egg/khmer/_khmer.py to _khmer.pyc
creating build/bdist.linux-x86_64/egg/EGG-INFO
installing scripts to build/bdist.linux-x86_64/egg/EGG-INFO/scripts
running install_scripts
running build_scripts
creating build/scripts-2.7
copying and adjusting scripts/normalize-by-median.py -> build/scripts-2.7
copying and adjusting scripts/load-graph.py -> build/scripts-2.7
copying and adjusting scripts/abundance-dist.py -> build/scripts-2.7
copying and adjusting scripts/annotate-partitions.py -> build/scripts-2.7
copying and adjusting scripts/abundance-dist-single.py -> build/scripts-2.7
copying and adjusting scripts/extract-long-sequences.py -> build/scripts-2.7
copying and adjusting scripts/count-overlap.py -> build/scripts-2.7
copying and adjusting scripts/partition-graph.py -> build/scripts-2.7
copying and adjusting scripts/merge-partitions.py -> build/scripts-2.7
copying and adjusting scripts/trim-low-abund.py -> build/scripts-2.7
copying and adjusting scripts/readstats.py -> build/scripts-2.7
copying and adjusting scripts/do-partition.py -> build/scripts-2.7
copying and adjusting scripts/load-into-counting.py -> build/scripts-2.7
copying and adjusting scripts/fastq-to-fasta.py -> build/scripts-2.7
copying and adjusting scripts/sample-reads-randomly.py -> build/scripts-2.7
copying and adjusting scripts/find-knots.py -> build/scripts-2.7
copying and adjusting scripts/filter-stoptags.py -> build/scripts-2.7
copying and adjusting scripts/count-median.py -> build/scripts-2.7
copying and adjusting scripts/extract-paired-reads.py -> build/scripts-2.7
copying and adjusting scripts/interleave-reads.py -> build/scripts-2.7
copying and adjusting scripts/extract-partitions.py -> build/scripts-2.7
copying and adjusting scripts/split-paired-reads.py -> build/scripts-2.7
copying and adjusting scripts/filter-abund.py -> build/scripts-2.7
copying and adjusting scripts/make-initial-stoptags.py -> build/scripts-2.7
copying and adjusting scripts/filter-abund-single.py -> build/scripts-2.7
changing mode of build/scripts-2.7/normalize-by-median.py from 644 to 755
changing mode of build/scripts-2.7/load-graph.py from 644 to 755
changing mode of build/scripts-2.7/abundance-dist.py from 644 to 755
changing mode of build/scripts-2.7/annotate-partitions.py from 644 to 755
changing mode of build/scripts-2.7/abundance-dist-single.py from 644 to 755
changing mode of build/scripts-2.7/extract-long-sequences.py from 644 to 755
changing mode of build/scripts-2.7/count-overlap.py from 644 to 755
changing mode of build/scripts-2.7/partition-graph.py from 644 to 755
changing mode of build/scripts-2.7/merge-partitions.py from 644 to 755
changing mode of build/scripts-2.7/trim-low-abund.py from 644 to 755
changing mode of build/scripts-2.7/readstats.py from 644 to 755
changing mode of build/scripts-2.7/do-partition.py from 644 to 755
changing mode of build/scripts-2.7/load-into-counting.py from 644 to 755
changing mode of build/scripts-2.7/fastq-to-fasta.py from 644 to 755
changing mode of build/scripts-2.7/sample-reads-randomly.py from 644 to 755
changing mode of build/scripts-2.7/find-knots.py from 644 to 755
changing mode of build/scripts-2.7/filter-stoptags.py from 644 to 755
changing mode of build/scripts-2.7/count-median.py from 644 to 755
changing mode of build/scripts-2.7/extract-paired-reads.py from 644 to 755
changing mode of build/scripts-2.7/interleave-reads.py from 644 to 755
changing mode of build/scripts-2.7/extract-partitions.py from 644 to 755
changing mode of build/scripts-2.7/split-paired-reads.py from 644 to 755
changing mode of build/scripts-2.7/filter-abund.py from 644 to 755
changing mode of build/scripts-2.7/make-initial-stoptags.py from 644 to 755
changing mode of build/scripts-2.7/filter-abund-single.py from 644 to 755
creating build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/normalize-by-median.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/load-graph.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/abundance-dist.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/annotate-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/abundance-dist-single.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/extract-long-sequences.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/count-overlap.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/partition-graph.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/merge-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/trim-low-abund.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/readstats.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/do-partition.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/load-into-counting.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/fastq-to-fasta.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/sample-reads-randomly.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/find-knots.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/filter-stoptags.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/count-median.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/extract-paired-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/interleave-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/extract-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/split-paired-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/filter-abund.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/make-initial-stoptags.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
copying build/scripts-2.7/filter-abund-single.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/normalize-by-median.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/load-graph.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/abundance-dist.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/annotate-partitions.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/abundance-dist-single.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-long-sequences.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/count-overlap.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/partition-graph.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/merge-partitions.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/trim-low-abund.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/readstats.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/do-partition.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/load-into-counting.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/fastq-to-fasta.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/sample-reads-randomly.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/find-knots.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-stoptags.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/count-median.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-paired-reads.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/interleave-reads.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-partitions.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/split-paired-reads.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-abund.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/make-initial-stoptags.py to 755
changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-abund-single.py to 755
copying khmer.egg-info/PKG-INFO -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/SOURCES.txt -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/dependency_links.txt -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/entry_points.txt -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/not-zip-safe -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/requires.txt -> build/bdist.linux-x86_64/egg/EGG-INFO
copying khmer.egg-info/top_level.txt -> build/bdist.linux-x86_64/egg/EGG-INFO
writing build/bdist.linux-x86_64/egg/EGG-INFO/native_libs.txt
creating dist
creating 'dist/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg' and adding 'build/bdist.linux-x86_64/egg' to it
removing 'build/bdist.linux-x86_64/egg' (and everything under it)
Processing khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg
creating /usr/local/lib/python2.7/dist-packages/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg
Extracting khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg to /usr/local/lib/python2.7/dist-packages
Adding khmer 1.4-261.g75f6fbf to easy-install.pth file
Installing count-median.py script to /usr/local/bin
Installing split-paired-reads.py script to /usr/local/bin
Installing filter-abund-single.py script to /usr/local/bin
Installing filter-abund.py script to /usr/local/bin
Installing abundance-dist.py script to /usr/local/bin
Installing partition-graph.py script to /usr/local/bin
Installing filter-stoptags.py script to /usr/local/bin
Installing merge-partitions.py script to /usr/local/bin
Installing sample-reads-randomly.py script to /usr/local/bin
Installing normalize-by-median.py script to /usr/local/bin
Installing extract-partitions.py script to /usr/local/bin
Installing fastq-to-fasta.py script to /usr/local/bin
Installing make-initial-stoptags.py script to /usr/local/bin
Installing count-overlap.py script to /usr/local/bin
Installing abundance-dist-single.py script to /usr/local/bin
Installing load-into-counting.py script to /usr/local/bin
Installing interleave-reads.py script to /usr/local/bin
Installing load-graph.py script to /usr/local/bin
Installing trim-low-abund.py script to /usr/local/bin
Installing readstats.py script to /usr/local/bin
Installing find-knots.py script to /usr/local/bin
Installing annotate-partitions.py script to /usr/local/bin
Installing extract-paired-reads.py script to /usr/local/bin
Installing extract-long-sequences.py script to /usr/local/bin
Installing do-partition.py script to /usr/local/bin
Installing oxli script to /usr/local/bin
Installed /usr/local/lib/python2.7/dist-packages/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg
Processing dependencies for khmer==1.4-261.g75f6fbf
Searching for screed>=0.9
Reading http://pypi.python.org/simple/screed/
Best match: screed 0.9
Downloading https://pypi.python.org/packages/source/s/screed/screed-0.9.tar.gz#md5=611dd11105489e4153265e055f13debd
Processing screed-0.9.tar.gz
Writing /tmp/easy_install-PGZAO3/screed-0.9/setup.cfg
Running screed-0.9/setup.py -q bdist_egg --dist-dir /tmp/easy_install-PGZAO3/screed-0.9/egg-dist-tmp-pop6SP
zip_safe flag not set; analyzing archive contents...
screed.tests.test_open_cm: module references __file__
screed.tests.test_pygr_api: module references __file__
screed.tests.screed_tst_utils: module references __file__
screed.tests.test_shell: module references __file__
screed.tests.test_open: module references __file__
screed.tests.__main__: module references __file__
Adding screed 0.9 to easy-install.pth file
Installed /usr/local/lib/python2.7/dist-packages/screed-0.9-py2.7.egg
Searching for bz2file
Reading http://pypi.python.org/simple/bz2file/
Best match: bz2file 0.98
Downloading https://pypi.python.org/packages/source/b/bz2file/bz2file-0.98.tar.gz#md5=27d6f711ae0db6cfd1eb37f95621dfb5
Processing bz2file-0.98.tar.gz
Writing /tmp/easy_install-tyYdeg/bz2file-0.98/setup.cfg
Running bz2file-0.98/setup.py -q bdist_egg --dist-dir /tmp/easy_install-tyYdeg/bz2file-0.98/egg-dist-tmp-poavWk
zip_safe flag not set; analyzing archive contents...
Adding bz2file 0.98 to easy-install.pth file
Installed /usr/local/lib/python2.7/dist-packages/bz2file-0.98-py2.7.egg
Finished processing dependencies for khmer==1.4-261.g75f6fbf
The following script is contained within the khmer package and can estimate the total unique number of k-mers in your dataset. Use cases for this might be a) determining how diverse a metagenome is compared to e.g., a bacterial genome for assembly, b) to compare k-mer diversity among multiple metagenomes, c) exploring the impacts of choice of length k for assembly.
Next, to estimate the number unique k-mers in the datasets for multiple k's (17, 21, 25, 29, 33, 37), execute the scripts below. The script output will identify the unique k-mers but will also save in a report named unique_count. (This takes about 15 minutes on a large instance and 8-10 minutes on an extra large.)
In [20]:
!python unique-kmers.py -R unique_count -k 17 SRR172903.qc.fastq
!python unique-kmers.py -R unique_count -k 21 SRR172903.qc.fastq
!python unique-kmers.py -R unique_count -k 25 SRR172903.qc.fastq
!python unique-kmers.py -R unique_count -k 29 SRR172903.qc.fastq
!python unique-kmers.py -R unique_count -k 33 SRR172903.qc.fastq
!python unique-kmers.py -R unique_count -k 37 SRR172903.qc.fastq
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 14330058
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 15287036
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 15446874
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 15427477
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 15147325
|| This is the script 'unique-kmers.py' in khmer.
|| You are running khmer version 0+unknown
|| You are also using screed version 0.9
||
|| If you use this script in a publication, please cite EACH of the following:
||
|| * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190
|| * A. Döring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11
|| * Irber and Brown, unpublished
||
|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.
Estimated number of unique k-mers: 14910222
You can see that this file now has in the first column the k-mer length and in the second column the estimated number of words of length k in the metagenomes. If you had multiple genomes, you could compare diversity of e.g., the total number of k-mers across datasets. To view the results of the file, you can use the concatentate program/command "cat".
In [21]:
!cat unique_count
17 14330058
21 15287036
25 15446874
29 15427477
33 15147325
37 14910222
Most metagenomic analysis require one to estimate the abundance of reference genes (e.g., orginating from genomes or one's own metagenomic assembly). This tutorial will cover both cases where references are available or unavailable (requiring de novo assembly).
For the mock HMP metagenome, the HMP has sequenced the genomes of the isolates used for this simulated dataset. The list of these genomes can be obtained on the HMP website, and we provide it here in a Github repository, a tool used for collaboratively sharing data and code. The command below will download data for this tutorial.
In [22]:
!cat ncbi_acc.txt
NC_005008.1
NC_005007.1
NC_005003.1
NC_005006.1
NC_005004.1
NC_009084.1
NC_005005.1
NC_000958.1
NC_000959.1
NC_009083.1
NC_001264.1
NC_001263.1
NC_004461.1
NC_009008.1
NC_010079.1
NC_007490.1
NC_009007.1
NC_007489.1
NC_004350.1
NC_007488.1
NC_007493.1
NC_007494.1
NC_009085.1
NC_009515.1
NC_009614.1
NC_000915.1
NC_003028.3
NC_000913.2
NC_006085.1
NC_003112.2
The following command downloads all the genomes for each ID in the above list into a directory called "genomes".
In [23]:
!python fetch-genomes-fasta.py ncbi_acc.txt genomes
Fetching NC_005008.1...Done
Fetching NC_005007.1...Done
Fetching NC_005003.1...Done
Fetching NC_005006.1...Done
Fetching NC_005004.1...Done
Fetching NC_009084.1...Done
Fetching NC_005005.1...Done
Fetching NC_000958.1...Done
Fetching NC_000959.1...Done
Fetching NC_009083.1...Done
Fetching NC_001264.1...Done
Fetching NC_001263.1...Done
Fetching NC_004461.1...Done
Fetching NC_009008.1...Done
Fetching NC_010079.1...Done
Fetching NC_007490.1...Done
Fetching NC_009007.1...Done
Fetching NC_007489.1...Done
Fetching NC_004350.1...Done
Fetching NC_007488.1...Done
Fetching NC_007493.1...Done
Fetching NC_007494.1...Done
Fetching NC_009085.1...Done
Fetching NC_009515.1...Done
Fetching NC_009614.1...Done
Fetching NC_000915.1...Done
Fetching NC_003028.3...Done
Fetching NC_000913.2...Done
Fetching NC_006085.1...Done
Fetching NC_003112.2...Done
To estimate the representation of reference genes or genomes in your metagenome, you can align reads to references using read mapping software (e.g., Bowtie2, BWA, etc.). In this tutorial, we will use Bowtie2 which we will install on this server. We will then be mapping the metagenome to a single reference genome (that we downloaded above).
In [24]:
!wget http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip
!unzip bowtie2-2.2.5-linux-x86_64.zip
--2015-06-26 14:07:44-- http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip
Resolving sourceforge.net (sourceforge.net)... 216.34.181.60
Connecting to sourceforge.net (sourceforge.net)|216.34.181.60|:80... connected.
HTTP request sent, awaiting response... 302 Found
Location: http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip/download [following]
--2015-06-26 14:07:44-- http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip/download
Connecting to sourceforge.net (sourceforge.net)|216.34.181.60|:80... connected.
HTTP request sent, awaiting response... 302 Found
Location: http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip?r=&ts=1435327664&use_mirror=iweb [following]
--2015-06-26 14:07:44-- http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip?r=&ts=1435327664&use_mirror=iweb
Resolving downloads.sourceforge.net (downloads.sourceforge.net)... 216.34.181.59
Connecting to downloads.sourceforge.net (downloads.sourceforge.net)|216.34.181.59|:80... connected.
HTTP request sent, awaiting response... 302 Found
Location: http://iweb.dl.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip [following]
--2015-06-26 14:07:44-- http://iweb.dl.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip
Resolving iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)... 70.38.0.134, 2607:f748:10:12::5f:2
Connecting to iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)|70.38.0.134|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 26413746 (25M) [application/octet-stream]
Saving to: ‘bowtie2-2.2.5-linux-x86_64.zip’
100%[======================================>] 26,413,746 313KB/s in 60s
2015-06-26 14:08:44 (428 KB/s) - ‘bowtie2-2.2.5-linux-x86_64.zip’ saved [26413746/26413746]
Archive: bowtie2-2.2.5-linux-x86_64.zip
creating: bowtie2-2.2.5/
inflating: bowtie2-2.2.5/AUTHORS
inflating: bowtie2-2.2.5/bowtie2
inflating: bowtie2-2.2.5/bowtie2-align-l
inflating: bowtie2-2.2.5/bowtie2-align-l-debug
inflating: bowtie2-2.2.5/bowtie2-align-s
inflating: bowtie2-2.2.5/bowtie2-align-s-debug
inflating: bowtie2-2.2.5/bowtie2-build
inflating: bowtie2-2.2.5/bowtie2-build-l
inflating: bowtie2-2.2.5/bowtie2-build-l-debug
inflating: bowtie2-2.2.5/bowtie2-build-s
inflating: bowtie2-2.2.5/bowtie2-build-s-debug
inflating: bowtie2-2.2.5/bowtie2-inspect
inflating: bowtie2-2.2.5/bowtie2-inspect-l
inflating: bowtie2-2.2.5/bowtie2-inspect-l-debug
inflating: bowtie2-2.2.5/bowtie2-inspect-s
inflating: bowtie2-2.2.5/bowtie2-inspect-s-debug
creating: bowtie2-2.2.5/doc/
inflating: bowtie2-2.2.5/doc/manual.html
inflating: bowtie2-2.2.5/doc/README
inflating: bowtie2-2.2.5/doc/style.css
creating: bowtie2-2.2.5/example/
creating: bowtie2-2.2.5/example/index/
inflating: bowtie2-2.2.5/example/index/lambda_virus.1.bt2
inflating: bowtie2-2.2.5/example/index/lambda_virus.2.bt2
inflating: bowtie2-2.2.5/example/index/lambda_virus.3.bt2
inflating: bowtie2-2.2.5/example/index/lambda_virus.4.bt2
inflating: bowtie2-2.2.5/example/index/lambda_virus.rev.1.bt2
inflating: bowtie2-2.2.5/example/index/lambda_virus.rev.2.bt2
creating: bowtie2-2.2.5/example/reads/
inflating: bowtie2-2.2.5/example/reads/longreads.fq
inflating: bowtie2-2.2.5/example/reads/reads_1.fq
inflating: bowtie2-2.2.5/example/reads/reads_2.fq
inflating: bowtie2-2.2.5/example/reads/simulate.pl
creating: bowtie2-2.2.5/example/reference/
inflating: bowtie2-2.2.5/example/reference/lambda_virus.fa
inflating: bowtie2-2.2.5/LICENSE
inflating: bowtie2-2.2.5/MANUAL
inflating: bowtie2-2.2.5/MANUAL.markdown
inflating: bowtie2-2.2.5/NEWS
creating: bowtie2-2.2.5/scripts/
inflating: bowtie2-2.2.5/scripts/convert_quals.pl
inflating: bowtie2-2.2.5/scripts/debug_wrapper.pl
inflating: bowtie2-2.2.5/scripts/gen_2b_occ_lookup.pl
inflating: bowtie2-2.2.5/scripts/gen_occ_lookup.pl
inflating: bowtie2-2.2.5/scripts/gen_solqual_lookup.pl
inflating: bowtie2-2.2.5/scripts/infer_fraglen.pl
inflating: bowtie2-2.2.5/scripts/make_a_thaliana_tair.sh
inflating: bowtie2-2.2.5/scripts/make_b_taurus_UMD3.sh
inflating: bowtie2-2.2.5/scripts/make_canFam2.sh
inflating: bowtie2-2.2.5/scripts/make_c_elegans.sh
inflating: bowtie2-2.2.5/scripts/make_d_melanogaster.sh
inflating: bowtie2-2.2.5/scripts/make_e_coli.sh
inflating: bowtie2-2.2.5/scripts/make_hg18.sh
inflating: bowtie2-2.2.5/scripts/make_hg19.sh
inflating: bowtie2-2.2.5/scripts/make_h_sapiens_ncbi36.sh
inflating: bowtie2-2.2.5/scripts/make_h_sapiens_ncbi37.sh
inflating: bowtie2-2.2.5/scripts/make_mm10.sh
inflating: bowtie2-2.2.5/scripts/make_mm9.sh
inflating: bowtie2-2.2.5/scripts/make_m_musculus_ncbi37.sh
inflating: bowtie2-2.2.5/scripts/make_rn4.sh
inflating: bowtie2-2.2.5/scripts/make_s_cerevisiae.sh
inflating: bowtie2-2.2.5/TUTORIAL
extracting: bowtie2-2.2.5/VERSION
I've written a script that will automatically map a set of reads to a given reference and output a file containing the number of reads that are mapped to a given reference. To use this script, we'll also need to install samtools. A samfile is a super compressed file that efficiently stores mapped information from mappers. Samtools helps us interact with this file.
In [25]:
!apt-get install samtools
The following NEW packages will be installed:
samtools
0 upgraded, 1 newly installed, 0 to remove and 14 not upgraded.
Need to get 560 kB of archives.
After this operation, 1,336 kB of additional disk space will be used.
Get:1 http://us-east-1.ec2.archive.ubuntu.com/ubuntu/ saucy/universe samtools amd64 0.1.19-1 [560 kB]
Fetched 560 kB in 0s (22.3 MB/s)
Selecting previously unselected package samtools.
(Reading database ... 112754 files and directories currently installed.)
Unpacking samtools (from .../samtools_0.1.19-1_amd64.deb) ...
Processing triggers for man-db ...
Setting up samtools (0.1.19-1) ...
To map reads to a reference, we have provided an easy to use program. The steps the program performs are as follows:
This takes about 8-10 minutes.
In [26]:
!bash bowtie.sh genomes/NC_000913.2.fa SRR172903.qc.fastq
Reference is genomes/NC_000913.2.fa
Reads are SRR172903.qc.fastq
Settings:
Output files: "genomes/NC_000913.2.fa-bowtie-index.*.bt2"
Line rate: 6 (line is 64 bytes)
Lines per side: 1 (side is 64 bytes)
Offset rate: 4 (one in 16)
FTable chars: 10
Strings: unpacked
Max bucket size: default
Max bucket size, sqrt multiplier: default
Max bucket size, len divisor: 4
Difference-cover sample period: 1024
Endianness: little
Actual local endianness: little
Sanity checking: disabled
Assertions: disabled
Random seed: 0
Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
genomes/NC_000913.2.fa
Building a SMALL index
Reading reference sizes
Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 1159918
Using parameters --bmax 869939 --dcv 1024
Doing ahead-of-time memory usage test
Passed! Constructing with these parameters: --bmax 869939 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
Building sPrime
Building sPrimeOrder
V-Sorting samples
V-Sorting samples time: 00:00:00
Allocating rank array
Ranking v-sort output
Ranking v-sort output time: 00:00:00
Invoking Larsson-Sadakane on ranks
Invoking Larsson-Sadakane on ranks time: 00:00:00
Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
(Using difference cover)
Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:00
Splitting and merging
Splitting and merging time: 00:00:00
Split 2, merged 6; iterating...
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:00
Splitting and merging
Splitting and merging time: 00:00:00
Split 1, merged 1; iterating...
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:01
Splitting and merging
Splitting and merging time: 00:00:00
Avg bucket size: 579958 (target: 869938)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 566788
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 566789
Getting block 2 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 564637
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 564638
Getting block 3 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 645098
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 645099
Getting block 4 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 234151
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 234152
Getting block 5 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 643592
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 643593
Getting block 6 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 711613
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 711614
Getting block 7 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 574603
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 574604
Getting block 8 of 8
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 699186
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 699187
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 1142228
fchr[G]: 2321782
fchr[T]: 3498705
fchr[$]: 4639675
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 5741113 bytes to primary EBWT file: genomes/NC_000913.2.fa-bowtie-index.1.bt2
Wrote 1159924 bytes to secondary EBWT file: genomes/NC_000913.2.fa-bowtie-index.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
len: 4639675
bwtLen: 4639676
sz: 1159919
bwtSz: 1159919
lineRate: 6
offRate: 4
offMask: 0xfffffff0
ftabChars: 10
eftabLen: 20
eftabSz: 80
ftabLen: 1048577
ftabSz: 4194308
offsLen: 289980
offsSz: 1159920
lineSz: 64
sideSz: 64
sideBwtSz: 48
sideBwtLen: 192
numSides: 24165
numLines: 24165
ebwtTotLen: 1546560
ebwtTotSz: 1546560
color: 0
reverse: 0
Total time for call to driver() for forward index: 00:00:02
Reading reference sizes
Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Time to join reference sequences: 00:00:00
Time to reverse reference sequence: 00:00:00
bmax according to bmaxDivN setting: 1159918
Using parameters --bmax 869939 --dcv 1024
Doing ahead-of-time memory usage test
Passed! Constructing with these parameters: --bmax 869939 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
Building sPrime
Building sPrimeOrder
V-Sorting samples
V-Sorting samples time: 00:00:00
Allocating rank array
Ranking v-sort output
Ranking v-sort output time: 00:00:00
Invoking Larsson-Sadakane on ranks
Invoking Larsson-Sadakane on ranks time: 00:00:00
Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
(Using difference cover)
Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:01
Splitting and merging
Splitting and merging time: 00:00:00
Split 2, merged 6; iterating...
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:00
Splitting and merging
Splitting and merging time: 00:00:00
Avg bucket size: 662810 (target: 869938)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 504667
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 504668
Getting block 2 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 574835
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 574836
Getting block 3 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 367744
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 367745
Getting block 4 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 868288
(Using difference cover)
Sorting block time: 00:00:01
Returning block of 868289
Getting block 5 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 852473
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 852474
Getting block 6 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 759657
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 759658
Getting block 7 of 7
Reserving size (869939) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 712005
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 712006
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 1142228
fchr[G]: 2321782
fchr[T]: 3498705
fchr[$]: 4639675
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 5741113 bytes to primary EBWT file: genomes/NC_000913.2.fa-bowtie-index.rev.1.bt2
Wrote 1159924 bytes to secondary EBWT file: genomes/NC_000913.2.fa-bowtie-index.rev.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
len: 4639675
bwtLen: 4639676
sz: 1159919
bwtSz: 1159919
lineRate: 6
offRate: 4
offMask: 0xfffffff0
ftabChars: 10
eftabLen: 20
eftabSz: 80
ftabLen: 1048577
ftabSz: 4194308
offsLen: 289980
offsSz: 1159920
lineSz: 64
sideSz: 64
sideBwtSz: 48
sideBwtLen: 192
numSides: 24165
numLines: 24165
ebwtTotLen: 1546560
ebwtTotSz: 1546560
color: 0
reverse: 1
Total time for backward call to driver() for mirror index: 00:00:02
820417 reads; of these:
820417 (100.00%) were unpaired; of these:
793072 (96.67%) aligned 0 times
26531 (3.23%) aligned exactly 1 time
814 (0.10%) aligned >1 times
3.33% overall alignment rate
[samopen] SAM header is present: 1 sequences.
We can look at the total number of reads mapped and unmapped from our metagenome to the genome NC_000913.2. We can also get a file that shows the reference sequence name (first column), reference sequence length (second column), # mapped reads (third column) and # unmapped reads (last column). The other columns contain information that samtools can use for other queries, you can read about samtools here, http://samtools.sourceforge.net/samtools.shtml.
In [27]:
!cat reads-mapped.count.txt
27345
In [28]:
!cat reads-unmapped.count.txt
793072
In [29]:
!cat reads.by.contigs.txt
gi|49175990|ref|NC_000913.2| 4639675 27345 0
* 0 0 793072
If you want a challenge, you can try mapping the metagenome to all reference genomes provided in the genome folder. To do so, try concatentating all genomes into one file (using this command: "cat genomes/*fa >> all-genomes.fa") and running the program on all-genomes.fa instead of NC_000913.2.fa.
Assembly is the process of merging overlapping metagenomic reads from hopefully the same genome into a longer, continguous sequence (most commonly called a contig). It is advantageous in that it provides longer lengths for sequences that can later be used as references (that may be previously unknown), reduces the dataset size for analysis, and provides references that are not dependent on previous knowledge.
The choice of what assembler to use is not an easy one and is a subject of debate (see http://assemblathon.org). It is most important to remember that an assembly is a hypothesized consensus representation of your dataset. The assembly itself is an initial step that needs to be followed by an evaluation of its accuracy and usefulness. For most assemblers, the inputs are sequencing reads and paramters for the assembly software. For this tutorial, we will be completing the assembly with an assembler published in 2014 called Megahit (Li et al., 2015, https://github.com/voutcn/megahit). Sharpton's review (Sharpton, 2014) also reviews quite nicely some of the many assembly programs and approaches for metagenomic assembly.
To reduce the memory that is needed, it is often advantageous to normalize the distribution of k-mers in a metagenome. Removing extraneous information not needed for assembly also removes reads that may contain errors and may improve assembly (http://arxiv.org/abs/1203.4802). These scripts and tutorials are available at http://ged.msu.edu/angus/diginorm-2012/tutorial.html.
For this tutorial, we will assemble our metagenome with the Megathit assembler so first we have to install it.
In [30]:
!bash install-megahit.sh
Cloning into 'megahit'...
remote: Counting objects: 1505, done.
remote: Compressing objects: 100% (27/27), done.
remote: Total 1505 (delta 9), reused 0 (delta 0), pack-reused 1478
Receiving objects: 100% (1505/1505), 1.06 MiB | 0 bytes/s, done.
Resolving deltas: 100% (1033/1033), done.
Checking connectivity... done
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c succinct_dbg.cpp -o succinct_dbg.o
succinct_dbg.cpp: In member function ‘void SuccinctDBG::LoadFromFile(const char*)’:
succinct_dbg.cpp:369:34: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, declared with attribute warn_unused_result [-Wunused-result]
fscanf(f_file, "%d", &kmer_k);
^
succinct_dbg.cpp:370:45: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, declared with attribute warn_unused_result [-Wunused-result]
fscanf(f_file, "%u", &num_dollar_nodes_);
^
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c assembly_algorithms.cpp -o assembly_algorithms.o
In file included from hash_map.h:17:0,
from unitig_graph.h:30,
from assembly_algorithms.cpp:34:
hash_table.h: In instantiation of ‘struct HashTableNode<std::pair<long int, unsigned int> >’:
hash_table.h:599:39: required from ‘void HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::clear() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]’
hash_table.h:277:15: required from ‘HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::~HashTable() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]’
hash_map.h:32:7: required from here
hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field ‘std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value’ [enabled by default]
T value;
^
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c branch_group.cpp -o branch_group.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c options_description.cpp -o options_description.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c unitig_graph.cpp -o unitig_graph.o
In file included from hash_map.h:17:0,
from unitig_graph.h:30,
from unitig_graph.cpp:21:
hash_table.h: In instantiation of ‘struct HashTableNode<std::pair<long int, unsigned int> >’:
hash_table.h:102:16: required from ‘HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::value_type* HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::operator->() const [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>; HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::pointer = std::pair<long int, unsigned int>*; HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::value_type = std::pair<long int, unsigned int>]’
unitig_graph.cpp:363:76: required from here
hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field ‘std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value’ [enabled by default]
T value;
^
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c sequence_manager.cpp -o sequence_manager.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c local_assembler.cpp -o local_assembler.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c city.cpp -o city.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_graph.cpp -o lib_idba/contig_graph.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_graph_branch_group.cpp -o lib_idba/contig_graph_branch_group.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_info.cpp -o lib_idba/contig_info.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/hash_graph.cpp -o lib_idba/hash_graph.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/sequence.cpp -o lib_idba/sequence.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt asm_core.cpp assembler.cpp local_assemble.cpp iterate_edges.cpp lib_idba/contig_graph.o lib_idba/contig_graph_branch_group.o lib_idba/contig_info.o lib_idba/hash_graph.o lib_idba/sequence.o succinct_dbg.o assembly_algorithms.o branch_group.o options_description.o unitig_graph.o sequence_manager.o local_assembler.o city.o -lm -lz -lpthread -o megahit_asm_core
In file included from hash_map.h:17:0,
from unitig_graph.h:30,
from assembler.cpp:34:
hash_table.h: In instantiation of ‘struct HashTableNode<std::pair<long int, unsigned int> >’:
hash_table.h:599:39: required from ‘void HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::clear() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]’
hash_table.h:277:15: required from ‘HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::~HashTable() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]’
hash_map.h:32:7: required from here
hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field ‘std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value’ [enabled by default]
T value;
^
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_kmer_count.cpp -o cx1_kmer_count.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_read2sdbg_s1.cpp -o cx1_read2sdbg_s1.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_read2sdbg_s2.cpp -o cx1_read2sdbg_s2.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_seq2sdbg.cpp -o cx1_seq2sdbg.o
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt sdbg_builder.cpp cx1_kmer_count.o options_description.o cx1_read2sdbg_s1.o cx1_read2sdbg_s2.o cx1_seq2sdbg.o sequence_manager.o -lm -lz -lpthread -o megahit_sdbg_build
g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt tools/toolkit.cpp tools/contigs_to_fastg.cpp tools/read_stat.cpp tools/trim_low_qual_tail.cpp tools/filter_by_len.cpp -lm -lz -lpthread -o megahit_toolkit
chmod +x ./megahit
This assembly will take about 15 minutes and will save the assembly to a folder names "megahit_assembly". You can read about the parameters to this program, such as --memory that specifies the maximum memory that can be used on the megahit software repo, https://github.com/voutcn/megahit.
In [31]:
!megahit/megahit --memory 10e9 -l 250 --k-max 81 -r SRR172903.qc.fastq --cpu-only -o megahit_assembly
MEGAHIT 0.3.0-beta3
--- [Fri Jun 26 14:13:38 2015] Start assembly. Number of CPU threads 4 ---
--- [Fri Jun 26 14:13:38 2015] k list: 21,41,61,81 ---
--- [LIB INFO] Single-end reads: SRR172903.qc.fastq
--- [Fri Jun 26 14:13:38 2015] Extracting solid (k+1)-mers for k = 21 ---
--- [Fri Jun 26 14:13:46 2015] Building graph for k = 21 ---
--- [Fri Jun 26 14:13:56 2015] Assembling contigs from SdBG for k = 21 ---
--- [Fri Jun 26 14:14:12 2015] Local assembling k = 21 ---
--- [Fri Jun 26 14:14:14 2015] Extracting iterative edges from k = 21 to 41 ---
--- [Fri Jun 26 14:14:17 2015] Building graph for k = 41 ---
--- [Fri Jun 26 14:14:23 2015] Assembling contigs from SdBG for k = 41 ---
--- [Fri Jun 26 14:14:38 2015] Local assembling k = 41 ---
--- [Fri Jun 26 14:14:39 2015] Extracting iterative edges from k = 41 to 61 ---
--- [Fri Jun 26 14:14:41 2015] Building graph for k = 61 ---
--- [Fri Jun 26 14:14:45 2015] Assembling contigs from SdBG for k = 61 ---
--- [Fri Jun 26 14:14:56 2015] Local assembling k = 61 ---
--- [Fri Jun 26 14:14:57 2015] Extracting iterative edges from k = 61 to 81 ---
--- [Fri Jun 26 14:14:57 2015] Merging to output final contigs ---
--- [STAT] 11345 contigs, total 5254736 bp, min 200 bp, max 8884 bp, avg 463.18 bp, N50 525 bp
--- [Fri Jun 26 14:14:57 2015] ALL DONE. Time elapsed: 79.401388 seconds ---
To take a look at the assembly, let's run the khmer assembly summary program on it, the final contigs are in megahit_assembly/final.contigs.fa. Let's get statistics on all contigs greater than or equal to 200 bp.
In [32]:
!python khmer/sandbox/assemstats3.py 200 megahit_assembly/final.contigs.fa
** cutoff: 200
N sum max filename
11345 5254736 8884 megahit_assembly/final.contigs.fa
In [33]:
!bash bowtie.sh megahit_assembly/final.contigs.fa SRR172903.qc.fastq
Reference is megahit_assembly/final.contigs.fa
Reads are SRR172903.qc.fastq
Settings:
Output files: "megahit_assembly/final.contigs.fa-bowtie-index.*.bt2"
Line rate: 6 (line is 64 bytes)
Lines per side: 1 (side is 64 bytes)
Offset rate: 4 (one in 16)
FTable chars: 10
Strings: unpacked
Max bucket size: default
Max bucket size, sqrt multiplier: default
Max bucket size, len divisor: 4
Difference-cover sample period: 1024
Endianness: little
Actual local endianness: little
Sanity checking: disabled
Assertions: disabled
Random seed: 0
Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
megahit_assembly/final.contigs.fa
Building a SMALL index
Reading reference sizes
Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 1313684
Using parameters --bmax 985263 --dcv 1024
Doing ahead-of-time memory usage test
Passed! Constructing with these parameters: --bmax 985263 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
Building sPrime
Building sPrimeOrder
V-Sorting samples
V-Sorting samples time: 00:00:00
Allocating rank array
Ranking v-sort output
Ranking v-sort output time: 00:00:00
Invoking Larsson-Sadakane on ranks
Invoking Larsson-Sadakane on ranks time: 00:00:00
Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
(Using difference cover)
Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:00
Splitting and merging
Splitting and merging time: 00:00:00
Split 2, merged 5; iterating...
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:01
Splitting and merging
Splitting and merging time: 00:00:00
Avg bucket size: 583859 (target: 985262)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 409513
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 409514
Getting block 2 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 717594
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 717595
Getting block 3 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 275862
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 275863
Getting block 4 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 933544
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 933545
Getting block 5 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 456717
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 456718
Getting block 6 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:01
Sorting block of length 650578
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 650579
Getting block 7 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 551983
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 551984
Getting block 8 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 736987
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 736988
Getting block 9 of 9
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 521950
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 521951
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 1811471
fchr[G]: 2639376
fchr[T]: 3476168
fchr[$]: 5254736
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 6549449 bytes to primary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.1.bt2
Wrote 1313692 bytes to secondary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
len: 5254736
bwtLen: 5254737
sz: 1313684
bwtSz: 1313685
lineRate: 6
offRate: 4
offMask: 0xfffffff0
ftabChars: 10
eftabLen: 20
eftabSz: 80
ftabLen: 1048577
ftabSz: 4194308
offsLen: 328422
offsSz: 1313688
lineSz: 64
sideSz: 64
sideBwtSz: 48
sideBwtLen: 192
numSides: 27369
numLines: 27369
ebwtTotLen: 1751616
ebwtTotSz: 1751616
color: 0
reverse: 0
Total time for call to driver() for forward index: 00:00:02
Reading reference sizes
Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
Time to join reference sequences: 00:00:00
Time to reverse reference sequence: 00:00:00
bmax according to bmaxDivN setting: 1313684
Using parameters --bmax 985263 --dcv 1024
Doing ahead-of-time memory usage test
Passed! Constructing with these parameters: --bmax 985263 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
Building sPrime
Building sPrimeOrder
V-Sorting samples
V-Sorting samples time: 00:00:00
Allocating rank array
Ranking v-sort output
Ranking v-sort output time: 00:00:00
Invoking Larsson-Sadakane on ranks
Invoking Larsson-Sadakane on ranks time: 00:00:00
Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
(Using difference cover)
Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Binary sorting into buckets
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Binary sorting into buckets time: 00:00:00
Splitting and merging
Splitting and merging time: 00:00:00
Avg bucket size: 656841 (target: 985262)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 537964
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 537965
Getting block 2 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 965284
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 965285
Getting block 3 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 368748
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 368749
Getting block 4 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:01
Sorting block of length 970675
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 970676
Getting block 5 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 562616
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 562617
Getting block 6 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 804480
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 804481
Getting block 7 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:00
Sorting block of length 952899
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 952900
Getting block 8 of 8
Reserving size (985263) for bucket
Calculating Z arrays
Calculating Z arrays time: 00:00:00
Entering block accumulator loop:
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Block accumulator loop time: 00:00:01
Sorting block of length 92063
(Using difference cover)
Sorting block time: 00:00:00
Returning block of 92064
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 1811471
fchr[G]: 2639376
fchr[T]: 3476168
fchr[$]: 5254736
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 6549449 bytes to primary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.rev.1.bt2
Wrote 1313692 bytes to secondary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.rev.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
len: 5254736
bwtLen: 5254737
sz: 1313684
bwtSz: 1313685
lineRate: 6
offRate: 4
offMask: 0xfffffff0
ftabChars: 10
eftabLen: 20
eftabSz: 80
ftabLen: 1048577
ftabSz: 4194308
offsLen: 328422
offsSz: 1313688
lineSz: 64
sideSz: 64
sideBwtSz: 48
sideBwtLen: 192
numSides: 27369
numLines: 27369
ebwtTotLen: 1751616
ebwtTotSz: 1751616
color: 0
reverse: 1
Total time for backward call to driver() for mirror index: 00:00:03
820417 reads; of these:
820417 (100.00%) were unpaired; of these:
298465 (36.38%) aligned 0 times
513783 (62.62%) aligned exactly 1 time
8169 (1.00%) aligned >1 times
63.62% overall alignment rate
[samopen] SAM header is present: 11345 sequences.
You can take a look at the results of the mapping much like you did above when we were mapping reads to the NCBI genome.
In [34]:
!cat reads-mapped.count.txt
521952
In [35]:
!cat reads-unmapped.count.txt
298465
In [36]:
!cat reads.by.contigs.txt
k61_2 218 15 0
k61_3 206 6 0
k61_4 256 104 0
k61_5 258 14 0
k61_6 305 21 0
k61_7 284 13 0
k61_8 256 63 0
k61_9 593 51 0
k61_10 400 36 0
k61_11 463 26 0
k61_12 270 12 0
k61_13 344 26 0
k61_14 335 31 0
k61_15 243 14 0
k61_16 481 42 0
k61_17 456 17 0
k61_18 283 15 0
k61_19 428 27 0
k61_20 763 78 0
k61_21 240 20 0
k61_22 361 25 0
k61_23 1476 157 0
k61_24 441 24 0
k61_25 1197 102 0
k61_27 354 23 0
k61_28 567 34 0
k61_29 353 17 0
k61_30 988 69 0
k61_31 294 11 0
k61_32 334 24 0
k61_33 419 26 0
k61_34 644 54 0
k61_36 767 88 0
k61_37 318 23 0
k61_38 398 22 0
k61_39 469 58 0
k61_40 229 7 0
k61_41 279 12 0
k61_42 577 47 0
k61_44 606 54 0
k61_45 455 45 0
k61_46 248 24 0
k61_47 206 10 0
k61_48 615 59 0
k61_49 976 93 0
k61_50 570 67 0
k61_52 218 6 0
k61_53 1128 128 0
k61_54 210 8 0
k61_55 225 18 0
k61_56 262 20 0
k61_58 220 24 0
k61_59 400 19 0
k61_60 519 46 0
k61_61 203 9 0
k61_62 873 120 0
k61_63 368 16 0
k61_65 208 18 0
k61_66 410 39 0
k61_67 1100 169 0
k61_68 365 13 0
k61_69 277 23 0
k61_70 472 42 0
k61_71 475 39 0
k61_72 328 16 0
k61_73 225 23 0
k61_74 682 65 0
k61_75 440 41 0
k61_76 268 17 0
k61_77 280 31 0
k61_78 225 7 0
k61_79 295 20 0
k61_80 384 41 0
k61_81 209 5 0
k61_82 247 12 0
k61_83 1478 158 0
k61_84 256 12 0
k61_85 372 40 0
k61_86 370 25 0
k61_87 368 48 0
k61_88 370 20 0
k61_89 277 13 0
k61_90 673 50 0
k61_91 633 47 0
k61_92 327 16 0
k61_93 225 9 0
k61_94 403 35 0
k61_95 237 12 0
k61_96 337 20 0
k61_97 206 5 0
k61_98 254 9 0
k61_99 310 16 0
k61_101 715 65 0
k61_102 288 21 0
k61_103 590 54 0
k61_104 573 32 0
k61_105 2060 222 0
k61_106 454 21 0
k61_107 297 27 0
k61_108 755 63 0
k61_110 352 27 0
k61_111 294 23 0
k61_112 288 27 0
k61_113 230 16 0
k61_114 257 15 0
k61_115 748 58 0
k61_117 420 16 0
k61_118 370 26 0
k61_119 309 16 0
k61_120 858 88 0
k61_122 273 12 0
k61_123 278 15 0
k61_124 281 25 0
k61_125 353 18 0
k61_126 329 28 0
k61_127 247 14 0
k61_128 217 18 0
k61_129 543 57 0
k61_130 486 62 0
k61_131 299 23 0
k61_132 279 6 0
k61_133 687 69 0
k61_135 208 15 0
k61_139 212 7 0
k61_141 216 15 0
k61_142 318 15 0
k61_143 815 68 0
k61_144 286 19 0
k61_145 537 54 0
k61_146 462 36 0
k61_147 276 18 0
k61_148 479 168 0
k61_149 232 11 0
k61_150 895 95 0
k61_151 332 14 0
k61_152 236 9 0
k61_153 303 13 0
k61_154 494 51 0
k61_155 486 44 0
k61_156 807 72 0
k61_157 848 67 0
k61_158 1031 94 0
k61_159 509 52 0
k61_160 336 13 0
k61_161 292 22 0
k61_162 297 10 0
k61_163 302 24 0
k61_165 390 34 0
k61_166 338 34 0
k61_167 310 24 0
k61_168 225 18 0
k61_169 289 17 0
k61_170 335 106 0
k61_171 297 21 0
k61_173 250 21 0
k61_174 205 10 0
k61_175 250 24 0
k61_176 299 21 0
k61_177 514 40 0
k61_178 208 10 0
k61_179 232 20 0
k61_180 1294 129 0
k61_181 500 50 0
k61_182 867 84 0
k61_183 507 35 0
k61_184 230 16 0
k61_185 369 26 0
k61_186 263 17 0
k61_187 705 59 0
k61_189 1306 103 0
k61_190 201 10 0
k61_191 323 26 0
k61_192 221 9 0
k61_193 245 20 0
k61_194 436 24 0
k61_195 312 12 0
k61_196 1003 84 0
k61_197 268 12 0
k61_198 230 10 0
k61_199 334 18 0
k61_200 325 20 0
k61_201 488 49 0
k61_202 1165 89 0
k61_203 570 43 0
k61_204 237 12 0
k61_205 272 15 0
k61_206 1158 83 0
k61_207 606 48 0
k61_208 474 26 0
k61_209 227 9 0
k61_210 322 28 0
k61_211 244 12 0
k61_212 234 9 0
k61_214 569 41 0
k61_215 596 23 0
k61_216 421 31 0
k61_217 514 42 0
k61_219 483 34 0
k61_220 563 64 0
k61_222 514 51 0
k61_223 919 88 0
k61_224 649 59 0
k61_225 212 17 0
k61_226 452 48 0
k61_227 321 21 0
k61_228 390 42 0
k61_229 729 92 0
k61_230 283 16 0
k61_231 407 49 0
k61_232 432 27 0
k61_233 231 13 0
k61_235 201 11 0
k61_236 311 17 0
k61_238 841 89 0
k61_239 257 11 0
k61_240 436 37 0
k61_241 216 15 0
k61_242 407 37 0
k61_243 492 48 0
k61_244 205 12 0
k61_246 302 23 0
k61_247 477 44 0
k61_248 226 8 0
k61_249 524 37 0
k61_251 217 5 0
k61_252 1270 120 0
k61_254 240 11 0
k61_255 289 23 0
k61_256 352 18 0
k61_257 377 37 0
k61_258 219 18 0
k61_259 202 10 0
k61_260 318 17 0
k61_261 306 16 0
k61_262 252 19 0
k61_263 317 14 0
k61_264 253 22 0
k61_265 1289 116 0
k61_266 439 33 0
k61_267 439 27 0
k61_268 419 29 0
k61_269 328 15 0
k61_270 392 33 0
k61_271 361 28 0
k61_272 242 22 0
k61_273 419 18 0
k61_274 594 56 0
k61_277 480 30 0
k61_279 253 18 0
k61_280 780 71 0
k61_281 776 68 0
k61_282 305 14 0
k61_283 327 37 0
k61_284 619 53 0
k61_285 442 33 0
k61_286 558 32 0
k61_287 233 16 0
k61_289 292 20 0
k61_290 250 9 0
k61_292 280 21 0
k61_293 271 15 0
k61_294 372 32 0
k61_295 475 33 0
k61_296 330 36 0
k61_297 291 12 0
k61_299 632 48 0
k61_300 207 7 0
k61_301 278 13 0
k61_302 481 31 0
k61_303 849 77 0
k61_304 386 19 0
k61_305 413 32 0
k61_306 252 9 0
k61_307 879 66 0
k61_308 236 10 0
k61_309 307 14 0
k61_310 642 48 0
k61_311 233 63 0
k61_312 233 10 0
k61_313 250 24 0
k61_315 256 24 0
k61_316 299 28 0
k61_317 209 7 0
k61_318 407 30 0
k61_320 226 8 0
k61_321 291 12 0
k61_322 235 15 0
k61_323 272 24 0
k61_324 528 47 0
k61_325 303 12 0
k61_327 703 72 0
k61_328 240 9 0
k61_329 255 18 0
k61_330 514 50 0
k61_331 579 33 0
k61_332 335 18 0
k61_333 464 48 0
k61_334 243 9 0
k61_336 1631 151 0
k61_337 281 10 0
k61_338 1266 134 0
k61_339 456 40 0
k61_340 213 12 0
k61_341 319 24 0
k61_342 347 28 0
k61_343 256 21 0
k61_344 313 24 0
k61_346 246 14 0
k61_347 208 21 0
k61_349 732 44 0
k61_350 305 26 0
k61_351 437 27 0
k61_352 306 20 0
k61_353 481 39 0
k61_354 775 39 0
k61_355 961 88 0
k61_356 1363 168 0
k61_358 308 21 0
k61_359 329 12 0
k61_361 200 10 0
k61_362 2581 277 0
k61_363 495 43 0
k61_364 515 33 0
k61_365 479 60 0
k61_366 230 15 0
k61_367 336 40 0
k61_368 487 41 0
k61_369 591 48 0
k61_370 446 39 0
k61_371 276 22 0
k61_372 386 33 0
k61_373 229 21 0
k61_374 695 53 0
k61_375 229 13 0
k61_376 400 43 0
k61_377 476 35 0
k61_379 330 14 0
k61_380 278 20 0
k61_381 823 59 0
k61_382 235 10 0
k61_383 1309 111 0
k61_384 920 99 0
k61_385 236 18 0
k61_386 291 29 0
k61_387 230 17 0
k61_388 224 11 0
k61_389 316 26 0
k61_390 454 32 0
k61_391 219 6 0
k61_392 391 31 0
k61_393 255 12 0
k61_394 368 21 0
k61_396 295 12 0
k61_397 246 13 0
k61_398 718 68 0
k61_399 353 32 0
k61_400 597 44 0
k61_401 392 28 0
k61_402 889 75 0
k61_403 315 19 0
k61_404 597 53 0
k61_405 332 19 0
k61_406 209 20 0
k61_407 227 22 0
k61_408 1426 123 0
k61_409 443 29 0
k61_410 200 7 0
k61_411 250 16 0
k61_412 275 20 0
k61_413 623 55 0
k61_414 201 13 0
k61_415 347 33 0
k61_416 353 31 0
k61_417 225 13 0
k61_418 524 40 0
k61_419 530 61 0
k61_421 606 50 0
k61_422 451 32 0
k61_423 223 11 0
k61_424 214 9 0
k61_425 202 10 0
k61_426 407 35 0
k61_427 342 17 0
k61_428 206 22 0
k61_430 597 46 0
k61_431 300 15 0
k61_432 552 47 0
k61_433 436 38 0
k61_434 235 14 0
k61_435 273 12 0
k61_436 208 17 0
k61_437 253 11 0
k61_438 356 27 0
k61_439 431 39 0
k61_440 272 17 0
k61_441 536 53 0
k61_442 344 23 0
k61_443 1312 148 0
k61_444 354 25 0
k61_445 254 11 0
k61_446 223 8 0
k61_447 218 5 0
k61_448 669 51 0
k61_449 271 27 0
k61_450 872 77 0
k61_451 407 34 0
k61_452 449 41 0
k61_453 235 9 0
k61_455 257 11 0
k61_456 422 30 0
k61_457 262 19 0
k61_458 537 43 0
k61_459 685 73 0
k61_460 277 23 0
k61_461 229 19 0
k61_462 665 61 0
k61_463 298 26 0
k61_464 309 23 0
k61_465 667 56 0
k61_466 292 17 0
k61_467 359 25 0
k61_468 227 6 0
k61_469 8884 2671 0
k61_470 300 23 0
k61_471 290 10 0
k61_472 284 12 0
k61_473 666 71 0
k61_474 971 95 0
k61_475 371 16 0
k61_476 305 20 0
k61_477 410 17 0
k61_478 208 8 0
k61_479 222 27 0
k61_480 412 27 0
k61_481 505 31 0
k61_482 288 14 0
k61_484 630 50 0
k61_485 204 8 0
k61_486 213 13 0
k61_487 490 45 0
k61_488 225 17 0
k61_491 321 20 0
k61_492 273 20 0
k61_493 812 55 0
k61_495 1004 103 0
k61_496 1106 109 0
k61_497 334 17 0
k61_498 359 28 0
k61_499 270 27 0
k61_500 239 18 0
k61_501 2311 229 0
k61_503 1710 147 0
k61_504 746 96 0
k61_505 245 8 0
k61_506 357 39 0
k61_507 319 28 0
k61_508 214 10 0
k61_509 205 12 0
k61_510 548 50 0
k61_511 238 17 0
k61_512 465 61 0
k61_513 339 29 0
k61_514 267 17 0
k61_515 209 8 0
k61_516 731 55 0
k61_517 1285 101 0
k61_518 241 14 0
k61_519 221 16 0
k61_520 972 111 0
k61_521 405 19 0
k61_522 260 19 0
k61_523 548 57 0
k61_524 217 7 0
k61_525 426 27 0
k61_526 543 45 0
k61_527 299 12 0
k61_528 919 93 0
k61_529 512 38 0
k61_530 236 14 0
k61_531 471 38 0
k61_532 200 7 0
k61_533 1461 142 0
k61_534 257 15 0
k61_535 218 17 0
k61_536 1044 118 0
k61_537 205 11 0
k61_538 275 17 0
k61_539 443 41 0
k61_540 254 7 0
k61_541 420 42 0
k61_542 274 16 0
k61_543 274 18 0
k61_544 273 21 0
k61_545 512 32 0
k61_546 591 54 0
k61_547 233 22 0
k61_548 342 20 0
k61_549 210 18 0
k61_550 374 28 0
k61_551 226 18 0
k61_552 420 23 0
k61_553 324 14 0
k61_554 374 30 0
k61_555 233 26 0
k61_556 481 49 0
k61_557 227 10 0
k61_558 287 24 0
k61_559 400 27 0
k61_560 607 49 0
k61_561 352 33 0
k61_562 1210 112 0
k61_564 331 16 0
k61_565 208 17 0
k61_566 283 10 0
k61_567 293 10 0
k61_568 215 11 0
k61_569 1238 114 0
k61_570 215 9 0
k61_571 282 16 0
k61_572 204 12 0
k61_573 521 45 0
k61_574 736 55 0
k61_575 398 27 0
k61_576 937 78 0
k61_577 238 11 0
k61_578 251 14 0
k61_579 394 32 0
k61_580 207 10 0
k61_581 351 29 0
k61_582 234 13 0
k61_583 247 10 0
k61_584 246 10 0
k61_585 1318 131 0
k61_586 468 41 0
k61_588 1025 373 0
k61_589 244 8 0
k61_590 214 9 0
k61_592 225 7 0
k61_593 476 36 0
k61_594 214 7 0
k61_595 810 100 0
k61_596 245 6 0
k61_597 220 10 0
k61_598 1221 116 0
k61_599 1644 151 0
k61_600 277 15 0
k61_601 309 16 0
k61_602 390 29 0
k61_603 494 48 0
k61_605 207 9 0
k61_606 214 7 0
k61_607 658 79 0
k61_608 366 24 0
k61_610 322 17 0
k61_611 640 44 0
k61_612 331 23 0
k61_613 558 62 0
k61_614 270 21 0
k61_615 453 39 0
k61_616 286 14 0
k61_617 218 21 0
k61_618 285 11 0
k61_619 346 29 0
k61_620 590 29 0
k61_621 231 6 0
k61_622 289 16 0
k61_623 596 56 0
k61_624 546 45 0
k61_625 326 12 0
k61_626 250 27 0
k61_627 259 21 0
k61_629 233 9 0
k61_630 256 21 0
k61_632 1870 1641 0
k61_633 842 74 0
k61_634 211 11 0
k61_635 441 46 0
k61_636 390 35 0
k61_637 360 37 0
k61_638 321 15 0
k61_639 215 17 0
k61_640 311 14 0
k61_641 263 24 0
k61_642 399 34 0
k61_643 471 46 0
k61_644 432 30 0
k61_645 278 11 0
k61_646 275 10 0
k61_647 1129 91 0
k61_648 369 28 0
k61_649 475 27 0
k61_650 1619 144 0
k61_651 202 10 0
k61_652 1138 95 0
k61_653 218 10 0
k61_654 269 17 0
k61_655 351 32 0
k61_656 713 65 0
k61_657 228 21 0
k61_658 202 20 0
k61_659 647 65 0
k61_661 312 21 0
k61_662 442 39 0
k61_663 313 25 0
k61_664 746 60 0
k61_665 644 55 0
k61_666 220 11 0
k61_667 358 24 0
k61_668 340 29 0
k61_669 470 29 0
k61_670 400 41 0
k61_671 264 17 0
k61_672 873 85 0
k61_673 1083 104 0
k61_674 236 7 0
k61_675 238 6 0
k61_676 551 32 0
k61_677 669 37 0
k61_678 247 23 0
k61_679 1788 179 0
k61_680 219 12 0
k61_681 332 20 0
k61_683 1025 101 0
k61_684 247 19 0
k61_685 222 23 0
k61_686 250 9 0
k61_687 245 18 0
k61_688 532 33 0
k61_689 426 29 0
k61_691 243 19 0
k61_692 561 54 0
k61_693 629 48 0
k61_694 464 32 0
k61_695 229 20 0
k61_696 396 20 0
k61_697 262 11 0
k61_698 303 31 0
k61_699 558 27 0
k61_700 252 16 0
k61_701 410 44 0
k61_703 345 33 0
k61_704 239 20 0
k61_705 500 44 0
k61_706 385 37 0
k61_707 205 16 0
k61_708 288 14 0
k61_709 357 18 0
k61_710 266 10 0
k61_711 381 29 0
k61_712 339 27 0
k61_713 304 14 0
k61_714 495 57 0
k61_715 875 69 0
k61_716 407 26 0
k61_717 878 67 0
k61_719 234 20 0
k61_720 730 66 0
k61_721 671 68 0
k61_722 220 18 0
k61_723 497 25 0
k61_724 398 29 0
k61_725 563 57 0
k61_726 225 7 0
k61_727 234 11 0
k61_728 551 57 0
k61_729 686 49 0
k61_730 409 40 0
k61_731 288 14 0
k61_732 238 16 0
k61_733 242 17 0
k61_734 1322 138 0
k61_736 368 27 0
k61_737 941 86 0
k61_738 293 14 0
k61_739 219 20 0
k61_740 209 21 0
k61_742 237 10 0
k61_743 247 16 0
k61_744 212 20 0
k61_745 318 21 0
k61_746 209 5 0
k61_747 430 47 0
k61_748 215 10 0
k61_749 485 43 0
k61_750 436 48 0
k61_751 414 31 0
k61_752 260 15 0
k61_753 325 17 0
k61_754 1437 237 0
k61_755 521 40 0
k61_757 205 10 0
k61_758 466 58 0
k61_760 438 50 0
k61_761 374 35 0
k61_763 380 17 0
k61_768 201 10 0
k61_769 204 10 0
k61_770 1006 98 0
k61_771 381 37 0
k61_772 252 11 0
k61_773 268 26 0
k61_775 661 61 0
k61_776 541 30 0
k61_777 240 24 0
k61_778 286 14 0
k61_779 303 16 0
k61_780 382 33 0
k61_781 227 12 0
k61_783 526 37 0
k61_784 2334 226 0
k61_785 404 38 0
k61_786 254 13 0
k61_787 411 29 0
k61_789 276 11 0
k61_790 501 31 0
k61_791 410 25 0
k61_792 255 14 0
k61_793 651 84 0
k61_794 390 44 0
k61_795 701 69 0
k61_796 429 28 0
k61_797 253 15 0
k61_798 1130 97 0
k61_799 296 6 0
k61_800 265 23 0
k61_801 628 35 0
k61_802 1792 165 0
k61_803 810 63 0
k61_804 663 47 0
k61_805 352 17 0
k61_806 252 10 0
k61_808 414 30 0
k61_809 298 13 0
k61_811 261 12 0
k61_813 465 45 0
k61_814 427 44 0
k61_815 447 43 0
k61_816 784 65 0
k61_817 251 19 0
k61_818 225 9 0
k61_819 233 8 0
k61_820 210 6 0
k61_821 1079 117 0
k61_822 743 73 0
k61_823 361 39 0
k61_824 288 22 0
k61_826 311 30 0
k61_827 263 12 0
k61_828 519 38 0
k61_829 323 32 0
k61_830 976 120 0
k61_831 239 13 0
k61_832 599 37 0
k61_833 1821 216 0
k61_834 207 17 0
k61_835 214 19 0
k61_836 248 8 0
k61_837 222 9 0
k61_838 405 29 0
k61_839 499 33 0
k61_840 285 23 0
k61_841 665 77 0
k61_842 535 22 0
k61_843 321 18 0
k61_844 200 17 0
k61_845 383 40 0
k61_846 422 21 0
k61_847 223 15 0
k61_848 239 16 0
k61_849 229 10 0
k61_850 413 46 0
k61_851 242 17 0
k61_852 811 75 0
k61_853 464 35 0
k61_854 612 39 0
k61_856 370 15 0
k61_857 488 32 0
k61_858 942 86 0
k61_859 342 17 0
k61_860 575 63 0
k61_861 481 43 0
k61_862 274 20 0
k61_863 433 38 0
k61_865 746 65 0
k61_866 201 8 0
k61_867 300 15 0
k61_868 932 97 0
k61_869 325 28 0
k61_870 326 18 0
k61_871 250 24 0
k61_872 224 13 0
k61_873 2346 185 0
k61_874 221 10 0
k61_875 222 10 0
k61_876 364 18 0
k61_878 309 25 0
k61_879 497 30 0
k61_880 612 68 0
k61_881 282 21 0
k61_882 271 25 0
k61_883 366 33 0
k61_884 1449 137 0
k61_885 552 68 0
k61_886 287 17 0
k61_887 211 12 0
k61_888 1277 137 0
k61_889 265 10 0
k61_890 209 5 0
k61_891 412 39 0
k61_892 240 11 0
k61_893 551 38 0
k61_894 239 14 0
k61_895 819 92 0
k61_896 203 22 0
k61_897 695 58 0
k61_898 281 17 0
k61_899 440 29 0
k61_900 220 11 0
k61_901 235 9 0
k61_902 309 32 0
k61_903 618 55 0
k61_904 911 70 0
k61_906 274 21 0
k61_907 1180 86 0
k61_908 657 52 0
k61_909 239 8 0
k61_910 212 7 0
k61_912 302 19 0
k61_913 383 23 0
k61_914 257 10 0
k61_915 209 7 0
k61_917 581 62 0
k61_919 554 31 0
k61_920 304 31 0
k61_921 207 5 0
k61_922 202 7 0
k61_923 668 46 0
k61_924 226 14 0
k61_926 729 66 0
k61_927 741 87 0
k61_928 344 26 0
k61_929 534 42 0
k61_930 315 22 0
k61_932 406 17 0
k61_934 385 39 0
k61_935 319 20 0
k61_936 384 32 0
k61_937 307 27 0
k61_938 321 15 0
k61_939 266 10 0
k61_940 201 34 0
k61_941 235 11 0
k61_942 236 13 0
k61_943 386 35 0
k61_944 387 21 0
k61_945 321 25 0
k61_946 268 24 0
k61_948 222 10 0
k61_949 695 73 0
k61_950 205 7 0
k61_951 453 50 0
k61_952 406 32 0
k61_953 356 25 0
k61_954 234 27 0
k61_955 220 18 0
k61_956 261 10 0
k61_957 547 39 0
k61_958 475 44 0
k61_959 379 36 0
k61_960 393 18 0
k61_961 456 29 0
k61_964 204 14 0
k61_965 247 18 0
k61_966 483 36 0
k61_968 527 47 0
k61_969 346 22 0
k61_970 231 19 0
k61_971 666 56 0
k61_972 948 88 0
k61_973 668 67 0
k61_974 490 45 0
k61_975 1047 123 0
k61_976 451 27 0
k61_978 612 71 0
k61_979 349 19 0
k61_980 201 12 0
k61_981 300 13 0
k61_982 783 79 0
k61_983 406 21 0
k61_984 247 9 0
k61_985 412 34 0
k61_987 486 29 0
k61_988 394 34 0
k61_989 581 34 0
k61_990 648 48 0
k61_991 400 36 0
k61_992 2335 265 0
k61_993 206 6 0
k61_994 389 32 0
k61_995 931 98 0
k61_996 323 17 0
k61_997 297 36 0
k61_998 306 14 0
k61_999 307 15 0
k61_1000 310 17 0
k61_1001 878 73 0
k61_1002 428 27 0
k61_1004 261 17 0
k61_1005 308 25 0
k61_1006 1201 79 0
k61_1007 314 23 0
k61_1008 671 60 0
k61_1009 219 8 0
k61_1010 284 16 0
k61_1011 589 63 0
k61_1012 1087 89 0
k61_1013 216 11 0
k61_1014 1373 141 0
k61_1015 355 18 0
k61_1016 360 16 0
k61_1017 210 13 0
k61_1018 400 25 0
k61_1019 211 9 0
k61_1020 506 35 0
k61_1021 211 8 0
k61_1022 393 36 0
k61_1023 415 25 0
k61_1024 314 27 0
k61_1025 307 17 0
k61_1026 219 7 0
k61_1028 1905 240 0
k61_1029 362 29 0
k61_1030 817 92 0
k61_1031 834 91 0
k61_1032 211 8 0
k61_1033 1031 103 0
k61_1034 289 11 0
k61_1035 231 11 0
k61_1036 518 213 0
k61_1037 207 18 0
k61_1038 288 14 0
k61_1039 211 10 0
k61_1041 357 15 0
k61_1044 425 31 0
k61_1045 1669 279 0
k61_1046 202 7 0
k61_1047 237 21 0
k61_1048 272 10 0
k61_1049 201 10 0
k61_1050 407 29 0
k61_1051 207 15 0
k61_1053 1242 121 0
k61_1054 599 44 0
k61_1055 780 76 0
k61_1056 275 13 0
k61_1057 414 23 0
k61_1058 498 32 0
k61_1059 358 23 0
k61_1060 251 8 0
k61_1061 269 13 0
k61_1062 490 58 0
k61_1063 265 11 0
k61_1064 263 17 0
k61_1065 699 54 0
k61_1068 352 41 0
k61_1069 372 25 0
k61_1070 645 62 0
k61_1071 274 11 0
k61_1072 307 29 0
k61_1073 221 12 0
k61_1074 459 38 0
k61_1075 540 32 0
k61_1076 399 26 0
k61_1077 348 20 0
k61_1078 332 24 0
k61_1079 652 32 0
k61_1081 548 29 0
k61_1082 216 7 0
k61_1086 347 15 0
k61_1087 320 25 0
k61_1088 242 24 0
k61_1089 299 23 0
k61_1090 548 49 0
k61_1091 559 46 0
k61_1092 660 77 0
k61_1093 384 22 0
k61_1094 248 14 0
k61_1095 460 21 0
k61_1097 556 37 0
k61_1098 205 13 0
k61_1099 852 66 0
k61_1100 224 12 0
k61_1101 288 12 0
k61_1102 286 10 0
k61_1103 411 15 0
k61_1104 224 21 0
k61_1105 234 18 0
k61_1106 210 16 0
k61_1107 219 19 0
k61_1108 240 10 0
k61_1109 553 43 0
k61_1110 215 16 0
k61_1111 569 38 0
k61_1112 312 22 0
k61_1113 648 51 0
k61_1114 211 18 0
k61_1115 318 16 0
k61_1117 790 63 0
k61_1118 918 63 0
k61_1119 726 60 0
k61_1120 249 19 0
k61_1121 762 67 0
k61_1122 322 24 0
k61_1123 213 9 0
k61_1124 231 25 0
k61_1125 244 25 0
k61_1126 365 33 0
k61_1127 577 72 0
k61_1128 571 63 0
k61_1129 417 29 0
k61_1130 238 18 0
k61_1131 1315 95 0
k61_1132 205 10 0
k61_1133 222 8 0
k61_1134 326 30 0
k61_1135 215 9 0
k61_1136 360 39 0
k61_1137 1094 95 0
k61_1138 932 78 0
k61_1139 265 26 0
k61_1140 321 23 0
k61_1141 239 19 0
k61_1142 686 51 0
k61_1144 393 15 0
k61_1145 340 32 0
k61_1146 335 37 0
k61_1147 299 11 0
k61_1148 1401 130 0
k61_1149 253 18 0
k61_1150 699 70 0
k61_1151 276 16 0
k61_1152 202 7 0
k61_1153 535 38 0
k61_1154 857 75 0
k61_1155 302 21 0
k61_1156 414 34 0
k61_1157 789 89 0
k61_1158 690 68 0
k61_1159 742 49 0
k61_1160 257 43 0
k61_1161 585 54 0
k61_1162 291 12 0
k61_1163 622 50 0
k61_1164 242 16 0
k61_1165 933 85 0
k61_1167 324 20 0
k61_1168 303 15 0
k61_1169 258 9 0
k61_1171 230 17 0
k61_1172 227 33 0
k61_1173 416 32 0
k61_1174 604 47 0
k61_1175 388 68 0
k61_1176 218 7 0
k61_1178 700 65 0
k61_1179 413 26 0
k61_1180 387 23 0
k61_1182 861 87 0
k61_1183 1577 162 0
k61_1184 497 42 0
k61_1185 441 38 0
k61_1186 849 83 0
k61_1187 358 34 0
k61_1188 282 11 0
k61_1189 582 64 0
k61_1190 819 103 0
k61_1191 281 26 0
k61_1193 518 34 0
k61_1194 303 17 0
k61_1195 428 34 0
k61_1196 1110 104 0
k61_1197 1103 128 0
k61_1198 277 13 0
k61_1199 994 87 0
k61_1200 209 9 0
k61_1201 231 19 0
k61_1202 869 77 0
k61_1203 425 33 0
k61_1204 923 83 0
k61_1205 628 57 0
k61_1206 313 29 0
k61_1207 623 51 0
k61_1208 306 16 0
k61_1209 247 18 0
k61_1210 401 35 0
k61_1211 204 11 0
k61_1212 960 148 0
k61_1213 654 50 0
k61_1215 525 66 0
k61_1217 245 12 0
k61_1218 254 16 0
k61_1219 235 13 0
k61_1220 259 24 0
k61_1221 819 70 0
k61_1222 327 15 0
k61_1223 219 30 0
k61_1224 1368 150 0
k61_1225 293 15 0
k61_1226 237 15 0
k61_1227 217 6 0
k61_1228 211 12 0
k61_1229 265 14 0
k61_1230 274 9 0
k61_1231 684 82 0
k61_1232 241 17 0
k61_1233 212 12 0
k61_1234 390 30 0
k61_1236 258 27 0
k61_1237 358 23 0
k61_1238 726 64 0
k61_1239 244 14 0
k61_1240 828 83 0
k61_1241 342 36 0
k61_1242 916 72 0
k61_1243 313 24 0
k61_1244 508 37 0
k61_1245 286 24 0
k61_1246 206 14 0
k61_1247 273 16 0
k61_1248 439 38 0
k61_1249 238 16 0
k61_1250 504 45 0
k61_1251 265 12 0
k61_1252 284 9 0
k61_1253 286 12 0
k61_1254 476 33 0
k61_1255 377 27 0
k61_1256 233 12 0
k61_1257 389 52 0
k61_1258 218 18 0
k61_1259 337 12 0
k61_1261 229 17 0
k61_1262 2576 318 0
k61_1264 334 19 0
k61_1265 2305 215 0
k61_1266 937 105 0
k61_1268 230 17 0
k61_1269 433 52 0
k61_1270 263 19 0
k61_1271 317 17 0
k61_1272 602 57 0
k61_1273 233 9 0
k61_1275 276 14 0
k61_1276 250 15 0
k61_1278 220 19 0
k61_1279 425 34 0
k61_1280 520 38 0
k61_1281 545 45 0
k61_1282 361 41 0
k61_1283 243 10 0
k61_1285 309 19 0
k61_1286 294 14 0
k61_1287 501 40 0
k61_1289 876 82 0
k61_1290 396 28 0
k61_1291 382 23 0
k61_1292 470 55 0
k61_1293 898 80 0
k61_1294 233 10 0
k61_1295 216 11 0
k61_1296 427 30 0
k61_1297 363 27 0
k61_1298 362 28 0
k61_1299 608 57 0
k61_1300 294 19 0
k61_1301 201 12 0
k61_1303 456 39 0
k61_1304 225 12 0
k61_1305 321 18 0
k61_1306 224 7 0
k61_1307 665 47 0
k61_1309 237 20 0
k61_1310 532 40 0
k61_1311 432 35 0
k61_1312 294 7 0
k61_1313 270 25 0
k61_1314 370 41 0
k61_1315 265 33 0
k61_1316 234 10 0
k61_1317 635 61 0
k61_1318 350 25 0
k61_1319 539 56 0
k61_1320 219 14 0
k61_1321 393 23 0
k61_1322 296 28 0
k61_1323 246 11 0
k61_1324 327 36 0
k61_1325 307 21 0
k61_1327 652 56 0
k61_1328 283 14 0
k61_1329 218 10 0
k61_1330 208 15 0
k61_1332 300 25 0
k61_1333 269 25 0
k61_1334 201 18 0
k61_1335 465 50 0
k61_1336 1933 179 0
k61_1337 293 23 0
k61_1338 267 23 0
k61_1339 454 48 0
k61_1340 265 16 0
k61_1341 457 61 0
k61_1342 553 40 0
k61_1343 501 20 0
k61_1345 455 38 0
k61_1346 393 43 0
k61_1347 274 17 0
k61_1348 3383 279 0
k61_1349 452 60 0
k61_1350 580 41 0
k61_1351 1054 76 0
k61_1352 295 28 0
k61_1353 376 32 0
k61_1354 877 64 0
k61_1355 234 14 0
k61_1356 1760 197 0
k61_1357 310 13 0
k61_1358 274 23 0
k61_1359 237 21 0
k61_1360 281 13 0
k61_1361 277 25 0
k61_1362 204 6 0
k61_1363 705 55 0
k61_1364 539 45 0
k61_1365 474 22 0
k61_1366 422 24 0
k61_1367 1164 105 0
k61_1368 777 49 0
k61_1369 248 20 0
k61_1370 801 56 0
k61_1371 222 8 0
k61_1372 258 26 0
k61_1374 258 21 0
k61_1375 311 21 0
k61_1376 592 34 0
k61_1377 514 56 0
k61_1378 206 10 0
k61_1379 2319 289 0
k61_1380 292 15 0
k61_1381 477 35 0
k61_1382 293 25 0
k61_1383 369 22 0
k61_1384 599 42 0
k61_1385 211 15 0
k61_1386 309 24 0
k61_1387 333 21 0
k61_1388 365 34 0
k61_1389 348 37 0
k61_1390 530 45 0
k61_1391 1478 551 0
k61_1392 300 25 0
k61_1393 1045 65 0
k61_1394 259 11 0
k61_1396 515 34 0
k61_1397 314 23 0
k61_1398 318 25 0
k61_1399 238 12 0
k61_1400 319 16 0
k61_1401 227 22 0
k61_1402 1031 67 0
k61_1403 756 60 0
k61_1404 265 11 0
k61_1405 227 12 0
k61_1406 255 10 0
k61_1407 740 56 0
k61_1408 227 7 0
k61_1409 375 20 0
k61_1410 291 25 0
k61_1411 486 40 0
k61_1412 226 10 0
k61_1413 816 47 0
k61_1414 474 27 0
k61_1415 4241 931 0
k61_1416 265 18 0
k61_1417 321 18 0
k61_1418 482 37 0
k61_1419 677 54 0
k61_1420 293 21 0
k61_1421 3438 374 0
k61_1422 749 74 0
k61_1423 298 12 0
k61_1424 554 43 0
k61_1425 613 46 0
k61_1427 549 35 0
k61_1428 353 21 0
k61_1429 637 38 0
k61_1430 542 41 0
k61_1431 249 20 0
k61_1432 241 13 0
k61_1433 200 5 0
k61_1434 218 11 0
k61_1435 1736 211 0
k61_1436 215 6 0
k61_1437 2496 282 0
k61_1438 219 10 0
k61_1439 202 8 0
k61_1440 491 37 0
k61_1441 340 34 0
k61_1442 1165 111 0
k61_1443 214 17 0
k61_1444 201 14 0
k61_1445 332 15 0
k61_1446 889 63 0
k61_1447 938 104 0
k61_1448 977 111 0
k61_1449 383 31 0
k61_1450 968 106 0
k61_1451 228 19 0
k61_1452 618 46 0
k61_1453 294 13 0
k61_1454 516 25 0
k61_1455 415 46 0
k61_1456 1540 161 0
k61_1457 544 47 0
k61_1458 229 10 0
k61_1459 343 29 0
k61_1460 217 12 0
k61_1461 984 83 0
k61_1462 248 11 0
k61_1463 327 21 0
k61_1464 362 34 0
k61_1465 1075 133 0
k61_1466 276 9 0
k61_1467 298 10 0
k61_1468 319 22 0
k61_1469 251 16 0
k61_1470 371 24 0
k61_1471 236 9 0
k61_1472 376 31 0
k61_1473 211 9 0
k61_1474 236 8 0
k61_1475 418 34 0
k61_1476 323 22 0
k61_1477 451 38 0
k61_1478 261 9 0
k61_1479 277 12 0
k61_1480 1075 122 0
k61_1481 490 51 0
k61_1482 561 55 0
k61_1483 386 35 0
k61_1484 523 37 0
k61_1485 231 11 0
k61_1486 234 19 0
k61_1487 361 13 0
k61_1488 944 105 0
k61_1489 609 51 0
k61_1490 932 101 0
k61_1491 306 20 0
k61_1492 223 10 0
k61_1493 359 27 0
k61_1494 677 74 0
k61_1495 407 33 0
k61_1496 625 50 0
k61_1497 268 11 0
k61_1499 446 26 0
k61_1500 331 16 0
k61_1502 605 56 0
k61_1503 784 68 0
k61_1505 760 69 0
k61_1506 919 72 0
k61_1507 746 67 0
k61_1508 697 52 0
k61_1509 665 64 0
k61_1510 291 26 0
k61_1511 446 41 0
k61_1512 291 13 0
k61_1513 225 12 0
k61_1514 728 64 0
k61_1515 599 52 0
k61_1516 315 24 0
k61_1517 235 13 0
k61_1518 370 29 0
k61_1519 388 23 0
k61_1520 272 28 0
k61_1521 346 44 0
k61_1522 406 25 0
k61_1523 334 36 0
k61_1524 429 19 0
k61_1525 1167 113 0
k61_1526 886 65 0
k61_1527 322 13 0
k61_1528 216 7 0
k61_1529 626 48 0
k61_1530 720 52 0
k61_1531 256 14 0
k61_1532 368 28 0
k61_1533 205 10 0
k61_1534 217 13 0
k61_1535 486 23 0
k61_1536 1620 155 0
k61_1538 254 18 0
k61_1539 266 20 0
k61_1540 432 46 0
k61_1542 222 16 0
k61_1543 398 20 0
k61_1544 236 9 0
k61_1545 612 51 0
k61_1547 299 12 0
k61_1548 412 33 0
k61_1549 208 10 0
k61_1550 305 10 0
k61_1552 921 72 0
k61_1553 308 19 0
k61_1554 666 40 0
k61_1556 356 34 0
k61_1557 245 15 0
k61_1559 1495 153 0
k61_1560 200 13 0
k61_1561 411 28 0
k61_1562 474 78 0
k61_1563 898 64 0
k61_1564 328 14 0
k61_1566 313 28 0
k61_1568 434 28 0
k61_1569 1233 119 0
k61_1570 217 8 0
k61_1571 248 19 0
k61_1572 214 10 0
k61_1573 501 56 0
k61_1574 607 63 0
k61_1576 1650 146 0
k61_1577 258 22 0
k61_1578 253 26 0
k61_1579 275 21 0
k61_1580 240 15 0
k61_1581 503 40 0
k61_1582 242 10 0
k61_1583 527 52 0
k61_1584 872 138 0
k61_1585 212 14 0
k61_1586 869 68 0
k61_1587 416 22 0
k61_1588 1251 124 0
k61_1589 556 56 0
k61_1590 383 24 0
k61_1591 205 13 0
k61_1592 231 17 0
k61_1593 823 66 0
k61_1594 201 6 0
k61_1595 284 19 0
k61_1596 220 17 0
k61_1597 201 5 0
k61_1598 813 74 0
k61_1599 223 8 0
k61_1600 369 28 0
k61_1602 866 52 0
k61_1603 287 21 0
k61_1604 475 40 0
k61_1605 276 19 0
k61_1606 207 15 0
k61_1607 417 26 0
k61_1608 719 56 0
k61_1609 300 16 0
k61_1611 678 72 0
k61_1612 362 12 0
k61_1613 252 17 0
k61_1614 681 79 0
k61_1615 209 11 0
k61_1616 247 10 0
k61_1617 245 13 0
k61_1618 204 9 0
k61_1619 348 30 0
k61_1620 509 31 0
k61_1621 385 46 0
k61_1623 202 7 0
k61_1624 1131 108 0
k61_1625 712 56 0
k61_1626 810 73 0
k61_1627 1531 163 0
k61_1628 237 13 0
k61_1629 229 18 0
k61_1631 370 19 0
k61_1633 765 78 0
k61_1634 306 18 0
k61_1635 783 87 0
k61_1637 271 19 0
k61_1638 378 35 0
k61_1639 222 14 0
k61_1640 509 58 0
k61_1641 1104 103 0
k61_1642 428 30 0
k61_1643 2639 274 0
k61_1644 356 26 0
k61_1645 242 12 0
k61_1646 577 54 0
k61_1647 294 26 0
k61_1648 368 33 0
k61_1649 671 41 0
k61_1650 215 13 0
k61_1651 363 17 0
k61_1652 334 20 0
k61_1653 222 19 0
k61_1655 279 11 0
k61_1656 215 11 0
k61_1657 276 8 0
k61_1658 273 30 0
k61_1659 351 26 0
k61_1660 1503 128 0
k61_1661 473 36 0
k61_1662 272 30 0
k61_1663 237 9 0
k61_1664 291 14 0
k61_1665 200 10 0
k61_1666 464 123 0
k61_1667 305 13 0
k61_1668 261 20 0
k61_1669 274 11 0
k61_1670 362 38 0
k61_1671 382 29 0
k61_1672 338 30 0
k61_1673 623 44 0
k61_1674 296 17 0
k61_1675 302 13 0
k61_1676 519 18 0
k61_1677 205 8 0
k61_1678 384 38 0
k61_1680 474 35 0
k61_1681 348 33 0
k61_1682 540 48 0
k61_1683 428 26 0
k61_1684 549 48 0
k61_1685 259 24 0
k61_1687 317 21 0
k61_1688 375 20 0
k61_1689 310 26 0
k61_1690 321 18 0
k61_1691 256 24 0
k61_1692 249 30 0
k61_1693 630 49 0
k61_1695 1519 135 0
k61_1696 569 37 0
k61_1697 406 32 0
k61_1698 245 25 0
k61_1699 499 55 0
k61_1700 219 13 0
k61_1702 722 103 0
k61_1703 282 11 0
k61_1704 218 8 0
k61_1705 337 26 0
k61_1706 543 39 0
k61_1709 212 15 0
k61_1710 453 27 0
k61_1712 453 34 0
k61_1713 371 26 0
k61_1714 350 22 0
k61_1715 319 24 0
k61_1716 458 37 0
k61_1717 216 13 0
k61_1718 266 24 0
k61_1719 911 76 0
k61_1720 233 10 0
k61_1721 223 7 0
k61_1722 321 25 0
k61_1723 206 9 0
k61_1724 252 12 0
k61_1725 281 15 0
k61_1726 443 45 0
k61_1727 394 32 0
k61_1729 203 14 0
k61_1730 1552 196 0
k61_1731 494 36 0
k61_1732 473 38 0
k61_1734 207 6 0
k61_1735 203 13 0
k61_1736 485 35 0
k61_1737 885 90 0
k61_1738 1558 192 0
k61_1739 383 23 0
k61_1740 225 6 0
k61_1741 346 27 0
k61_1742 240 21 0
k61_1743 696 59 0
k61_1744 361 30 0
k61_1745 933 71 0
k61_1746 565 41 0
k61_1747 330 16 0
k61_1748 559 52 0
k61_1749 231 13 0
k61_1751 332 22 0
k61_1752 421 29 0
k61_1754 489 34 0
k61_1755 291 10 0
k61_1757 273 19 0
k61_1758 735 61 0
k61_1759 286 26 0
k61_1760 6265 4379 0
k61_1761 315 13 0
k61_1762 231 11 0
k61_1763 457 54 0
k61_1764 600 55 0
k61_1765 266 19 0
k61_1766 265 18 0
k61_1767 319 22 0
k61_1768 524 55 0
k61_1769 242 14 0
k61_1770 226 13 0
k61_1772 260 13 0
k61_1773 694 67 0
k61_1775 251 24 0
k61_1777 664 56 0
k61_1778 1261 129 0
k61_1780 1567 164 0
k61_1781 528 44 0
k61_1782 232 19 0
k61_1783 812 161 0
k61_1784 862 72 0
k61_1786 314 11 0
k61_1787 492 44 0
k61_1788 478 43 0
k61_1789 226 10 0
k61_1790 911 77 0
k61_1791 318 21 0
k61_1792 208 6 0
k61_1793 415 49 0
k61_1794 405 21 0
k61_1795 405 31 0
k61_1796 526 40 0
k61_1797 327 17 0
k61_1798 243 9 0
k61_1799 472 41 0
k61_1800 309 25 0
k61_1801 207 12 0
k61_1802 400 28 0
k61_1803 382 21 0
k61_1804 756 66 0
k61_1805 257 18 0
k61_1807 497 37 0
k61_1808 398 22 0
k61_1809 365 31 0
k61_1810 246 17 0
k61_1811 552 45 0
k61_1812 209 13 0
k61_1814 1644 135 0
k61_1815 395 19 0
k61_1816 692 65 0
k61_1817 1268 107 0
k61_1818 405 22 0
k61_1819 426 57 0
k61_1820 215 6 0
k61_1821 446 39 0
k61_1822 322 28 0
k61_1823 268 18 0
k61_1824 338 27 0
k61_1825 377 42 0
k61_1826 370 24 0
k61_1828 551 45 0
k61_1829 225 8 0
k61_1830 255 14 0
k61_1831 978 93 0
k61_1832 899 62 0
k61_1833 795 56 0
k61_1834 203 17 0
k61_1835 280 22 0
k61_1836 851 93 0
k61_1837 279 9 0
k61_1838 1000 107 0
k61_1839 1019 76 0
k61_1840 238 18 0
k61_1841 217 43 0
k61_1842 683 42 0
k61_1843 232 11 0
k61_1844 206 7 0
k61_1845 1034 1042 0
k61_1846 361 32 0
k61_1847 315 18 0
k61_1848 210 47 0
k61_1849 237 11 0
k61_1850 1485 196 0
k61_1851 587 57 0
k61_1852 577 64 0
k61_1853 538 58 0
k61_1854 492 39 0
k61_1855 208 11 0
k61_1856 413 43 0
k61_1858 855 72 0
k61_1859 311 26 0
k61_1860 279 18 0
k61_1861 405 39 0
k61_1862 484 49 0
k61_1863 1379 119 0
k61_1864 266 10 0
k61_1865 553 37 0
k61_1866 215 14 0
k61_1867 431 16 0
k61_1868 548 53 0
k61_1870 910 73 0
k61_1872 255 13 0
k61_1873 346 23 0
k61_1874 1102 99 0
k61_1875 489 33 0
k61_1877 291 16 0
k61_1878 532 65 0
k61_1882 286 16 0
k61_1883 264 11 0
k61_1884 419 29 0
k61_1885 200 6 0
k61_1886 516 36 0
k61_1887 260 18 0
k61_1888 301 19 0
k61_1889 223 12 0
k61_1890 829 85 0
k61_1891 431 25 0
k61_1892 232 13 0
k61_1893 219 6 0
k61_1894 527 48 0
k61_1895 517 48 0
k61_1896 1069 92 0
k61_1897 235 11 0
k61_1898 241 11 0
k61_1899 1118 131 0
k61_1900 244 21 0
k61_1901 364 14 0
k61_1902 414 35 0
k61_1904 204 16 0
k61_1905 1122 112 0
k61_1906 203 7 0
k61_1907 1416 132 0
k61_1908 294 19 0
k61_1909 479 26 0
k61_1910 364 16 0
k61_1911 300 19 0
k61_1912 504 25 0
k61_1913 543 27 0
k61_1914 418 42 0
k61_1915 327 17 0
k61_1916 803 71 0
k61_1917 246 7 0
k61_1918 322 25 0
k61_1919 224 9 0
k61_1920 273 25 0
k61_1921 539 47 0
k61_1922 213 5 0
k61_1923 499 50 0
k61_1924 251 9 0
k61_1925 249 13 0
k61_1926 234 9 0
k61_1927 641 62 0
k61_1928 355 31 0
k61_1929 250 15 0
k61_1930 357 20 0
k61_1931 210 25 0
k61_1932 226 7 0
k61_1933 356 12 0
k61_1934 233 8 0
k61_1935 398 38 0
k61_1936 1456 151 0
k61_1937 803 55 0
k61_1938 203 8 0
k61_1939 922 194 0
k61_1940 278 20 0
k61_1941 295 17 0
k61_1942 200 13 0
k61_1943 221 15 0
k61_1944 620 63 0
k61_1945 581 46 0
k61_1946 246 10 0
k61_1948 461 44 0
k61_1949 241 18 0
k61_1950 214 10 0
k61_1951 455 38 0
k61_1952 271 12 0
k61_1953 341 21 0
k61_1954 236 7 0
k61_1955 205 11 0
k61_1956 321 15 0
k61_1957 317 22 0
k61_1958 217 14 0
k61_1959 1226 92 0
k61_1960 219 11 0
k61_1961 244 19 0
k61_1962 304 28 0
k61_1963 243 13 0
k61_1964 415 30 0
k61_1965 259 7 0
k61_1966 244 9 0
k61_1968 383 32 0
k61_1969 503 51 0
k61_1970 312 22 0
k61_1971 1054 91 0
k61_1972 375 25 0
k61_1973 578 55 0
k61_1975 1016 100 0
k61_1976 686 47 0
k61_1977 428 25 0
k61_1978 362 16 0
k61_1979 214 18 0
k61_1980 234 7 0
k61_1982 258 22 0
k61_1983 293 9 0
k61_1984 296 19 0
k61_1985 454 33 0
k61_1986 379 21 0
k61_1987 650 69 0
k61_1988 432 39 0
k61_1989 461 52 0
k61_1990 364 34 0
k61_1991 347 21 0
k61_1993 252 9 0
k61_1994 477 35 0
k61_1995 286 11 0
k61_1996 321 23 0
k61_1997 461 30 0
k61_1998 653 53 0
k61_1999 201 7 0
k61_2000 647 47 0
k61_2001 322 32 0
k61_2002 364 33 0
k61_2003 265 15 0
k61_2004 501 36 0
k61_2005 278 19 0
k61_2006 231 9 0
k61_2007 346 37 0
k61_2008 249 20 0
k61_2009 331 19 0
k61_2010 517 46 0
k61_2011 231 12 0
k61_2012 201 7 0
k61_2013 493 33 0
k61_2014 401 33 0
k61_2015 635 42 0
k61_2016 268 10 0
k61_2017 718 73 0
k61_2018 219 22 0
k61_2019 669 61 0
k61_2020 263 28 0
k61_2021 328 18 0
k61_2022 210 19 0
k61_2023 603 67 0
k61_2024 221 13 0
k61_2025 355 24 0
k61_2026 202 10 0
k61_2027 489 28 0
k61_2028 400 23 0
k61_2031 783 60 0
k61_2033 447 38 0
k61_2034 599 50 0
k61_2035 1290 144 0
k61_2036 380 17 0
k61_2037 220 8 0
k61_2038 412 28 0
k61_2039 231 14 0
k61_2042 223 17 0
k61_2043 585 35 0
k61_2044 353 32 0
k61_2045 701 55 0
k61_2047 350 29 0
k61_2048 654 55 0
k61_2049 1186 135 0
k61_2050 292 16 0
k61_2051 389 24 0
k61_2053 477 39 0
k61_2054 207 11 0
k61_2055 590 55 0
k61_2056 1667 168 0
k61_2057 1482 123 0
k61_2058 266 15 0
k61_2059 1007 107 0
k61_2061 892 87 0
k61_2062 281 21 0
k61_2063 375 30 0
k61_2064 390 17 0
k61_2065 212 7 0
k61_2066 262 18 0
k61_2067 421 32 0
k61_2068 219 15 0
k61_2069 228 11 0
k61_2070 311 32 0
k61_2071 317 25 0
k61_2072 237 24 0
k61_2073 414 50 0
k61_2075 237 14 0
k61_2077 209 12 0
k61_2078 458 46 0
k61_2079 1498 136 0
k61_2080 354 34 0
k61_2081 861 61 0
k61_2082 380 19 0
k61_2083 260 7 0
k61_2085 412 38 0
k61_2086 535 36 0
k61_2087 1276 118 0
k61_2088 539 49 0
k61_2090 669 55 0
k61_2091 361 26 0
k61_2092 257 33 0
k61_2093 284 33 0
k61_2094 405 23 0
k61_2096 315 13 0
k61_2097 294 23 0
k61_2098 417 20 0
k61_2099 204 11 0
k61_2100 304 29 0
k61_2101 483 36 0
k61_2102 523 38 0
k61_2103 680 47 0
k61_2104 503 37 0
k61_2105 213 5 0
k61_2106 314 22 0
k61_2107 414 25 0
k61_2108 296 39 0
k61_2109 396 30 0
k61_2110 740 67 0
k61_2111 292 13 0
k61_2112 452 37 0
k61_2113 371 32 0
k61_2114 289 13 0
k61_2115 560 55 0
k61_2117 224 13 0
k61_2118 226 15 0
k61_2119 1458 140 0
k61_2120 364 27 0
k61_2121 205 5 0
k61_2122 234 20 0
k61_2123 265 10 0
k61_2125 1070 75 0
k61_2126 237 10 0
k61_2127 405 35 0
k61_2128 581 53 0
k61_2129 383 30 0
k61_2130 319 26 0
k61_2131 214 8 0
k61_2132 404 21 0
k61_2133 266 24 0
k61_2134 540 50 0
k61_2135 467 42 0
k61_2136 324 19 0
k61_2137 715 55 0
k61_2138 340 27 0
k61_2139 1072 106 0
k61_2140 454 27 0
k61_2141 514 37 0
k61_2142 328 26 0
k61_2143 216 11 0
k61_2144 330 18 0
k61_2146 611 56 0
k61_2147 215 15 0
k61_2148 251 16 0
k61_2149 381 20 0
k61_2150 233 7 0
k61_2151 201 8 0
k61_2152 217 7 0
k61_2153 796 290 0
k61_2154 824 74 0
k61_2156 506 39 0
k61_2157 487 36 0
k61_2158 817 86 0
k61_2159 296 20 0
k61_2160 410 33 0
k61_2161 226 21 0
k61_2162 768 69 0
k61_2163 202 22 0
k61_2166 769 67 0
k61_2167 364 22 0
k61_2168 215 10 0
k61_2169 331 14 0
k61_2171 915 82 0
k61_2172 211 15 0
k61_2173 1597 148 0
k61_2174 760 52 0
k61_2176 218 20 0
k61_2177 303 34 0
k61_2179 314 11 0
k61_2180 421 40 0
k61_2181 511 23 0
k61_2182 508 36 0
k61_2183 259 12 0
k61_2184 1060 105 0
k61_2185 321 18 0
k61_2186 277 14 0
k61_2187 321 14 0
k61_2188 556 45 0
k61_2189 313 11 0
k61_2190 1376 137 0
k61_2191 655 69 0
k61_2192 275 26 0
k61_2193 268 17 0
k61_2194 211 8 0
k61_2195 202 5 0
k61_2196 573 46 0
k61_2197 342 16 0
k61_2198 336 26 0
k61_2199 634 48 0
k61_2200 431 28 0
k61_2201 296 14 0
k61_2202 287 19 0
k61_2204 203 7 0
k61_2205 280 17 0
k61_2206 894 104 0
k61_2207 556 66 0
k61_2208 655 58 0
k61_2209 309 26 0
k61_2211 259 21 0
k61_2212 509 58 0
k61_2213 323 30 0
k61_2214 327 25 0
k61_2215 1137 119 0
k61_2216 840 67 0
k61_2217 257 19 0
k61_2218 241 15 0
k61_2219 275 13 0
k61_2220 284 34 0
k61_2221 811 79 0
k61_2222 380 47 0
k61_2223 666 71 0
k61_2224 248 9 0
k61_2225 205 6 0
k61_2226 264 22 0
k61_2227 321 30 0
k61_2228 234 6 0
k61_2229 227 113 0
k61_2230 202 9 0
k61_2231 215 18 0
k61_2232 263 15 0
k61_2233 889 82 0
k61_2234 296 16 0
k61_2235 625 59 0
k61_2237 219 9 0
k61_2238 356 22 0
k61_2239 437 46 0
k61_2240 276 14 0
k61_2241 428 38 0
k61_2242 285 18 0
k61_2243 523 36 0
k61_2245 210 9 0
k61_2246 584 25 0
k61_2247 314 14 0
k61_2248 397 39 0
k61_2249 229 14 0
k61_2250 508 46 0
k61_2252 378 46 0
k61_2254 772 68 0
k61_2255 272 14 0
k61_2258 229 15 0
k61_2259 279 26 0
k61_2260 1165 96 0
k61_2261 328 27 0
k61_2262 342 14 0
k61_2263 377 32 0
k61_2265 279 13 0
k61_2267 265 19 0
k61_2268 649 56 0
k61_2269 644 57 0
k61_2270 328 17 0
k61_2272 416 30 0
k61_2274 227 25 0
k61_2275 256 5 0
k61_2276 236 11 0
k61_2277 574 49 0
k61_2278 898 65 0
k61_2279 1403 148 0
k61_2280 625 55 0
k61_2281 228 10 0
k61_2282 245 12 0
k61_2283 458 43 0
k61_2284 263 16 0
k61_2285 256 15 0
k61_2287 466 43 0
k61_2288 862 81 0
k61_2289 208 13 0
k61_2290 449 47 0
k61_2292 600 49 0
k61_2293 584 63 0
k61_2294 233 20 0
k61_2295 835 69 0
k61_2296 567 44 0
k61_2297 576 24 0
k61_2298 549 27 0
k61_2299 562 46 0
k61_2300 815 68 0
k61_2301 375 14 0
k61_2302 215 25 0
k61_2303 213 7 0
k61_2304 214 7 0
k61_2305 328 27 0
k61_2307 1741 150 0
k61_2308 341 31 0
k61_2309 523 56 0
k61_2310 355 34 0
k61_2311 211 16 0
k61_2312 240 21 0
k61_2313 264 12 0
k61_2314 294 20 0
k61_2315 866 72 0
k61_2316 4214 735 0
k61_2317 283 19 0
k61_2318 456 48 0
k61_2319 1013 86 0
k61_2320 234 12 0
k61_2321 366 32 0
k61_2324 392 26 0
k61_2325 334 23 0
k61_2326 611 59 0
k61_2327 456 43 0
k61_2328 424 23 0
k61_2329 635 52 0
k61_2330 411 36 0
k61_2331 437 29 0
k61_2332 765 71 0
k61_2334 279 17 0
k61_2336 426 39 0
k61_2337 379 26 0
k61_2338 357 23 0
k61_2339 382 22 0
k61_2340 243 16 0
k61_2341 424 41 0
k61_2342 670 54 0
k61_2343 532 67 0
k61_2344 348 36 0
k61_2347 212 13 0
k61_2348 598 46 0
k61_2349 768 66 0
k61_2351 463 48 0
k61_2352 930 110 0
k61_2353 789 48 0
k61_2354 233 12 0
k61_2355 537 52 0
k61_2356 207 18 0
k61_2357 628 63 0
k61_2358 210 19 0
k61_2359 209 9 0
k61_2360 234 23 0
k61_2361 250 14 0
k61_2362 615 65 0
k61_2363 258 23 0
k61_2365 310 23 0
k61_2366 211 7 0
k61_2367 274 21 0
k61_2368 376 30 0
k61_2369 344 18 0
k61_2370 298 17 0
k61_2371 341 36 0
k61_2372 451 48 0
k61_2373 274 32 0
k61_2374 300 20 0
k61_2377 209 12 0
k61_2378 323 16 0
k61_2379 200 7 0
k61_2380 243 13 0
k61_2381 252 14 0
k61_2383 572 42 0
k61_2384 338 23 0
k61_2385 315 40 0
k61_2386 326 19 0
k61_2387 802 71 0
k61_2388 285 14 0
k61_2389 699 43 0
k61_2390 371 38 0
k61_2391 277 20 0
k61_2392 368 22 0
k61_2394 217 11 0
k61_2395 928 68 0
k61_2397 206 18 0
k61_2398 242 18 0
k61_2399 554 41 0
k61_2400 569 53 0
k61_2401 263 11 0
k61_2402 379 18 0
k61_2403 264 28 0
k61_2404 215 10 0
k61_2405 1032 92 0
k61_2406 362 22 0
k61_2407 240 9 0
k61_2408 374 26 0
k61_2409 248 13 0
k61_2410 1279 122 0
k61_2411 250 11 0
k61_2412 368 312 0
k61_2413 730 71 0
k61_2414 230 10 0
k61_2415 1065 103 0
k61_2416 223 16 0
k61_2417 420 29 0
k61_2418 431 28 0
k61_2419 205 7 0
k61_2420 253 27 0
k61_2421 829 66 0
k61_2422 283 24 0
k61_2424 297 16 0
k61_2425 311 28 0
k61_2427 458 33 0
k61_2428 652 41 0
k61_2429 623 37 0
k61_2430 270 21 0
k61_2431 480 34 0
k61_2433 218 13 0
k61_2434 721 56 0
k61_2435 698 54 0
k61_2436 270 19 0
k61_2437 476 25 0
k61_2438 340 24 0
k61_2439 281 10 0
k61_2440 326 15 0
k61_2441 297 9 0
k61_2442 301 16 0
k61_2443 338 29 0
k61_2444 351 23 0
k61_2445 284 34 0
k61_2447 1642 973 0
k61_2448 466 44 0
k61_2449 216 7 0
k61_2450 282 20 0
k61_2451 202 15 0
k61_2453 311 30 0
k61_2454 313 13 0
k61_2455 370 19 0
k61_2456 271 17 0
k61_2457 399 26 0
k61_2458 246 12 0
k61_2459 689 58 0
k61_2460 543 59 0
k61_2461 475 20 0
k61_2462 632 44 0
k61_2463 562 36 0
k61_2464 762 59 0
k61_2465 429 37 0
k61_2467 958 96 0
k61_2468 427 37 0
k61_2470 289 20 0
k61_2471 362 39 0
k61_2472 306 13 0
k61_2473 216 22 0
k61_2474 587 51 0
k61_2475 828 74 0
k61_2476 618 74 0
k61_2477 497 37 0
k61_2478 279 8 0
k61_2479 871 84 0
k61_2480 256 11 0
k61_2481 691 58 0
k61_2482 355 20 0
k61_2483 232 7 0
k61_2484 1457 144 0
k61_2485 487 49 0
k61_2486 236 11 0
k61_2487 293 21 0
k61_2488 286 18 0
k61_2489 1762 243 0
k61_2490 277 16 0
k61_2491 317 31 0
k61_2492 209 11 0
k61_2493 368 36 0
k61_2494 373 31 0
k61_2495 243 11 0
k61_2497 205 7 0
k61_2498 385 30 0
k61_2499 650 32 0
k61_2500 214 10 0
k61_2501 346 19 0
k61_2502 443 26 0
k61_2503 530 35 0
k61_2504 414 33 0
k61_2505 1342 135 0
k61_2507 773 57 0
k61_2508 237 17 0
k61_2509 382 33 0
k61_2510 546 54 0
k61_2511 221 16 0
k61_2512 900 82 0
k61_2513 210 15 0
k61_2514 395 24 0
k61_2515 342 25 0
k61_2516 324 11 0
k61_2517 292 7 0
k61_2518 325 29 0
k61_2519 208 10 0
k61_2520 300 14 0
k61_2521 281 28 0
k61_2522 391 23 0
k61_2523 329 23 0
k61_2524 226 13 0
k61_2525 204 24 0
k61_2527 314 17 0
k61_2528 240 9 0
k61_2529 354 19 0
k61_2531 366 19 0
k61_2532 486 29 0
k61_2533 313 21 0
k61_2534 213 10 0
k61_2536 210 10 0
k61_2537 295 22 0
k61_2539 317 16 0
k61_2541 1282 119 0
k61_2542 281 17 0
k61_2543 3183 334 0
k61_2544 417 29 0
k61_2545 301 12 0
k61_2547 397 22 0
k61_2548 352 26 0
k61_2549 1353 154 0
k61_2551 211 14 0
k61_2552 694 57 0
k61_2553 280 16 0
k61_2555 345 21 0
k61_2556 366 22 0
k61_2557 215 12 0
k61_2558 710 80 0
k61_2559 285 15 0
k61_2560 209 18 0
k61_2561 285 21 0
k61_2562 564 45 0
k61_2563 1079 103 0
k61_2564 936 105 0
k61_2565 207 20 0
k61_2566 384 24 0
k61_2567 629 54 0
k61_2568 1045 134 0
k61_2569 543 54 0
k61_2570 1632 130 0
k61_2571 275 17 0
k61_2572 322 26 0
k61_2573 498 44 0
k61_2574 200 14 0
k61_2575 287 22 0
k61_2576 343 24 0
k61_2577 903 94 0
k61_2579 1136 127 0
k61_2580 1305 91 0
k61_2581 340 15 0
k61_2582 990 77 0
k61_2583 308 24 0
k61_2584 269 19 0
k61_2585 458 47 0
k61_2586 363 37 0
k61_2587 773 74 0
k61_2588 1006 72 0
k61_2589 436 38 0
k61_2590 205 12 0
k61_2591 914 88 0
k61_2592 437 31 0
k61_2594 596 43 0
k61_2595 322 26 0
k61_2596 280 17 0
k61_2597 488 29 0
k61_2599 848 51 0
k61_2600 314 27 0
k61_2601 218 14 0
k61_2602 2028 197 0
k61_2603 698 60 0
k61_2604 646 67 0
k61_2605 562 61 0
k61_2606 555 50 0
k61_2607 501 16 0
k61_2608 282 30 0
k61_2609 486 34 0
k61_2610 241 9 0
k61_2611 268 17 0
k61_2612 800 59 0
k61_2613 378 27 0
k61_2614 566 48 0
k61_2615 1463 138 0
k61_2616 593 56 0
k61_2617 324 23 0
k61_2618 420 34 0
k61_2619 924 85 0
k61_2620 338 22 0
k61_2621 540 37 0
k61_2622 277 15 0
k61_2623 445 37 0
k61_2624 360 11 0
k61_2625 404 41 0
k61_2626 678 55 0
k61_2627 205 4 0
k61_2628 503 46 0
k61_2629 222 17 0
k61_2630 220 17 0
k61_2631 656 75 0
k61_2632 769 72 0
k61_2633 218 23 0
k61_2634 436 24 0
k61_2635 483 40 0
k61_2636 243 14 0
k61_2637 217 9 0
k61_2638 513 56 0
k61_2639 233 15 0
k61_2641 221 13 0
k61_2643 240 11 0
k61_2645 355 40 0
k61_2646 950 105 0
k61_2647 874 73 0
k61_2648 242 15 0
k61_2649 610 60 0
k61_2652 1073 69 0
k61_2653 211 15 0
k61_2654 321 24 0
k61_2655 284 14 0
k61_2656 270 24 0
k61_2657 271 13 0
k61_2658 301 21 0
k61_2659 582 55 0
k61_2660 454 49 0
k61_2661 516 47 0
k61_2662 434 35 0
k61_2663 349 18 0
k61_2664 363 20 0
k61_2665 360 13 0
k61_2666 335 21 0
k61_2667 373 25 0
k61_2668 256 13 0
k61_2669 232 8 0
k61_2670 235 10 0
k61_2671 439 25 0
k61_2672 439 49 0
k61_2673 392 30 0
k61_2674 349 34 0
k61_2675 1007 109 0
k61_2676 228 14 0
k61_2677 292 19 0
k61_2678 217 10 0
k61_2679 388 28 0
k61_2680 783 69 0
k61_2681 237 12 0
k61_2682 371 32 0
k61_2683 1217 116 0
k61_2684 245 22 0
k61_2685 434 31 0
k61_2686 873 83 0
k61_2687 308 20 0
k61_2688 329 21 0
k61_2689 266 13 0
k61_2690 344 29 0
k61_2691 317 22 0
k61_2692 715 57 0
k61_2693 206 9 0
k61_2694 211 6 0
k61_2695 404 31 0
k61_2696 363 33 0
k61_2697 278 19 0
k61_2698 265 7 0
k61_2699 614 54 0
k61_2700 217 12 0
k61_2701 1322 120 0
k61_2702 207 9 0
k61_2703 762 66 0
k61_2705 355 18 0
k61_2706 330 15 0
k61_2707 260 14 0
k61_2708 350 18 0
k61_2709 473 36 0
k61_2711 310 26 0
k61_2712 200 12 0
k61_2713 779 70 0
k61_2714 375 24 0
k61_2715 222 10 0
k61_2716 301 18 0
k61_2717 507 54 0
k61_2718 541 50 0
k61_2719 213 16 0
k61_2720 250 19 0
k61_2721 536 44 0
k61_2722 288 13 0
k61_2723 276 20 0
k61_2724 545 36 0
k61_2725 238 6 0
k61_2726 445 51 0
k61_2727 734 64 0
k61_2728 205 7 0
k61_2729 412 19 0
k61_2730 243 12 0
k61_2731 1410 149 0
k61_2732 356 22 0
k61_2733 342 24 0
k61_2734 214 12 0
k61_2735 649 65 0
k61_2736 868 101 0
k61_2737 357 27 0
k61_2738 255 16 0
k61_2739 398 30 0
k61_2740 536 49 0
k61_2741 246 11 0
k61_2742 566 35 0
k61_2743 265 17 0
k61_2744 405 25 0
k61_2745 988 92 0
k61_2746 400 35 0
k61_2747 400 42 0
k61_2748 537 25 0
k61_2749 381 28 0
k61_2750 239 14 0
k61_2751 260 16 0
k61_2752 225 19 0
k61_2753 290 39 0
k61_2755 513 53 0
k61_2756 211 10 0
k61_2757 503 43 0
k61_2758 260 12 0
k61_2759 632 46 0
k61_2760 688 56 0
k61_2761 282 26 0
k61_2762 246 7 0
k61_2764 294 16 0
k61_2766 349 24 0
k61_2767 297 21 0
k61_2768 402 39 0
k61_2769 717 71 0
k61_2770 272 21 0
k61_2771 242 12 0
k61_2772 459 35 0
k61_2773 245 12 0
k61_2774 664 31 0
k61_2775 651 43 0
k61_2776 203 17 0
k61_2778 396 50 0
k61_2779 208 9 0
k61_2780 608 71 0
k61_2781 255 20 0
k61_2782 300 20 0
k61_2783 536 43 0
k61_2784 775 74 0
k61_2785 209 22 0
k61_2786 221 12 0
k61_2787 579 59 0
k61_2788 390 23 0
k61_2789 258 11 0
k61_2790 260 16 0
k61_2791 329 32 0
k61_2792 308 17 0
k61_2793 246 13 0
k61_2795 292 21 0
k61_2798 422 29 0
k61_2799 293 25 0
k61_2800 220 9 0
k61_2801 290 18 0
k61_2802 439 37 0
k61_2803 1074 117 0
k61_2804 423 32 0
k61_2806 275 20 0
k61_2807 493 51 0
k61_2808 212 11 0
k61_2809 202 12 0
k61_2810 677 79 0
k61_2811 246 11 0
k61_2812 206 7 0
k61_2813 678 43 0
k61_2814 245 13 0
k61_2815 393 33 0
k61_2816 219 8 0
k61_2817 246 14 0
k61_2818 446 25 0
k61_2819 215 14 0
k61_2820 373 25 0
k61_2821 363 14 0
k61_2822 201 17 0
k61_2825 371 25 0
k61_2827 793 79 0
k61_2828 364 26 0
k61_2829 457 24 0
k61_2830 401 28 0
k61_2831 396 31 0
k61_2832 324 38 0
k61_2833 853 77 0
k61_2834 215 17 0
k61_2835 243 15 0
k61_2836 301 22 0
k61_2837 356 30 0
k61_2838 216 11 0
k61_2839 344 33 0
k61_2840 486 48 0
k61_2841 537 43 0
k61_2842 278 11 0
k61_2843 456 35 0
k61_2844 346 26 0
k61_2846 590 49 0
k61_2847 245 8 0
k61_2848 246 12 0
k61_2849 305 25 0
k61_2852 337 17 0
k61_2853 227 16 0
k61_2855 202 12 0
k61_2856 284 17 0
k61_2857 645 62 0
k61_2858 317 25 0
k61_2859 283 14 0
k61_2860 243 11 0
k61_2861 1704 147 0
k61_2863 221 14 0
k61_2864 436 24 0
k61_2865 238 10 0
k61_2866 229 12 0
k61_2867 344 37 0
k61_2868 204 8 0
k61_2869 215 6 0
k61_2870 399 35 0
k61_2871 426 32 0
k61_2872 403 33 0
k61_2873 203 10 0
k61_2874 622 51 0
k61_2875 304 20 0
k61_2876 437 44 0
k61_2877 372 47 0
k61_2878 709 77 0
k61_2879 374 23 0
k61_2880 330 26 0
k61_2881 317 22 0
k61_2882 465 29 0
k61_2883 299 39 0
k61_2884 240 10 0
k61_2885 237 17 0
k61_2886 877 72 0
k61_2887 523 61 0
k61_2888 452 24 0
k61_2890 870 64 0
k61_2891 237 15 0
k61_2892 235 9 0
k61_2893 408 35 0
k61_2895 389 17 0
k61_2896 284 8 0
k61_2897 201 8 0
k61_2898 337 22 0
k61_2899 285 20 0
k61_2900 220 18 0
k61_2901 965 73 0
k61_2902 769 66 0
k61_2903 666 71 0
k61_2904 439 26 0
k61_2905 598 38 0
k61_2906 287 14 0
k61_2907 232 19 0
k61_2908 380 19 0
k61_2909 262 12 0
k61_2910 244 19 0
k61_2911 444 34 0
k61_2912 343 28 0
k61_2913 206 13 0
k61_2914 296 26 0
k61_2915 415 29 0
k61_2916 215 15 0
k61_2917 221 15 0
k61_2918 203 20 0
k61_2919 268 9 0
k61_2920 258 9 0
k61_2921 325 20 0
k61_2922 481 22 0
k61_2923 291 31 0
k61_2924 401 27 0
k61_2925 1028 93 0
k61_2926 272 16 0
k61_2927 640 69 0
k61_2929 384 32 0
k61_2930 246 15 0
k61_2931 835 91 0
k61_2932 1013 91 0
k61_2933 431 32 0
k61_2934 1160 99 0
k61_2935 251 12 0
k61_2936 240 28 0
k61_2937 242 9 0
k61_2938 338 29 0
k61_2939 324 22 0
k61_2940 422 34 0
k61_2941 269 24 0
k61_2942 430 30 0
k61_2943 541 32 0
k61_2944 475 47 0
k61_2945 271 10 0
k61_2946 207 8 0
k61_2947 318 27 0
k61_2948 240 16 0
k61_2949 283 10 0
k61_2950 239 22 0
k61_2951 280 8 0
k61_2952 425 33 0
k61_2953 436 41 0
k61_2954 964 82 0
k61_2955 587 52 0
k61_2956 204 8 0
k61_2957 296 17 0
k61_2958 458 43 0
k61_2959 892 81 0
k61_2960 204 13 0
k61_2963 387 29 0
k61_2964 205 5 0
k61_2965 574 38 0
k61_2966 320 19 0
k61_2967 1175 145 0
k61_2968 352 23 0
k61_2969 573 44 0
k61_2970 690 64 0
k61_2971 229 8 0
k61_2972 431 41 0
k61_2973 640 104 0
k61_2974 210 10 0
k61_2975 397 31 0
k61_2976 267 16 0
k61_2977 268 14 0
k61_2978 217 15 0
k61_2979 220 13 0
k61_2980 576 36 0
k61_2981 347 22 0
k61_2982 295 21 0
k61_2983 262 16 0
k61_2984 200 6 0
k61_2985 578 41 0
k61_2986 232 12 0
k61_2987 274 19 0
k61_2988 217 8 0
k61_2989 270 6 0
k61_2990 1036 102 0
k61_2991 230 17 0
k61_2993 784 56 0
k61_2994 377 40 0
k61_2995 898 73 0
k61_2996 329 24 0
k61_2997 211 16 0
k61_2998 1116 93 0
k61_2999 416 42 0
k61_3000 211 14 0
k61_3001 331 18 0
k61_3002 3153 350 0
k61_3003 322 15 0
k61_3004 453 29 0
k61_3005 278 12 0
k61_3006 313 14 0
k61_3007 263 19 0
k61_3008 315 17 0
k61_3009 219 20 0
k61_3010 1049 141 0
k61_3011 456 20 0
k61_3013 234 20 0
k61_3014 242 8 0
k61_3015 250 24 0
k61_3016 235 10 0
k61_3017 559 31 0
k61_3018 387 27 0
k61_3019 884 89 0
k61_3020 307 13 0
k61_3021 620 39 0
k61_3022 464 22 0
k61_3023 728 73 0
k61_3024 1147 95 0
k61_3026 229 8 0
k61_3027 1008 89 0
k61_3028 271 13 0
k61_3029 429 21 0
k61_3030 304 20 0
k61_3031 1417 118 0
k61_3032 475 17 0
k61_3033 367 33 0
k61_3034 1891 204 0
k61_3035 226 14 0
k61_3036 222 8 0
k61_3037 254 9 0
k61_3038 598 31 0
k61_3040 210 12 0
k61_3041 672 52 0
k61_3042 201 9 0
k61_3043 407 26 0
k61_3044 747 70 0
k61_3045 865 78 0
k61_3046 271 17 0
k61_3047 304 23 0
k61_3048 516 50 0
k61_3049 240 13 0
k61_3050 794 62 0
k61_3051 503 36 0
k61_3052 1029 94 0
k61_3053 261 28 0
k61_3054 215 9 0
k61_3055 200 8 0
k61_3056 537 48 0
k61_3057 977 124 0
k61_3059 202 10 0
k61_3060 215 14 0
k61_3061 1323 101 0
k61_3062 577 43 0
k61_3063 281 31 0
k61_3064 462 39 0
k61_3065 240 6 0
k61_3067 295 23 0
k61_3068 367 29 0
k61_3069 209 17 0
k61_3070 310 25 0
k61_3071 502 44 0
k61_3072 489 43 0
k61_3073 262 10 0
k61_3074 1241 111 0
k61_3075 394 33 0
k61_3076 225 12 0
k61_3077 283 21 0
k61_3078 365 39 0
k61_3079 288 10 0
k61_3080 203 6 0
k61_3082 869 88 0
k61_3083 241 11 0
k61_3084 592 43 0
k61_3085 319 17 0
k61_3086 459 59 0
k61_3087 555 41 0
k61_3088 254 22 0
k61_3089 1015 90 0
k61_3090 248 26 0
k61_3091 316 29 0
k61_3092 333 16 0
k61_3093 226 20 0
k61_3095 827 67 0
k61_3096 469 27 0
k61_3097 240 18 0
k61_3099 396 40 0
k61_3100 519 51 0
k61_3101 327 20 0
k61_3102 237 12 0
k61_3103 3632 3961 0
k61_3104 251 18 0
k61_3105 507 54 0
k61_3107 276 15 0
k61_3108 239 11 0
k61_3109 202 7 0
k61_3110 253 29 0
k61_3112 260 30 0
k61_3113 224 8 0
k61_3114 476 37 0
k61_3116 213 14 0
k61_3117 386 32 0
k61_3118 421 26 0
k61_3119 271 7 0
k61_3120 247 9 0
k61_3121 638 50 0
k61_3122 318 25 0
k61_3123 222 12 0
k61_3124 303 21 0
k61_3125 664 75 0
k61_3126 287 17 0
k61_3127 234 17 0
k61_3128 286 28 0
k61_3129 288 24 0
k61_3130 354 34 0
k61_3131 339 20 0
k61_3132 884 70 0
k61_3133 491 35 0
k61_3134 700 62 0
k61_3135 288 23 0
k61_3137 348 22 0
k61_3138 350 26 0
k61_3139 200 14 0
k61_3140 233 8 0
k61_3141 563 41 0
k61_3142 1070 90 0
k61_3143 284 13 0
k61_3144 1055 99 0
k61_3145 351 22 0
k61_3146 316 31 0
k61_3147 633 51 0
k61_3148 622 36 0
k61_3149 287 15 0
k61_3150 465 34 0
k61_3153 1056 93 0
k61_3154 275 11 0
k61_3155 350 25 0
k61_3156 206 11 0
k61_3158 406 21 0
k61_3159 201 18 0
k61_3160 366 25 0
k61_3161 292 19 0
k61_3162 655 55 0
k61_3163 345 24 0
k61_3164 368 24 0
k61_3165 207 10 0
k61_3166 350 31 0
k61_3167 213 14 0
k61_3169 685 77 0
k61_3170 281 14 0
k61_3171 374 29 0
k61_3172 781 60 0
k61_3173 228 9 0
k61_3174 775 78 0
k61_3175 227 15 0
k61_3176 620 74 0
k61_3177 337 32 0
k61_3178 432 29 0
k61_3179 626 57 0
k61_3180 334 23 0
k61_3181 374 22 0
k61_3182 364 10 0
k61_3183 275 17 0
k61_3184 767 58 0
k61_3185 243 14 0
k61_3186 353 32 0
k61_3187 472 19 0
k61_3188 248 14 0
k61_3189 306 16 0
k61_3190 765 68 0
k61_3191 586 53 0
k61_3192 625 49 0
k61_3193 461 37 0
k61_3195 843 68 0
k61_3196 706 71 0
k61_3197 1189 148 0
k61_3198 238 23 0
k61_3199 228 11 0
k61_3200 757 70 0
k61_3201 2589 263 0
k61_3202 646 47 0
k61_3203 603 33 0
k61_3204 268 15 0
k61_3205 372 18 0
k61_3206 261 12 0
k61_3207 1106 86 0
k61_3208 1125 89 0
k61_3209 233 16 0
k61_3210 212 14 0
k61_3211 350 10 0
k61_3212 396 24 0
k61_3213 646 58 0
k61_3214 406 35 0
k61_3215 245 13 0
k61_3216 503 38 0
k61_3217 314 22 0
k61_3218 226 19 0
k61_3220 401 24 0
k61_3221 404 35 0
k61_3222 244 12 0
k61_3223 268 30 0
k61_3224 377 22 0
k61_3225 315 11 0
k61_3226 555 80 0
k61_3227 792 100 0
k61_3228 482 38 0
k61_3230 233 14 0
k61_3231 200 5 0
k61_3232 229 15 0
k61_3233 361 25 0
k61_3234 216 12 0
k61_3235 222 21 0
k61_3236 344 29 0
k61_3237 639 51 0
k61_3238 780 67 0
k61_3239 277 20 0
k61_3240 307 16 0
k61_3241 795 193 0
k61_3242 295 16 0
k61_3243 241 14 0
k61_3244 525 40 0
k61_3245 233 10 0
k61_3246 571 47 0
k61_3247 236 8 0
k61_3248 237 23 0
k61_3249 229 16 0
k61_3250 257 13 0
k61_3251 1035 85 0
k61_3253 245 20 0
k61_3254 215 11 0
k61_3255 230 15 0
k61_3256 209 6 0
k61_3257 267 21 0
k61_3258 318 22 0
k61_3259 998 85 0
k61_3260 205 28 0
k61_3261 231 12 0
k61_3262 1253 104 0
k61_3263 725 81 0
k61_3264 832 68 0
k61_3265 224 15 0
k61_3266 296 13 0
k61_3267 737 69 0
k61_3268 828 70 0
k61_3269 209 17 0
k61_3270 709 83 0
k61_3271 209 14 0
k61_3272 271 22 0
k61_3273 213 11 0
k61_3274 204 10 0
k61_3275 417 19 0
k61_3276 234 14 0
k61_3277 358 22 0
k61_3278 474 42 0
k61_3280 668 76 0
k61_3281 201 8 0
k61_3282 358 25 0
k61_3283 687 62 0
k61_3284 914 126 0
k61_3285 203 13 0
k61_3286 248 12 0
k61_3289 319 13 0
k61_3290 270 12 0
k61_3291 245 43 0
k61_3292 684 80 0
k61_3294 235 6 0
k61_3295 514 40 0
k61_3296 285 22 0
k61_3297 404 33 0
k61_3298 587 63 0
k61_3299 748 95 0
k61_3300 743 70 0
k61_3301 339 25 0
k61_3302 562 39 0
k61_3303 1487 205 0
k61_3304 1312 107 0
k61_3305 442 35 0
k61_3306 642 53 0
k61_3307 284 21 0
k61_3308 295 24 0
k61_3309 1263 116 0
k61_3310 224 13 0
k61_3311 1260 126 0
k61_3312 233 9 0
k61_3313 1120 80 0
k61_3314 234 10 0
k61_3317 608 40 0
k61_3318 521 45 0
k61_3319 328 27 0
k61_3320 385 45 0
k61_3321 323 19 0
k61_3322 217 25 0
k61_3323 237 17 0
k61_3324 648 45 0
k61_3325 1258 115 0
k61_3326 206 10 0
k61_3327 632 56 0
k61_3328 974 81 0
k61_3329 327 24 0
k61_3330 490 59 0
k61_3331 316 24 0
k61_3332 359 28 0
k61_3333 284 16 0
k61_3334 399 34 0
k61_3335 1043 72 0
k61_3336 1161 99 0
k61_3338 1046 70 0
k61_3339 232 28 0
k61_3340 374 45 0
k61_3341 309 20 0
k61_3342 338 21 0
k61_3343 212 7 0
k61_3344 259 17 0
k61_3345 202 5 0
k61_3346 569 52 0
k61_3347 357 32 0
k61_3348 288 12 0
k61_3349 673 46 0
k61_3350 682 52 0
k61_3352 641 92 0
k61_3353 239 12 0
k61_3354 389 34 0
k61_3355 314 30 0
k61_3356 785 80 0
k61_3357 346 11 0
k61_3358 664 65 0
k61_3360 391 23 0
k61_3363 469 41 0
k61_3364 254 12 0
k61_3365 1209 140 0
k61_3366 404 23 0
k61_3367 775 61 0
k61_3368 201 7 0
k61_3369 328 23 0
k61_3370 445 28 0
k61_3371 560 45 0
k61_3372 241 12 0
k61_3373 659 56 0
k61_3374 455 42 0
k61_3375 344 22 0
k61_3376 617 62 0
k61_3377 671 63 0
k61_3378 252 24 0
k61_3379 736 91 0
k61_3380 316 22 0
k61_3381 210 19 0
k61_3382 222 6 0
k61_3383 799 77 0
k61_3384 261 17 0
k61_3385 420 42 0
k61_3386 215 6 0
k61_3387 667 58 0
k61_3388 335 19 0
k61_3389 252 16 0
k61_3390 237 9 0
k61_3391 1416 133 0
k61_3392 248 6 0
k61_3393 225 9 0
k61_3394 295 29 0
k61_3395 243 26 0
k61_3396 469 27 0
k61_3397 204 7 0
k61_3398 261 10 0
k61_3399 281 17 0
k61_3400 419 34 0
k61_3401 260 15 0
k61_3403 346 23 0
k61_3405 639 55 0
k61_3406 330 21 0
k61_3408 443 31 0
k61_3409 967 90 0
k61_3410 284 12 0
k61_3411 507 47 0
k61_3412 223 14 0
k61_3415 244 12 0
k61_3416 239 11 0
k61_3418 336 13 0
k61_3419 343 32 0
k61_3420 276 18 0
k61_3421 286 10 0
k61_3422 238 13 0
k61_3423 252 23 0
k61_3424 468 31 0
k61_3425 252 14 0
k61_3426 1080 95 0
k61_3427 766 94 0
k61_3428 212 19 0
k61_3429 649 58 0
k61_3430 873 87 0
k61_3431 213 9 0
k61_3432 327 22 0
k61_3433 682 67 0
k61_3434 312 13 0
k61_3435 230 25 0
k61_3436 1523 193 0
k61_3437 304 21 0
k61_3438 246 11 0
k61_3439 416 29 0
k61_3440 349 24 0
k61_3442 311 19 0
k61_3443 246 8 0
k61_3444 989 67 0
k61_3445 231 17 0
k61_3448 263 26 0
k61_3449 1070 125 0
k61_3450 213 12 0
k61_3451 592 42 0
k61_3452 421 33 0
k61_3453 385 34 0
k61_3454 364 30 0
k61_3456 203 8 0
k61_3457 393 39 0
k61_3458 223 10 0
k61_3460 488 23 0
k61_3461 494 44 0
k61_3462 528 50 0
k61_3463 1030 82 0
k61_3464 348 26 0
k61_3465 312 28 0
k61_3466 248 11 0
k61_3467 219 8 0
k61_3468 619 40 0
k61_3469 506 24 0
k61_3470 221 11 0
k61_3471 552 50 0
k61_3472 251 13 0
k61_3474 298 29 0
k61_3476 241 8 0
k61_3477 254 24 0
k61_3478 375 33 0
k61_3479 299 25 0
k61_3480 287 15 0
k61_3481 235 16 0
k61_3482 364 16 0
k61_3483 268 24 0
k61_3485 227 12 0
k61_3486 201 5 0
k61_3487 752 78 0
k61_3488 862 80 0
k61_3489 249 12 0
k61_3490 335 15 0
k61_3491 243 16 0
k61_3492 224 19 0
k61_3493 246 26 0
k61_3494 1472 141 0
k61_3495 263 17 0
k61_3496 220 15 0
k61_3497 335 24 0
k61_3498 271 19 0
k61_3499 1031 88 0
k61_3500 819 56 0
k61_3501 241 19 0
k61_3502 245 14 0
k61_3504 722 54 0
k61_3505 631 40 0
k61_3507 805 64 0
k61_3508 211 15 0
k61_3509 258 20 0
k61_3510 213 14 0
k61_3511 262 17 0
k61_3512 390 15 0
k61_3513 469 35 0
k61_3514 718 59 0
k61_3515 578 51 0
k61_3516 272 18 0
k61_3517 337 22 0
k61_3518 349 26 0
k61_3519 217 4 0
k61_3520 453 39 0
k61_3521 298 25 0
k61_3522 863 92 0
k61_3523 222 11 0
k61_3525 933 89 0
k61_3526 436 42 0
k61_3527 224 10 0
k61_3528 273 19 0
k61_3530 312 15 0
k61_3531 247 10 0
k61_3532 213 10 0
k61_3533 253 15 0
k61_3534 216 10 0
k61_3535 271 20 0
k61_3536 1127 108 0
k61_3537 333 23 0
k61_3538 333 25 0
k61_3539 208 24 0
k61_3541 596 42 0
k61_3543 870 69 0
k61_3544 212 12 0
k61_3545 341 26 0
k61_3546 342 24 0
k61_3547 282 19 0
k61_3548 367 27 0
k61_3549 224 11 0
k61_3550 974 74 0
k61_3551 248 17 0
k61_3552 458 41 0
k61_3553 229 14 0
k61_3554 396 16 0
k61_3555 326 27 0
k61_3556 638 41 0
k61_3557 403 26 0
k61_3558 580 52 0
k61_3559 234 22 0
k61_3560 601 56 0
k61_3561 872 66 0
k61_3562 438 20 0
k61_3563 913 72 0
k61_3565 217 11 0
k61_3566 694 66 0
k61_3567 516 39 0
k61_3568 446 29 0
k61_3569 292 21 0
k61_3570 297 12 0
k61_3572 517 44 0
k61_3573 480 51 0
k61_3574 470 27 0
k61_3575 261 6 0
k61_3576 256 8 0
k61_3577 230 16 0
k61_3578 383 30 0
k61_3579 308 20 0
k61_3581 377 33 0
k61_3582 540 37 0
k61_3583 337 14 0
k61_3584 346 28 0
k61_3585 342 31 0
k61_3586 1372 134 0
k61_3587 724 57 0
k61_3588 241 12 0
k61_3589 625 47 0
k61_3590 349 18 0
k61_3591 263 15 0
k61_3592 235 15 0
k61_3593 1251 118 0
k61_3594 230 13 0
k61_3595 447 35 0
k61_3596 432 28 0
k61_3597 405 31 0
k61_3598 487 42 0
k61_3599 272 28 0
k61_3600 541 42 0
k61_3601 212 17 0
k61_3602 405 35 0
k61_3603 277 26 0
k61_3604 226 16 0
k61_3605 202 23 0
k61_3606 382 45 0
k61_3607 218 7 0
k61_3608 353 21 0
k61_3609 338 26 0
k61_3610 862 73 0
k61_3611 606 63 0
k61_3612 424 27 0
k61_3614 918 95 0
k61_3615 342 20 0
k61_3616 399 38 0
k61_3617 361 37 0
k61_3619 272 11 0
k61_3620 222 8 0
k61_3621 859 78 0
k61_3622 291 16 0
k61_3623 461 19 0
k61_3624 266 12 0
k61_3625 577 40 0
k61_3626 572 49 0
k61_3627 211 11 0
k61_3628 614 37 0
k61_3629 461 36 0
k61_3630 367 24 0
k61_3631 1241 121 0
k61_3632 445 23 0
k61_3633 491 37 0
k61_3634 1319 169 0
k61_3635 202 10 0
k61_3636 381 28 0
k61_3637 384 26 0
k61_3638 227 14 0
k61_3639 536 47 0
k61_3640 235 18 0
k61_3641 814 55 0
k61_3642 283 11 0
k61_3643 227 10 0
k61_3644 212 10 0
k61_3645 510 47 0
k61_3646 689 63 0
k61_3647 328 32 0
k61_3648 393 16 0
k61_3649 430 42 0
k61_3650 430 34 0
k61_3651 832 61 0
k61_3652 908 86 0
k61_3653 589 41 0
k61_3654 357 14 0
k61_3656 226 13 0
k61_3657 270 18 0
k61_3658 403 23 0
k61_3659 261 21 0
k61_3663 2473 250 0
k61_3664 391 29 0
k61_3665 490 36 0
k61_3666 369 17 0
k61_3667 202 6 0
k61_3668 439 30 0
k61_3669 480 48 0
k61_3670 203 5 0
k61_3671 671 72 0
k61_3672 705 70 0
k61_3673 1710 152 0
k61_3674 739 69 0
k61_3675 839 91 0
k61_3676 973 111 0
k61_3677 287 14 0
k61_3678 542 72 0
k61_3679 374 41 0
k61_3680 1516 163 0
k61_3681 352 17 0
k61_3682 590 37 0
k61_3684 263 15 0
k61_3685 217 9 0
k61_3686 282 23 0
k61_3687 656 61 0
k61_3688 294 21 0
k61_3689 202 18 0
k61_3692 200 7 0
k61_3693 207 15 0
k61_3694 467 35 0
k61_3695 428 18 0
k61_3696 440 43 0
k61_3697 334 19 0
k61_3698 386 23 0
k61_3699 214 12 0
k61_3700 454 31 0
k61_3701 218 7 0
k61_3702 325 10 0
k61_3703 413 48 0
k61_3704 435 26 0
k61_3706 445 30 0
k61_3707 397 22 0
k61_3708 326 18 0
k61_3709 267 25 0
k61_3710 387 29 0
k61_3711 267 31 0
k61_3712 278 27 0
k61_3713 238 10 0
k61_3714 330 33 0
k61_3715 479 42 0
k61_3716 528 38 0
k61_3717 365 29 0
k61_3718 474 29 0
k61_3719 357 20 0
k61_3720 203 11 0
k61_3721 266 17 0
k61_3722 578 39 0
k61_3723 352 29 0
k61_3724 620 46 0
k61_3725 268 15 0
k61_3726 202 12 0
k61_3727 765 63 0
k61_3728 285 13 0
k61_3729 699 45 0
k61_3731 301 12 0
k61_3732 317 22 0
k61_3734 969 61 0
k61_3735 225 10 0
k61_3736 399 31 0
k61_3739 223 15 0
k61_3740 881 86 0
k61_3741 419 36 0
k61_3742 446 25 0
k61_3743 837 97 0
k61_3744 218 11 0
k61_3745 217 13 0
k61_3746 541 41 0
k61_3747 325 25 0
k61_3748 498 46 0
k61_3750 992 85 0
k61_3751 238 10 0
k61_3752 349 27 0
k61_3753 410 38 0
k61_3754 396 30 0
k61_3755 211 7 0
k61_3756 205 10 0
k61_3757 668 47 0
k61_3758 212 10 0
k61_3759 399 36 0
k61_3760 539 35 0
k61_3761 366 22 0
k61_3762 212 10 0
k61_3763 385 16 0
k61_3764 1267 124 0
k61_3765 286 16 0
k61_3766 263 20 0
k61_3768 227 14 0
k61_3770 677 54 0
k61_3772 455 45 0
k61_3773 233 15 0
k61_3774 411 33 0
k61_3775 536 49 0
k61_3776 201 12 0
k61_3777 355 18 0
k61_3778 265 11 0
k61_3779 488 38 0
k61_3780 339 19 0
k61_3781 502 57 0
k61_3782 681 64 0
k61_3783 222 10 0
k61_3784 319 23 0
k61_3785 208 12 0
k61_3787 377 39 0
k61_3788 1262 115 0
k61_3789 537 48 0
k61_3790 210 13 0
k61_3791 527 44 0
k61_3792 373 29 0
k61_3793 227 14 0
k61_3794 210 9 0
k61_3795 991 90 0
k61_3796 1033 73 0
k61_3797 323 10 0
k61_3798 266 14 0
k61_3799 232 10 0
k61_3800 231 7 0
k61_3801 209 10 0
k61_3802 1507 131 0
k61_3803 226 16 0
k61_3804 549 43 0
k61_3805 224 13 0
k61_3806 220 17 0
k61_3807 343 33 0
k61_3808 215 15 0
k61_3809 233 14 0
k61_3810 1098 123 0
k61_3811 1272 112 0
k61_3813 232 27 0
k61_3815 436 30 0
k61_3817 290 47 0
k61_3818 246 23 0
k61_3819 256 20 0
k61_3820 246 19 0
k61_3821 322 21 0
k61_3822 601 68 0
k61_3823 235 8 0
k61_3824 225 14 0
k61_3825 494 28 0
k61_3826 202 7 0
k61_3828 408 32 0
k61_3829 253 15 0
k61_3830 207 22 0
k61_3831 258 13 0
k61_3833 263 12 0
k61_3834 261 22 0
k61_3835 239 6 0
k61_3836 1015 88 0
k61_3837 487 34 0
k61_3838 250 13 0
k61_3839 339 21 0
k61_3840 804 99 0
k61_3841 698 55 0
k61_3842 584 51 0
k61_3844 331 17 0
k61_3845 403 27 0
k61_3846 259 8 0
k61_3847 313 22 0
k61_3848 263 17 0
k61_3849 232 24 0
k61_3850 230 8 0
k61_3851 583 56 0
k61_3852 221 17 0
k61_3853 270 17 0
k61_3854 264 12 0
k61_3855 697 66 0
k61_3856 411 38 0
k61_3857 231 9 0
k61_3858 242 15 0
k61_3859 226 12 0
k61_3861 257 13 0
k61_3862 392 41 0
k61_3863 253 23 0
k61_3865 531 50 0
k61_3867 245 22 0
k61_3868 240 14 0
k61_3869 399 23 0
k61_3870 632 54 0
k61_3871 683 48 0
k61_3873 244 20 0
k61_3874 1662 163 0
k61_3875 204 8 0
k61_3876 641 53 0
k61_3877 236 14 0
k61_3878 443 27 0
k61_3879 422 28 0
k61_3880 612 67 0
k61_3881 248 13 0
k61_3882 768 61 0
k61_3883 205 12 0
k61_3884 258 19 0
k61_3885 257 15 0
k61_3886 251 12 0
k61_3887 370 34 0
k61_3888 748 90 0
k61_3889 1053 100 0
k61_3891 265 16 0
k61_3892 309 28 0
k61_3893 201 6 0
k61_3894 234 20 0
k61_3895 208 13 0
k61_3896 1353 159 0
k61_3897 275 13 0
k61_3898 314 21 0
k61_3899 207 8 0
k61_3900 827 78 0
k61_3901 227 15 0
k61_3902 372 28 0
k61_3903 256 15 0
k61_3904 381 28 0
k61_3905 340 23 0
k61_3906 555 38 0
k61_3907 332 19 0
k61_3908 395 21 0
k61_3909 261 19 0
k61_3911 310 21 0
k61_3913 366 28 0
k61_3914 462 37 0
k61_3915 214 18 0
k61_3916 328 16 0
k61_3917 491 53 0
k61_3918 241 18 0
k61_3919 771 60 0
k61_3920 810 70 0
k61_3921 345 19 0
k61_3922 614 47 0
k61_3923 402 33 0
k61_3924 274 15 0
k61_3926 788 61 0
k61_3927 603 69 0
k61_3928 380 21 0
k61_3929 929 91 0
k61_3930 471 21 0
k61_3931 212 15 0
k61_3932 442 15 0
k61_3933 490 42 0
k61_3934 327 29 0
k61_3935 319 38 0
k61_3936 583 106 0
k61_3937 441 28 0
k61_3938 207 10 0
k61_3939 395 23 0
k61_3940 1130 99 0
k61_3943 315 31 0
k61_3944 251 18 0
k61_3945 388 16 0
k61_3946 400 43 0
k61_3947 642 36 0
k61_3948 331 32 0
k61_3949 293 17 0
k61_3950 467 43 0
k61_3951 229 10 0
k61_3952 308 16 0
k61_3953 482 50 0
k61_3955 228 9 0
k61_3956 469 23 0
k61_3958 205 18 0
k61_3959 954 92 0
k61_3960 271 20 0
k61_3961 746 83 0
k61_3962 490 39 0
k61_3963 623 43 0
k61_3964 349 26 0
k61_3966 894 74 0
k61_3967 610 65 0
k61_3968 867 95 0
k61_3969 204 13 0
k61_3970 1922 194 0
k61_3971 211 12 0
k61_3972 281 29 0
k61_3973 395 35 0
k61_3974 536 41 0
k61_3976 394 36 0
k61_3977 820 80 0
k61_3979 364 23 0
k61_3980 560 44 0
k61_3983 219 17 0
k61_3984 388 23 0
k61_3985 228 11 0
k61_3986 218 8 0
k61_3987 227 9 0
k61_3988 269 19 0
k61_3989 293 21 0
k61_3990 826 80 0
k61_3991 1253 116 0
k61_3992 233 8 0
k61_3993 323 34 0
k61_3994 345 29 0
k61_3995 537 52 0
k61_3996 883 86 0
k61_3998 237 14 0
k61_3999 273 16 0
k61_4000 368 33 0
k61_4001 304 17 0
k61_4002 543 48 0
k61_4003 280 26 0
k61_4004 254 13 0
k61_4005 357 23 0
k61_4006 399 24 0
k61_4007 311 17 0
k61_4008 315 22 0
k61_4009 231 8 0
k61_4010 207 14 0
k61_4011 269 25 0
k61_4012 273 16 0
k61_4014 745 98 0
k61_4015 201 9 0
k61_4017 218 9 0
k61_4018 310 46 0
k61_4019 308 24 0
k61_4020 261 12 0
k61_4021 249 24 0
k61_4022 970 89 0
k61_4023 494 51 0
k61_4024 488 48 0
k61_4025 549 52 0
k61_4026 343 41 0
k61_4027 359 28 0
k61_4028 207 5 0
k61_4029 359 16 0
k61_4030 627 50 0
k61_4031 303 29 0
k61_4032 382 24 0
k61_4033 501 37 0
k61_4034 366 18 0
k61_4035 261 26 0
k61_4036 792 80 0
k61_4037 257 22 0
k61_4038 617 56 0
k61_4039 442 38 0
k61_4040 406 31 0
k61_4042 205 14 0
k61_4043 202 6 0
k61_4044 292 28 0
k61_4045 1580 209 0
k61_4046 264 26 0
k61_4047 262 15 0
k61_4048 227 10 0
k61_4049 443 31 0
k61_4050 500 35 0
k61_4051 301 18 0
k61_4052 241 13 0
k61_4053 272 11 0
k61_4054 375 33 0
k61_4057 214 14 0
k61_4058 1489 138 0
k61_4059 367 44 0
k61_4060 385 37 0
k61_4061 255 27 0
k61_4062 286 34 0
k61_4063 530 45 0
k61_4064 210 12 0
k61_4065 229 16 0
k61_4066 445 34 0
k61_4067 266 17 0
k61_4068 618 52 0
k61_4069 270 19 0
k61_4070 461 47 0
k61_4071 220 11 0
k61_4072 286 16 0
k61_4073 309 15 0
k61_4074 789 75 0
k61_4075 237 16 0
k61_4076 219 12 0
k61_4077 747 57 0
k61_4078 264 13 0
k61_4079 337 17 0
k61_4080 2009 214 0
k61_4081 331 26 0
k61_4082 200 7 0
k61_4083 202 18 0
k61_4084 696 58 0
k61_4085 304 21 0
k61_4086 265 13 0
k61_4087 602 51 0
k61_4088 314 23 0
k61_4089 205 12 0
k61_4090 270 21 0
k61_4091 432 21 0
k61_4092 224 15 0
k61_4093 513 40 0
k61_4094 214 9 0
k61_4095 351 16 0
k61_4096 1138 79 0
k61_4097 922 72 0
k61_4098 409 29 0
k61_4099 363 43 0
k61_4100 742 85 0
k61_4101 323 16 0
k61_4102 1508 176 0
k61_4103 229 11 0
k61_4104 697 62 0
k61_4105 208 12 0
k61_4106 316 27 0
k61_4107 1092 105 0
k61_4108 253 7 0
k61_4109 332 21 0
k61_4110 248 10 0
k61_4111 369 16 0
k61_4112 584 41 0
k61_4113 347 17 0
k61_4114 702 64 0
k61_4115 285 19 0
k61_4117 622 46 0
k61_4118 513 33 0
k61_4119 627 49 0
k61_4121 326 22 0
k61_4122 423 49 0
k61_4123 209 15 0
k61_4124 1736 189 0
k61_4125 466 24 0
k61_4126 771 54 0
k61_4127 232 17 0
k61_4128 212 11 0
k61_4129 1386 162 0
k61_4130 926 85 0
k61_4131 1856 1116 0
k61_4132 537 42 0
k61_4133 396 34 0
k61_4135 718 53 0
k61_4136 453 41 0
k61_4138 267 20 0
k61_4139 205 9 0
k61_4140 279 17 0
k61_4141 265 11 0
k61_4142 260 33 0
k61_4143 478 31 0
k61_4144 348 20 0
k61_4145 505 41 0
k61_4146 243 18 0
k61_4147 684 64 0
k61_4148 213 17 0
k61_4149 580 47 0
k61_4150 830 73 0
k61_4151 343 29 0
k61_4152 334 17 0
k61_4153 257 17 0
k61_4154 414 43 0
k61_4155 236 9 0
k61_4156 476 43 0
k61_4157 939 91 0
k61_4159 212 6 0
k61_4160 329 31 0
k61_4161 202 9 0
k61_4162 255 18 0
k61_4163 540 48 0
k61_4164 446 43 0
k61_4165 202 6 0
k61_4166 347 29 0
k61_4167 642 49 0
k61_4168 299 17 0
k61_4170 234 9 0
k61_4171 413 27 0
k61_4172 332 27 0
k61_4173 204 10 0
k61_4174 215 8 0
k61_4175 365 25 0
k61_4176 503 33 0
k61_4177 806 82 0
k61_4178 376 23 0
k61_4179 659 56 0
k61_4180 364 22 0
k61_4181 2296 385 0
k61_4182 441 33 0
k61_4183 831 76 0
k61_4184 835 53 0
k61_4185 200 12 0
k61_4186 653 44 0
k61_4187 367 20 0
k61_4188 252 10 0
k61_4189 446 46 0
k61_4190 295 26 0
k61_4191 1420 122 0
k61_4192 418 30 0
k61_4193 266 18 0
k61_4194 201 8 0
k61_4195 327 19 0
k61_4196 717 49 0
k61_4197 305 29 0
k61_4200 211 17 0
k61_4201 590 46 0
k61_4202 350 25 0
k61_4203 341 27 0
k61_4204 226 11 0
k61_4205 321 8 0
k61_4206 932 128 0
k61_4207 436 22 0
k61_4208 353 32 0
k61_4209 235 7 0
k61_4210 243 9 0
k61_4211 223 16 0
k61_4212 2040 158 0
k61_4213 363 23 0
k61_4214 202 8 0
k61_4215 393 48 0
k61_4216 825 69 0
k61_4217 658 65 0
k61_4218 396 21 0
k61_4219 282 21 0
k61_4221 218 14 0
k61_4222 302 14 0
k61_4223 209 8 0
k61_4224 753 72 0
k61_4225 242 7 0
k61_4226 604 46 0
k61_4227 269 15 0
k61_4228 232 11 0
k61_4229 321 33 0
k61_4230 207 10 0
k61_4231 400 80 0
k61_4232 321 22 0
k61_4233 1134 115 0
k61_4234 592 46 0
k61_4235 419 20 0
k61_4236 220 9 0
k61_4238 1056 95 0
k61_4239 611 76 0
k61_4240 254 11 0
k61_4241 346 18 0
k61_4242 479 27 0
k61_4243 277 20 0
k61_4244 263 20 0
k61_4245 416 29 0
k61_4246 403 24 0
k61_4247 1240 129 0
k61_4248 238 14 0
k61_4249 454 61 0
k61_4250 378 37 0
k61_4251 406 36 0
k61_4252 519 42 0
k61_4253 383 32 0
k61_4254 329 25 0
k61_4255 338 15 0
k61_4256 403 29 0
k61_4257 587 40 0
k61_4258 513 40 0
k61_4259 496 49 0
k61_4260 221 6 0
k61_4261 732 66 0
k61_4262 484 44 0
k61_4264 310 23 0
k61_4265 285 33 0
k61_4266 1185 105 0
k61_4267 362 20 0
k61_4268 593 47 0
k61_4269 337 31 0
k61_4270 293 25 0
k61_4271 284 20 0
k61_4272 320 18 0
k61_4273 218 9 0
k61_4274 260 15 0
k61_4275 909 83 0
k61_4276 580 63 0
k61_4277 1049 107 0
k61_4278 539 33 0
k61_4279 325 32 0
k61_4280 341 18 0
k61_4281 324 20 0
k61_4282 651 62 0
k61_4283 243 10 0
k61_4284 220 8 0
k61_4285 382 30 0
k61_4286 222 15 0
k61_4287 698 49 0
k61_4288 208 10 0
k61_4289 360 14 0
k61_4290 295 36 0
k61_4291 514 45 0
k61_4292 212 11 0
k61_4293 571 48 0
k61_4294 697 68 0
k61_4295 202 18 0
k61_4296 414 44 0
k61_4297 339 33 0
k61_4298 361 21 0
k61_4299 1166 132 0
k61_4300 330 26 0
k61_4301 269 23 0
k61_4302 297 17 0
k61_4303 265 18 0
k61_4305 599 48 0
k61_4307 414 19 0
k61_4308 692 71 0
k61_4309 264 14 0
k61_4311 819 70 0
k61_4312 201 18 0
k61_4313 506 46 0
k61_4314 383 19 0
k61_4315 341 13 0
k61_4317 215 8 0
k61_4318 373 24 0
k61_4319 1446 129 0
k61_4320 345 24 0
k61_4322 1418 133 0
k61_4323 255 17 0
k61_4324 279 24 0
k61_4326 374 23 0
k61_4327 549 53 0
k61_4328 228 9 0
k61_4329 326 26 0
k61_4330 286 26 0
k61_4331 432 29 0
k61_4332 221 19 0
k61_4333 311 25 0
k61_4334 1112 123 0
k61_4335 573 44 0
k61_4336 234 10 0
k61_4337 256 15 0
k61_4339 265 16 0
k61_4340 282 19 0
k61_4341 297 11 0
k61_4342 258 13 0
k61_4343 1528 181 0
k61_4345 615 44 0
k61_4346 342 16 0
k61_4347 237 4 0
k61_4348 395 39 0
k61_4349 424 43 0
k61_4350 400 28 0
k61_4351 885 66 0
k61_4352 346 20 0
k61_4353 350 40 0
k61_4354 625 47 0
k61_4355 525 52 0
k61_4357 256 13 0
k61_4358 1152 97 0
k61_4359 576 38 0
k61_4360 257 17 0
k61_4361 330 18 0
k61_4362 262 13 0
k61_4363 242 32 0
k61_4364 730 63 0
k61_4365 270 30 0
k61_4366 266 13 0
k61_4367 1979 164 0
k61_4368 360 19 0
k61_4369 609 37 0
k61_4370 652 41 0
k61_4371 482 36 0
k61_4372 240 12 0
k61_4373 340 19 0
k61_4374 1091 105 0
k61_4375 440 31 0
k61_4376 305 23 0
k61_4377 457 35 0
k61_4378 228 10 0
k61_4379 311 24 0
k61_4380 481 54 0
k61_4381 325 21 0
k61_4382 234 10 0
k61_4383 445 29 0
k61_4384 222 5 0
k61_4385 272 25 0
k61_4386 349 22 0
k61_4387 207 8 0
k61_4388 289 11 0
k61_4390 364 27 0
k61_4391 249 16 0
k61_4392 488 71 0
k61_4393 233 25 0
k61_4395 337 11 0
k61_4397 616 64 0
k61_4398 254 8 0
k61_4399 430 17 0
k61_4400 252 10 0
k61_4401 420 30 0
k61_4402 236 12 0
k61_4403 570 59 0
k61_4404 226 19 0
k61_4405 456 55 0
k61_4406 711 81 0
k61_4407 479 41 0
k61_4409 713 65 0
k61_4410 206 6 0
k61_4411 1860 214 0
k61_4412 593 46 0
k61_4413 233 21 0
k61_4416 296 14 0
k61_4417 1621 156 0
k61_4418 330 26 0
k61_4419 393 30 0
k61_4420 256 10 0
k61_4421 370 46 0
k61_4422 2231 213 0
k61_4423 286 12 0
k61_4424 593 59 0
k61_4425 215 8 0
k61_4426 304 22 0
k61_4427 592 68 0
k61_4428 526 30 0
k61_4429 295 20 0
k61_4430 262 26 0
k61_4432 537 44 0
k61_4433 834 65 0
k61_4434 464 36 0
k61_4435 219 8 0
k61_4436 220 11 0
k61_4437 311 17 0
k61_4438 313 22 0
k61_4439 476 61 0
k61_4440 1173 125 0
k61_4441 319 14 0
k61_4443 405 27 0
k61_4444 208 14 0
k61_4445 439 29 0
k61_4446 334 21 0
k61_4448 249 9 0
k61_4449 415 31 0
k61_4450 251 23 0
k61_4451 311 15 0
k61_4452 527 43 0
k61_4453 504 44 0
k61_4454 374 23 0
k61_4455 400 32 0
k61_4456 311 27 0
k61_4457 304 25 0
k61_4458 476 39 0
k61_4459 229 16 0
k61_4460 1248 123 0
k61_4461 497 44 0
k61_4463 305 24 0
k61_4464 994 97 0
k61_4465 316 27 0
k61_4467 483 57 0
k61_4468 219 13 0
k61_4469 297 24 0
k61_4470 422 35 0
k61_4471 288 31 0
k61_4472 219 11 0
k61_4473 291 16 0
k61_4474 232 19 0
k61_4475 528 43 0
k61_4476 2160 205 0
k61_4477 519 37 0
k61_4478 246 12 0
k61_4479 396 37 0
k61_4480 363 48 0
k61_4482 219 21 0
k61_4483 377 33 0
k61_4484 331 16 0
k61_4485 1603 200 0
k61_4486 291 17 0
k61_4487 360 21 0
k61_4488 433 31 0
k61_4489 409 29 0
k61_4490 414 34 0
k61_4491 202 7 0
k61_4492 231 18 0
k61_4493 206 8 0
k61_4494 206 13 0
k61_4496 394 25 0
k61_4497 397 20 0
k61_4498 482 36 0
k61_4499 385 32 0
k61_4500 334 37 0
k61_4502 434 58 0
k61_4503 334 26 0
k61_4504 868 70 0
k61_4506 211 12 0
k61_4508 429 38 0
k61_4509 752 64 0
k61_4510 307 14 0
k61_4511 269 11 0
k61_4512 323 28 0
k61_4513 320 29 0
k61_4514 241 12 0
k61_4517 369 16 0
k61_4518 624 56 0
k61_4519 249 22 0
k61_4520 296 17 0
k61_4521 478 28 0
k61_4522 782 62 0
k61_4523 292 25 0
k61_4524 299 29 0
k61_4525 1098 107 0
k61_4526 299 20 0
k61_4527 264 21 0
k61_4528 512 49 0
k61_4529 462 37 0
k61_4530 650 71 0
k61_4532 937 64 0
k61_4533 645 68 0
k61_4534 324 16 0
k61_4535 216 20 0
k61_4536 651 71 0
k61_4537 480 31 0
k61_4538 211 10 0
k61_4539 388 25 0
k61_4540 388 34 0
k61_4541 202 8 0
k61_4543 728 59 0
k61_4544 1026 75 0
k61_4545 508 36 0
k61_4546 309 25 0
k61_4547 1427 143 0
k61_4548 350 24 0
k61_4549 258 9 0
k61_4550 295 21 0
k61_4551 410 43 0
k61_4552 854 80 0
k61_4553 1024 120 0
k61_4554 295 13 0
k61_4555 526 54 0
k61_4556 328 21 0
k61_4557 202 8 0
k61_4558 261 9 0
k61_4559 318 36 0
k61_4560 287 43 0
k61_4562 289 11 0
k61_4563 628 64 0
k61_4565 446 42 0
k61_4566 263 9 0
k61_4567 418 30 0
k61_4568 452 29 0
k61_4569 316 25 0
k61_4571 358 24 0
k61_4572 286 24 0
k61_4573 1110 1117 0
k61_4574 566 35 0
k61_4575 253 13 0
k61_4577 286 15 0
k61_4578 1324 117 0
k61_4579 202 19 0
k61_4580 327 20 0
k61_4581 308 11 0
k61_4582 392 40 0
k61_4583 369 481 0
k61_4585 929 97 0
k61_4587 307 16 0
k61_4588 242 12 0
k61_4589 288 31 0
k61_4590 358 23 0
k61_4591 240 9 0
k61_4593 579 42 0
k61_4594 257 12 0
k61_4595 478 50 0
k61_4597 543 53 0
k61_4598 390 32 0
k61_4599 429 16 0
k61_4600 225 8 0
k61_4601 240 11 0
k61_4602 228 9 0
k61_4603 246 21 0
k61_4605 855 69 0
k61_4606 279 24 0
k61_4607 226 8 0
k61_4608 640 51 0
k61_4609 843 104 0
k61_4610 281 10 0
k61_4611 410 40 0
k61_4612 468 51 0
k61_4613 283 22 0
k61_4614 295 9 0
k61_4616 228 15 0
k61_4617 924 100 0
k61_4618 1343 125 0
k61_4619 244 10 0
k61_4620 300 14 0
k61_4621 284 19 0
k61_4622 248 12 0
k61_4623 316 22 0
k61_4624 214 11 0
k61_4625 339 30 0
k61_4626 245 15 0
k61_4627 239 12 0
k61_4628 218 12 0
k61_4629 207 20 0
k61_4630 239 13 0
k61_4631 298 22 0
k61_4632 211 15 0
k61_4633 233 16 0
k61_4634 231 10 0
k61_4635 256 23 0
k61_4636 323 17 0
k61_4638 455 30 0
k61_4640 293 10 0
k61_4641 273 10 0
k61_4642 210 24 0
k61_4643 728 75 0
k61_4644 213 8 0
k61_4645 216 12 0
k61_4646 309 21 0
k61_4647 597 42 0
k61_4648 517 47 0
k61_4649 449 20 0
k61_4650 759 52 0
k61_4651 654 48 0
k61_4654 533 40 0
k61_4655 355 28 0
k61_4656 264 22 0
k61_4657 239 16 0
k61_4658 326 32 0
k61_4659 405 16 0
k61_4660 351 24 0
k61_4661 296 26 0
k61_4662 263 17 0
k61_4663 549 40 0
k61_4664 291 22 0
k61_4665 260 13 0
k61_4666 409 28 0
k61_4667 250 10 0
k61_4668 273 16 0
k61_4669 251 9 0
k61_4671 353 30 0
k61_4672 460 38 0
k61_4673 272 20 0
k61_4674 265 14 0
k61_4675 657 54 0
k61_4676 273 20 0
k61_4677 630 54 0
k61_4678 208 9 0
k61_4679 327 23 0
k61_4680 510 73 0
k61_4681 316 24 0
k61_4683 1685 194 0
k61_4684 216 43 0
k61_4685 292 12 0
k61_4686 273 22 0
k61_4687 336 18 0
k61_4688 339 21 0
k61_4689 680 48 0
k61_4690 856 80 0
k61_4691 629 43 0
k61_4692 1240 108 0
k61_4693 296 27 0
k61_4694 228 16 0
k61_4695 1362 136 0
k61_4696 530 52 0
k61_4697 454 32 0
k61_4698 536 46 0
k61_4699 207 10 0
k61_4700 703 62 0
k61_4702 392 25 0
k61_4703 450 21 0
k61_4704 231 10 0
k61_4705 264 9 0
k61_4706 505 39 0
k61_4707 702 75 0
k61_4708 236 17 0
k61_4709 710 56 0
k61_4710 390 33 0
k61_4711 542 34 0
k61_4712 380 16 0
k61_4713 589 44 0
k61_4714 510 34 0
k61_4715 329 16 0
k61_4716 370 26 0
k61_4719 329 15 0
k61_4720 440 37 0
k61_4721 619 46 0
k61_4722 593 57 0
k61_4723 645 63 0
k61_4727 246 13 0
k61_4728 436 33 0
k61_4729 201 7 0
k61_4731 733 56 0
k61_4732 439 33 0
k61_4734 228 12 0
k61_4735 719 71 0
k61_4736 355 36 0
k61_4737 345 38 0
k61_4738 246 15 0
k61_4739 309 23 0
k61_4740 378 37 0
k61_4741 302 34 0
k61_4742 468 57 0
k61_4744 364 22 0
k61_4745 472 56 0
k61_4746 233 13 0
k61_4747 262 8 0
k61_4748 2168 221 0
k61_4749 865 1070 0
k61_4751 676 66 0
k61_4752 200 9 0
k61_4753 220 8 0
k61_4754 873 77 0
k61_4755 680 51 0
k61_4756 238 15 0
k61_4757 452 26 0
k61_4758 415 33 0
k61_4759 1040 189 0
k61_4760 5189 809 0
k61_4761 204 10 0
k61_4762 268 20 0
k61_4763 293 26 0
k61_4764 408 27 0
k61_4765 687 47 0
k61_4766 279 22 0
k61_4767 221 7 0
k61_4769 253 21 0
k61_4770 255 10 0
k61_4771 224 51 0
k61_4772 381 25 0
k61_4773 242 12 0
k61_4774 565 63 0
k61_4775 393 31 0
k61_4776 483 42 0
k61_4777 240 10 0
k61_4778 355 12 0
k61_4779 321 23 0
k61_4780 778 54 0
k61_4781 332 22 0
k61_4782 223 20 0
k61_4783 543 55 0
k61_4784 461 21 0
k61_4785 671 43 0
k61_4786 1606 158 0
k61_4787 257 10 0
k61_4788 631 51 0
k61_4789 257 21 0
k61_4790 463 35 0
k61_4791 243 31 0
k61_4792 678 65 0
k61_4793 237 14 0
k61_4794 1207 148 0
k61_4795 830 84 0
k61_4796 216 6 0
k61_4797 261 17 0
k61_4798 321 13 0
k61_4799 276 38 0
k61_4800 397 16 0
k61_4801 285 14 0
k61_4803 603 41 0
k61_4804 1550 201 0
k61_4805 284 20 0
k61_4806 213 10 0
k61_4807 464 41 0
k61_4808 1815 170 0
k61_4809 201 9 0
k61_4810 307 27 0
k61_4811 672 58 0
k61_4812 311 18 0
k61_4813 335 16 0
k61_4814 1294 109 0
k61_4816 252 15 0
k61_4817 383 42 0
k61_4818 312 22 0
k61_4819 1122 137 0
k61_4820 222 12 0
k61_4822 556 52 0
k61_4823 220 9 0
k61_4825 363 60 0
k61_4826 344 85 0
k61_4829 267 13 0
k61_4830 688 55 0
k61_4831 230 10 0
k61_4832 573 52 0
k61_4833 397 28 0
k61_4834 536 44 0
k61_4835 435 33 0
k61_4836 2566 258 0
k61_4837 236 17 0
k61_4838 501 42 0
k61_4840 231 12 0
k61_4841 552 31 0
k61_4842 951 102 0
k61_4843 396 30 0
k61_4844 849 72 0
k61_4846 278 15 0
k61_4848 321 15 0
k61_4849 763 64 0
k61_4850 414 50 0
k61_4851 529 46 0
k61_4852 301 9 0
k61_4853 212 13 0
k61_4855 349 16 0
k61_4856 233 9 0
k61_4857 372 40 0
k61_4858 212 8 0
k61_4859 265 24 0
k61_4860 232 12 0
k61_4861 770 57 0
k61_4864 227 23 0
k61_4865 347 32 0
k61_4866 290 11 0
k61_4867 206 12 0
k61_4868 279 11 0
k61_4869 202 8 0
k61_4870 211 11 0
k61_4871 819 107 0
k61_4873 210 11 0
k61_4874 407 30 0
k61_4876 209 16 0
k61_4877 590 69 0
k61_4878 310 24 0
k61_4879 391 28 0
k61_4880 343 47 0
k61_4881 478 29 0
k61_4882 465 45 0
k61_4883 286 12 0
k61_4884 218 15 0
k61_4885 528 37 0
k61_4888 893 79 0
k61_4889 230 12 0
k61_4890 207 16 0
k61_4891 348 48 0
k61_4892 511 41 0
k61_4893 207 9 0
k61_4894 295 14 0
k61_4895 316 34 0
k61_4896 252 6 0
k61_4897 237 12 0
k61_4898 211 13 0
k61_4899 347 41 0
k61_4900 349 28 0
k61_4901 323 21 0
k61_4902 312 24 0
k61_4903 775 67 0
k61_4904 456 43 0
k61_4905 201 10 0
k61_4906 429 25 0
k61_4908 764 84 0
k61_4909 2409 230 0
k61_4910 720 59 0
k61_4911 1031 86 0
k61_4912 259 18 0
k61_4913 470 33 0
k61_4914 462 32 0
k61_4915 214 16 0
k61_4917 221 13 0
k61_4919 851 66 0
k61_4920 302 29 0
k61_4921 549 55 0
k61_4922 209 8 0
k61_4923 268 26 0
k61_4924 605 60 0
k61_4925 436 51 0
k61_4926 236 11 0
k61_4927 320 25 0
k61_4929 387 37 0
k61_4930 319 37 0
k61_4931 358 20 0
k61_4933 212 13 0
k61_4936 208 17 0
k61_4938 403 23 0
k61_4939 450 41 0
k61_4940 408 69 0
k61_4941 208 10 0
k61_4942 959 111 0
k61_4943 513 30 0
k61_4944 914 79 0
k61_4945 245 9 0
k61_4946 923 66 0
k61_4948 396 28 0
k61_4949 491 36 0
k61_4950 262 9 0
k61_4951 320 16 0
k61_4952 389 24 0
k61_4953 271 9 0
k61_4954 271 13 0
k61_4955 273 20 0
k61_4957 528 28 0
k61_4958 409 17 0
k61_4959 415 43 0
k61_4960 434 15 0
k61_4961 287 20 0
k61_4962 323 29 0
k61_4963 333 27 0
k61_4964 294 14 0
k61_4965 1116 118 0
k61_4966 200 15 0
k61_4967 209 9 0
k61_4968 310 18 0
k61_4969 249 13 0
k61_4970 330 21 0
k61_4971 360 24 0
k61_4972 262 26 0
k61_4974 281 16 0
k61_4975 302 16 0
k61_4977 205 9 0
k61_4978 1030 113 0
k61_4979 240 9 0
k61_4980 218 10 0
k61_4981 908 1091 0
k61_4982 1484 248 0
k61_4983 210 5 0
k61_4984 393 17 0
k61_4985 291 12 0
k61_4987 234 10 0
k61_4988 709 65 0
k61_4989 296 18 0
k61_4990 308 22 0
k61_4991 653 52 0
k61_4993 264 25 0
k61_4994 204 7 0
k61_4995 989 78 0
k61_4996 507 42 0
k61_4997 236 8 0
k61_4998 212 8 0
k61_4999 699 49 0
k61_5000 1032 96 0
k61_5001 351 32 0
k61_5004 253 11 0
k61_5006 211 12 0
k61_5007 247 12 0
k61_5008 280 13 0
k61_5009 562 39 0
k61_5010 281 17 0
k61_5012 464 46 0
k61_5013 968 71 0
k61_5015 214 17 0
k61_5016 934 101 0
k61_5017 237 9 0
k61_5018 568 51 0
k61_5019 564 63 0
k61_5021 922 79 0
k61_5022 224 12 0
k61_5023 1354 108 0
k61_5024 312 27 0
k61_5025 651 37 0
k61_5026 400 31 0
k61_5028 285 19 0
k61_5029 205 6 0
k61_5030 274 7 0
k61_5031 373 30 0
k61_5032 225 8 0
k61_5033 354 19 0
k61_5034 356 17 0
k61_5035 392 19 0
k61_5036 362 23 0
k61_5037 258 10 0
k61_5038 202 9 0
k61_5039 246 24 0
k61_5040 257 16 0
k61_5041 604 59 0
k61_5042 332 21 0
k61_5043 215 13 0
k61_5044 736 57 0
k61_5045 260 19 0
k61_5046 241 13 0
k61_5047 278 14 0
k61_5048 396 48 0
k61_5049 207 10 0
k61_5050 288 17 0
k61_5051 1880 2699 0
k61_5052 217 7 0
k61_5053 408 31 0
k61_5054 548 46 0
k61_5055 207 8 0
k61_5056 303 18 0
k61_5057 201 6 0
k61_5058 249 19 0
k61_5059 495 34 0
k61_5060 306 14 0
k61_5061 229 23 0
k61_5062 265 29 0
k61_5063 200 13 0
k61_5064 282 15 0
k61_5065 935 65 0
k61_5066 386 31 0
k61_5067 513 58 0
k61_5068 201 8 0
k61_5069 234 13 0
k61_5070 203 14 0
k61_5071 206 7 0
k61_5072 429 36 0
k61_5073 211 7 0
k61_5074 275 12 0
k61_5075 201 23 0
k61_5076 827 73 0
k61_5077 288 14 0
k61_5078 971 78 0
k61_5079 421 31 0
k61_5080 295 22 0
k61_5081 298 17 0
k61_5082 216 7 0
k61_5083 280 18 0
k61_5084 292 12 0
k61_5085 272 25 0
k61_5086 336 23 0
k61_5087 281 15 0
k61_5088 465 51 0
k61_5089 227 9 0
k61_5090 393 19 0
k61_5091 344 24 0
k61_5092 420 22 0
k61_5093 464 37 0
k61_5094 312 29 0
k61_5095 777 66 0
k61_5096 320 14 0
k61_5097 270 17 0
k61_5098 232 12 0
k61_5099 573 41 0
k61_5100 321 30 0
k61_5101 309 23 0
k61_5102 429 32 0
k61_5103 410 37 0
k61_5104 1569 171 0
k61_5105 273 23 0
k61_5107 313 17 0
k61_5108 301 22 0
k61_5109 294 167 0
k61_5110 301 18 0
k61_5111 320 21 0
k61_5112 456 45 0
k61_5113 220 14 0
k61_5114 388 32 0
k61_5115 249 15 0
k61_5116 430 41 0
k61_5117 438 31 0
k61_5119 252 7 0
k61_5120 313 13 0
k61_5121 345 34 0
k61_5122 470 35 0
k61_5123 717 92 0
k61_5124 224 16 0
k61_5125 304 21 0
k61_5126 595 43 0
k61_5128 315 24 0
k61_5129 386 21 0
k61_5130 399 25 0
k61_5131 228 17 0
k61_5133 210 11 0
k61_5134 529 50 0
k61_5135 364 17 0
k61_5136 320 23 0
k61_5137 386 33 0
k61_5138 208 18 0
k61_5139 316 20 0
k61_5140 214 16 0
k61_5141 428 32 0
k61_5142 1227 106 0
k61_5143 324 18 0
k61_5144 341 12 0
k61_5147 442 21 0
k61_5148 208 17 0
k61_5151 441 33 0
k61_5152 299 32 0
k61_5153 447 29 0
k61_5154 212 20 0
k61_5155 216 15 0
k61_5156 773 66 0
k61_5157 200 6 0
k61_5158 413 41 0
k61_5159 759 40 0
k61_5160 471 40 0
k61_5161 315 24 0
k61_5162 1315 1738 0
k61_5163 725 77 0
k61_5164 883 62 0
k61_5165 247 22 0
k61_5166 458 19 0
k61_5167 2234 185 0
k61_5168 357 18 0
k61_5169 299 14 0
k61_5170 271 12 0
k61_5171 290 23 0
k61_5172 321 48 0
k61_5173 266 22 0
k61_5174 266 16 0
k61_5175 201 8 0
k61_5176 685 56 0
k61_5177 291 19 0
k61_5178 273 11 0
k61_5179 208 12 0
k61_5180 318 32 0
k61_5181 231 11 0
k61_5182 1195 123 0
k61_5183 1069 91 0
k61_5185 1217 118 0
k61_5186 322 35 0
k61_5187 242 16 0
k61_5188 222 26 0
k61_5190 448 22 0
k61_5191 553 35 0
k61_5192 334 14 0
k61_5193 243 10 0
k61_5194 251 12 0
k61_5195 210 21 0
k61_5196 251 11 0
k61_5197 364 34 0
k61_5198 1343 124 0
k61_5200 1093 88 0
k61_5201 275 11 0
k61_5202 341 22 0
k61_5204 312 18 0
k61_5205 217 66 0
k61_5207 543 32 0
k61_5208 1335 134 0
k61_5209 693 59 0
k61_5211 261 25 0
k61_5212 284 19 0
k61_5213 823 61 0
k61_5214 323 22 0
k61_5215 651 30 0
k61_5216 1275 128 0
k61_5217 205 10 0
k61_5218 373 20 0
k61_5219 268 21 0
k61_5220 756 61 0
k61_5221 362 37 0
k61_5222 506 35 0
k61_5223 638 60 0
k61_5225 491 46 0
k61_5227 522 39 0
k61_5228 601 44 0
k61_5230 603 52 0
k61_5231 815 85 0
k61_5232 260 15 0
k61_5233 288 20 0
k61_5234 710 62 0
k61_5235 227 19 0
k61_5236 481 30 0
k61_5238 292 20 0
k61_5239 996 98 0
k61_5240 300 13 0
k61_5242 276 23 0
k61_5243 367 22 0
k61_5244 518 40 0
k61_5245 208 9 0
k61_5247 218 11 0
k61_5248 494 55 0
k61_5249 501 51 0
k61_5251 851 93 0
k61_5252 221 9 0
k61_5253 1122 152 0
k61_5254 234 14 0
k61_5255 395 38 0
k61_5256 725 72 0
k61_5258 286 23 0
k61_5259 714 48 0
k61_5260 245 18 0
k61_5261 441 21 0
k61_5263 273 13 0
k61_5264 532 52 0
k61_5265 276 21 0
k61_5267 1003 118 0
k61_5268 891 74 0
k61_5270 547 41 0
k61_5271 1517 159 0
k61_5273 225 26 0
k61_5274 275 17 0
k61_5275 264 10 0
k61_5276 209 9 0
k61_5277 358 27 0
k61_5279 360 26 0
k61_5280 266 9 0
k61_5281 478 35 0
k61_5282 200 9 0
k61_5283 445 20 0
k61_5284 308 17 0
k61_5285 305 15 0
k61_5286 204 11 0
k61_5287 1476 137 0
k61_5289 581 56 0
k61_5290 265 12 0
k61_5291 501 41 0
k61_5292 201 8 0
k61_5293 423 34 0
k61_5294 727 68 0
k61_5295 221 23 0
k61_5296 365 20 0
k61_5297 234 9 0
k61_5298 361 45 0
k61_5299 923 66 0
k61_5300 227 11 0
k61_5301 577 60 0
k61_5302 460 56 0
k61_5303 521 25 0
k61_5304 789 53 0
k61_5305 529 40 0
k61_5306 1735 181 0
k61_5307 317 17 0
k61_5308 308 20 0
k61_5309 547 53 0
k61_5310 579 50 0
k61_5311 705 84 0
k61_5312 378 37 0
k61_5313 267 19 0
k61_5314 479 38 0
k61_5315 391 36 0
k61_5316 325 24 0
k61_5318 209 9 0
k61_5319 337 23 0
k61_5320 206 11 0
k61_5321 292 10 0
k61_5322 272 16 0
k61_5323 300 29 0
k61_5324 678 49 0
k61_5325 314 13 0
k61_5326 1018 119 0
k61_5327 220 22 0
k61_5328 246 10 0
k61_5329 560 43 0
k61_5330 300 25 0
k61_5331 318 27 0
k61_5332 274 10 0
k61_5333 303 23 0
k61_5334 250 21 0
k61_5335 348 37 0
k61_5336 300 19 0
k61_5337 265 10 0
k61_5338 827 99 0
k61_5339 895 66 0
k61_5340 520 21 0
k61_5342 515 49 0
k61_5343 204 17 0
k61_5344 361 20 0
k61_5345 223 13 0
k61_5347 1210 119 0
k61_5348 366 25 0
k61_5349 349 32 0
k61_5350 319 15 0
k61_5351 633 43 0
k61_5352 584 75 0
k61_5353 316 24 0
k61_5354 279 35 0
k61_5355 210 7 0
k61_5357 821 67 0
k61_5358 489 63 0
k61_5359 320 15 0
k61_5361 1034 97 0
k61_5362 287 28 0
k61_5363 494 40 0
k61_5364 221 10 0
k61_5365 320 25 0
k61_5366 371 25 0
k61_5368 604 70 0
k61_5370 289 14 0
k61_5371 427 38 0
k61_5372 430 24 0
k61_5373 243 14 0
k61_5374 830 60 0
k61_5375 218 9 0
k61_5376 298 27 0
k61_5377 239 19 0
k61_5378 206 26 0
k61_5379 309 22 0
k61_5380 447 46 0
k61_5382 658 55 0
k61_5383 520 36 0
k61_5384 617 47 0
k61_5385 230 22 0
k61_5386 311 19 0
k61_5387 572 49 0
k61_5388 477 37 0
k61_5389 218 9 0
k61_5390 226 12 0
k61_5391 569 51 0
k61_5392 365 34 0
k61_5393 354 30 0
k61_5394 329 22 0
k61_5395 380 36 0
k61_5397 433 38 0
k61_5398 265 8 0
k61_5399 376 18 0
k61_5400 436 33 0
k61_5401 232 15 0
k61_5402 265 15 0
k61_5403 294 33 0
k61_5404 254 19 0
k61_5405 250 9 0
k61_5406 297 19 0
k61_5407 201 8 0
k61_5408 427 34 0
k61_5409 497 30 0
k61_5410 259 25 0
k61_5411 251 17 0
k61_5412 511 45 0
k61_5413 299 19 0
k61_5415 200 8 0
k61_5416 1419 157 0
k61_5417 210 14 0
k61_5418 606 49 0
k61_5420 903 58 0
k61_5421 824 105 0
k61_5422 252 16 0
k61_5423 344 32 0
k61_5424 290 15 0
k61_5425 338 22 0
k61_5426 269 8 0
k61_5428 242 18 0
k61_5429 711 87 0
k61_5430 259 18 0
k61_5431 287 11 0
k61_5432 572 57 0
k61_5433 222 9 0
k61_5434 438 27 0
k61_5435 230 14 0
k61_5436 717 77 0
k61_5437 338 12 0
k61_5438 218 10 0
k61_5439 540 52 0
k61_5440 260 24 0
k61_5441 750 54 0
k61_5442 244 11 0
k61_5443 2829 264 0
k61_5444 254 13 0
k61_5445 543 42 0
k61_5446 514 47 0
k61_5448 247 7 0
k61_5449 387 27 0
k61_5450 740 67 0
k61_5451 292 15 0
k61_5452 669 41 0
k61_5453 565 45 0
k61_5454 217 9 0
k61_5456 488 51 0
k61_5457 324 21 0
k61_5458 514 28 0
k61_5460 478 39 0
k61_5462 399 23 0
k61_5463 612 57 0
k61_5464 241 26 0
k61_5465 209 11 0
k61_5466 602 40 0
k61_5467 238 13 0
k61_5469 308 43 0
k61_5470 597 70 0
k61_5471 370 20 0
k61_5472 272 21 0
k61_5473 295 12 0
k61_5474 350 27 0
k61_5475 346 25 0
k61_5478 325 21 0
k61_5480 441 28 0
k61_5482 706 71 0
k61_5483 618 45 0
k61_5484 226 41 0
k61_5485 262 13 0
k61_5487 298 16 0
k61_5488 227 9 0
k61_5489 608 45 0
k61_5490 418 27 0
k61_5491 344 26 0
k61_5492 1635 187 0
k61_5493 233 19 0
k61_5494 331 23 0
k61_5495 309 24 0
k61_5496 215 6 0
k61_5497 212 14 0
k61_5498 208 5 0
k61_5499 331 20 0
k61_5500 518 39 0
k61_5501 260 18 0
k61_5502 804 79 0
k61_5503 296 20 0
k61_5504 288 14 0
k61_5505 649 70 0
k61_5506 333 17 0
k61_5507 312 29 0
k61_5508 322 28 0
k61_5510 247 9 0
k61_5511 561 42 0
k61_5512 380 28 0
k61_5513 237 12 0
k61_5514 754 56 0
k61_5515 515 47 0
k61_5516 274 29 0
k61_5518 375 37 0
k61_5519 214 10 0
k61_5520 527 47 0
k61_5521 256 20 0
k61_5522 222 13 0
k61_5523 302 17 0
k61_5524 216 12 0
k61_5525 328 23 0
k61_5526 229 13 0
k61_5527 439 35 0
k61_5528 1089 111 0
k61_5529 250 17 0
k61_5530 242 8 0
k61_5531 202 11 0
k61_5532 289 30 0
k61_5533 926 72 0
k61_5535 319 22 0
k61_5536 335 12 0
k61_5537 1236 111 0
k61_5538 522 48 0
k61_5539 895 105 0
k61_5540 313 15 0
k61_5541 271 28 0
k61_5542 259 7 0
k61_5543 775 50 0
k61_5544 454 49 0
k61_5545 1354 113 0
k61_5546 273 20 0
k61_5547 248 10 0
k61_5548 1355 138 0
k61_5549 207 9 0
k61_5550 947 92 0
k61_5551 430 38 0
k61_5552 216 13 0
k61_5553 216 6 0
k61_5554 221 7 0
k61_5555 2510 274 0
k61_5556 618 51 0
k61_5557 372 28 0
k61_5558 491 32 0
k61_5559 389 32 0
k61_5560 433 55 0
k61_5562 262 16 0
k61_5563 375 38 0
k61_5564 244 15 0
k61_5565 544 45 0
k61_5566 491 34 0
k61_5567 256 18 0
k61_5568 375 24 0
k61_5569 402 23 0
k61_5570 288 21 0
k61_5571 345 27 0
k61_5572 398 17 0
k61_5573 234 8 0
k61_5574 260 10 0
k61_5575 635 53 0
k61_5576 385 32 0
k61_5577 413 26 0
k61_5578 354 21 0
k61_5579 500 50 0
k61_5580 219 6 0
k61_5582 367 23 0
k61_5583 625 49 0
k61_5585 286 16 0
k61_5586 411 20 0
k61_5587 288 20 0
k61_5588 520 35 0
k61_5589 260 10 0
k61_5590 588 24 0
k61_5591 371 27 0
k61_5592 343 25 0
k61_5593 347 19 0
k61_5594 559 50 0
k61_5596 208 11 0
k61_5597 967 103 0
k61_5598 900 83 0
k61_5599 767 63 0
k61_5600 940 93 0
k61_5601 376 21 0
k61_5602 2963 401 0
k61_5603 882 81 0
k61_5604 218 12 0
k61_5605 430 22 0
k61_5606 312 23 0
k61_5607 224 14 0
k61_5608 217 13 0
k61_5610 238 9 0
k61_5611 1325 139 0
k61_5612 215 8 0
k61_5613 234 8 0
k61_5614 213 8 0
k61_5615 931 136 0
k61_5616 211 7 0
k61_5617 289 28 0
k61_5618 312 22 0
k61_5619 816 49 0
k61_5620 252 20 0
k61_5621 431 43 0
k61_5622 483 30 0
k61_5623 955 78 0
k61_5624 221 10 0
k61_5625 271 15 0
k61_5626 326 14 0
k61_5627 655 62 0
k61_5628 275 13 0
k61_5629 214 10 0
k61_5630 253 14 0
k61_5632 270 21 0
k61_5633 567 46 0
k61_5634 234 15 0
k61_5636 225 18 0
k61_5637 297 28 0
k61_5639 1327 115 0
k61_5640 230 20 0
k61_5641 474 47 0
k61_5642 369 30 0
k61_5643 840 102 0
k61_5644 271 22 0
k61_5645 1148 112 0
k61_5646 229 6 0
k61_5647 356 20 0
k61_5648 380 27 0
k61_5649 235 16 0
k61_5650 652 60 0
k61_5651 332 29 0
k61_5652 782 58 0
k61_5653 272 24 0
k61_5654 279 25 0
k61_5656 401 34 0
k61_5657 352 24 0
k61_5659 346 28 0
k61_5660 469 47 0
k61_5661 318 19 0
k61_5662 921 101 0
k61_5663 261 12 0
k61_5664 220 14 0
k61_5665 289 18 0
k61_5667 234 16 0
k61_5668 230 22 0
k61_5669 309 16 0
k61_5670 379 17 0
k61_5671 885 87 0
k61_5674 496 31 0
k61_5675 453 20 0
k61_5676 422 23 0
k61_5677 371 35 0
k61_5678 227 20 0
k61_5680 404 21 0
k61_5681 1121 1092 0
k61_5683 200 18 0
k61_5684 202 7 0
k61_5685 438 29 0
k61_5687 203 8 0
k61_5688 518 49 0
k61_5689 245 23 0
k61_5690 664 68 0
k61_5691 454 52 0
k61_5692 251 19 0
k61_5693 467 38 0
k61_5694 330 19 0
k61_5695 313 29 0
k61_5696 200 10 0
k61_5697 266 33 0
k61_5698 267 36 0
k61_5700 326 30 0
k61_5701 259 10 0
k61_5702 233 19 0
k61_5703 718 53 0
k61_5704 377 43 0
k61_5705 319 28 0
k61_5707 230 9 0
k61_5708 216 11 0
k61_5709 571 44 0
k61_5710 277 22 0
k61_5711 1198 86 0
k61_5712 319 21 0
k61_5713 526 26 0
k61_5714 478 40 0
k61_5715 457 49 0
k61_5716 218 8 0
k61_5717 634 54 0
k61_5718 347 24 0
k61_5719 399 28 0
k61_5720 268 29 0
k61_5721 392 25 0
k61_5722 514 35 0
k61_5723 1332 108 0
k61_5724 505 64 0
k61_5725 307 26 0
k61_5726 397 26 0
k61_5727 736 50 0
k61_5728 801 74 0
k61_5729 622 53 0
k61_5730 267 14 0
k61_5731 359 23 0
k61_5732 309 33 0
k61_5733 283 10 0
k61_5735 286 14 0
k61_5736 839 65 0
k61_5739 2471 920 0
k61_5740 233 16 0
k61_5742 243 10 0
k61_5743 546 44 0
k61_5744 502 41 0
k61_5745 517 30 0
k61_5746 391 24 0
k61_5747 372 29 0
k61_5748 1211 104 0
k61_5749 370 16 0
k61_5751 265 20 0
k61_5752 698 64 0
k61_5753 223 21 0
k61_5754 211 9 0
k61_5755 393 21 0
k61_5756 265 12 0
k61_5757 230 22 0
k61_5758 202 6 0
k61_5759 620 51 0
k61_5760 229 17 0
k61_5761 498 40 0
k61_5762 203 9 0
k61_5763 409 38 0
k61_5764 510 52 0
k61_5765 235 20 0
k61_5766 375 27 0
k61_5767 258 17 0
k61_5768 1087 118 0
k61_5769 302 26 0
k61_5770 677 64 0
k61_5771 269 22 0
k61_5773 205 11 0
k61_5774 444 30 0
k61_5775 225 33 0
k61_5776 610 51 0
k61_5777 279 23 0
k61_5778 277 19 0
k61_5779 287 30 0
k61_5780 298 19 0
k61_5781 212 13 0
k61_5782 587 36 0
k61_5783 767 76 0
k61_5784 547 51 0
k61_5785 253 13 0
k61_5786 258 12 0
k61_5787 311 19 0
k61_5789 429 29 0
k61_5790 205 16 0
k61_5791 631 48 0
k61_5792 299 16 0
k61_5793 438 28 0
k61_5794 217 9 0
k61_5796 255 29 0
k61_5797 200 14 0
k61_5798 285 26 0
k61_5799 415 21 0
k61_5800 247 19 0
k61_5801 284 13 0
k61_5802 329 16 0
k61_5803 220 14 0
k61_5804 207 7 0
k61_5805 1143 99 0
k61_5806 492 46 0
k61_5807 571 34 0
k61_5808 241 16 0
k61_5809 206 20 0
k61_5811 1228 140 0
k61_5812 242 12 0
k61_5813 322 12 0
k61_5814 269 23 0
k61_5815 281 25 0
k61_5816 439 44 0
k61_5817 952 86 0
k61_5818 255 21 0
k61_5819 383 29 0
k61_5820 889 81 0
k61_5821 454 38 0
k61_5822 240 16 0
k61_5823 380 28 0
k61_5824 1793 196 0
k61_5825 344 15 0
k61_5826 382 36 0
k61_5827 214 8 0
k61_5828 207 12 0
k61_5829 254 29 0
k61_5830 230 17 0
k61_5831 360 46 0
k61_5832 238 11 0
k61_5833 371 23 0
k61_5834 1091 177 0
k61_5835 315 16 0
k61_5836 809 67 0
k61_5837 234 21 0
k61_5838 725 56 0
k61_5839 323 35 0
k61_5840 229 9 0
k61_5841 2423 448 0
k61_5842 460 39 0
k61_5843 329 20 0
k61_5844 300 34 0
k61_5845 238 14 0
k61_5847 229 17 0
k61_5848 341 27 0
k61_5849 332 21 0
k61_5851 203 12 0
k61_5852 685 62 0
k61_5853 249 23 0
k61_5854 232 19 0
k61_5855 270 17 0
k61_5856 378 18 0
k61_5857 215 16 0
k61_5858 527 33 0
k61_5859 223 13 0
k61_5861 249 21 0
k61_5862 255 18 0
k61_5863 692 55 0
k61_5864 340 18 0
k61_5865 269 25 0
k61_5866 973 91 0
k61_5867 599 42 0
k61_5868 216 9 0
k61_5869 396 19 0
k61_5870 398 28 0
k61_5872 331 31 0
k61_5873 1538 210 0
k61_5874 417 27 0
k61_5875 257 27 0
k61_5877 233 14 0
k61_5878 332 22 0
k61_5879 503 50 0
k61_5880 236 11 0
k61_5881 408 40 0
k61_5882 262 26 0
k61_5883 281 28 0
k61_5884 1173 104 0
k61_5885 217 75 0
k61_5886 499 36 0
k61_5887 577 41 0
k61_5888 810 75 0
k61_5889 368 28 0
k61_5890 237 9 0
k61_5891 294 15 0
k61_5892 265 13 0
k61_5893 563 51 0
k61_5894 217 16 0
k61_5895 767 58 0
k61_5896 277 16 0
k61_5897 1432 92 0
k61_5898 400 22 0
k61_5899 483 23 0
k61_5900 297 32 0
k61_5901 246 16 0
k61_5902 202 9 0
k61_5903 1125 95 0
k61_5904 221 13 0
k61_5905 676 58 0
k61_5906 689 57 0
k61_5907 292 16 0
k61_5908 806 69 0
k61_5909 561 49 0
k61_5911 773 51 0
k61_5912 251 32 0
k61_5913 418 31 0
k61_5914 237 12 0
k61_5915 231 18 0
k61_5916 237 10 0
k61_5917 265 13 0
k61_5918 290 17 0
k61_5919 218 6 0
k61_5920 360 29 0
k61_5921 299 18 0
k61_5922 550 70 0
k61_5923 214 9 0
k61_5924 537 50 0
k61_5925 401 24 0
k61_5926 688 70 0
k61_5927 252 11 0
k61_5928 424 36 0
k61_5929 324 11 0
k61_5930 334 30 0
k61_5931 1696 189 0
k61_5933 599 45 0
k61_5934 798 65 0
k61_5935 299 28 0
k61_5936 524 57 0
k61_5937 207 8 0
k61_5938 275 31 0
k61_5939 204 6 0
k61_5940 233 13 0
k61_5941 1258 108 0
k61_5942 489 46 0
k61_5943 301 35 0
k61_5944 244 22 0
k61_5945 260 5 0
k61_5946 1329 131 0
k61_5947 665 70 0
k61_5948 420 29 0
k61_5949 302 16 0
k61_5950 283 20 0
k61_5951 679 69 0
k61_5952 216 16 0
k61_5953 1583 152 0
k61_5954 201 14 0
k61_5955 893 69 0
k61_5956 240 16 0
k61_5957 644 41 0
k61_5958 510 33 0
k61_5959 226 15 0
k61_5960 1578 126 0
k61_5961 306 15 0
k61_5963 908 87 0
k61_5964 208 4 0
k61_5965 233 14 0
k61_5966 363 39 0
k61_5967 203 8 0
k61_5968 265 19 0
k61_5969 301 18 0
k61_5970 464 38 0
k61_5971 357 25 0
k61_5972 261 11 0
k61_5973 628 61 0
k61_5974 334 32 0
k61_5975 222 20 0
k61_5976 598 42 0
k61_5977 835 74 0
k61_5978 343 28 0
k61_5979 309 18 0
k61_5980 467 39 0
k61_5981 235 15 0
k61_5983 485 40 0
k61_5984 559 50 0
k61_5985 211 11 0
k61_5986 262 11 0
k61_5987 235 11 0
k61_5988 238 21 0
k61_5989 315 16 0
k61_5990 724 54 0
k61_5991 244 14 0
k61_5992 253 21 0
k61_5993 501 45 0
k61_5994 1404 194 0
k61_5995 437 31 0
k61_5996 267 16 0
k61_5997 479 37 0
k61_5998 689 58 0
k61_5999 502 45 0
k61_6000 688 77 0
k61_6002 466 37 0
k61_6003 236 24 0
k61_6004 3124 719 0
k61_6005 639 53 0
k61_6006 248 8 0
k61_6007 226 13 0
k61_6008 349 26 0
k61_6009 351 31 0
k61_6010 569 46 0
k61_6012 1231 113 0
k61_6013 294 17 0
k61_6014 243 9 0
k61_6015 252 19 0
k61_6016 984 83 0
k61_6017 421 40 0
k61_6018 324 17 0
k61_6019 313 23 0
k61_6020 268 16 0
k61_6021 318 22 0
k61_6022 284 23 0
k61_6023 1378 148 0
k61_6024 287 18 0
k61_6025 224 9 0
k61_6026 616 45 0
k61_6027 527 38 0
k61_6028 518 47 0
k61_6030 481 34 0
k61_6031 302 12 0
k61_6032 274 14 0
k61_6033 227 11 0
k61_6034 435 28 0
k61_6035 320 20 0
k61_6036 310 23 0
k61_6037 261 16 0
k61_6038 523 61 0
k61_6040 284 29 0
k61_6041 990 86 0
k61_6042 210 7 0
k61_6043 222 13 0
k61_6044 231 8 0
k61_6045 689 61 0
k61_6046 482 35 0
k61_6047 250 26 0
k61_6048 233 15 0
k61_6050 1728 198 0
k61_6051 318 23 0
k61_6052 292 30 0
k61_6054 484 43 0
k61_6055 270 18 0
k61_6056 705 30 0
k61_6057 260 10 0
k61_6058 230 12 0
k61_6059 395 29 0
k61_6060 402 41 0
k61_6061 414 30 0
k61_6062 389 38 0
k61_6065 912 68 0
k61_6066 420 42 0
k61_6067 886 82 0
k61_6068 390 16 0
k61_6069 202 5 0
k61_6070 221 16 0
k61_6071 261 19 0
k61_6072 276 18 0
k61_6073 290 17 0
k61_6074 222 19 0
k61_6075 282 9 0
k61_6076 276 15 0
k61_6077 262 13 0
k61_6078 1509 152 0
k61_6079 533 32 0
k61_6081 248 17 0
k61_6082 291 27 0
k61_6083 251 11 0
k61_6084 627 57 0
k61_6085 220 11 0
k61_6087 234 12 0
k61_6088 209 19 0
k61_6089 287 11 0
k61_6090 499 31 0
k61_6091 278 12 0
k61_6092 1717 158 0
k61_6094 384 15 0
k61_6095 628 46 0
k61_6096 223 7 0
k61_6097 293 17 0
k61_6098 349 29 0
k61_6099 272 17 0
k61_6101 238 24 0
k61_6102 352 17 0
k61_6103 213 9 0
k61_6105 201 14 0
k61_6106 447 30 0
k61_6107 412 35 0
k61_6108 263 18 0
k61_6109 453 29 0
k61_6110 334 27 0
k61_6111 202 7 0
k61_6113 478 47 0
k61_6114 730 86 0
k61_6115 321 34 0
k61_6116 256 26 0
k61_6117 240 10 0
k61_6118 503 37 0
k61_6119 379 34 0
k61_6120 1704 147 0
k61_6122 1622 160 0
k61_6124 200 14 0
k61_6125 266 16 0
k61_6126 333 23 0
k61_6127 786 67 0
k61_6128 363 29 0
k61_6129 263 13 0
k61_6130 260 27 0
k61_6131 233 13 0
k61_6132 239 12 0
k61_6134 576 57 0
k61_6135 267 13 0
k61_6136 536 53 0
k61_6137 574 45 0
k61_6138 498 38 0
k61_6139 400 35 0
k61_6140 629 55 0
k61_6141 376 22 0
k61_6142 250 17 0
k61_6143 222 17 0
k61_6144 325 27 0
k61_6146 387 38 0
k61_6148 904 75 0
k61_6149 464 41 0
k61_6150 248 9 0
k61_6151 309 25 0
k61_6152 1193 132 0
k61_6153 871 43 0
k61_6154 297 14 0
k61_6155 229 6 0
k61_6156 562 44 0
k61_6157 256 16 0
k61_6158 407 43 0
k61_6159 403 34 0
k61_6161 236 13 0
k61_6162 371 28 0
k61_6163 363 30 0
k61_6164 303 12 0
k61_6165 900 67 0
k61_6166 276 19 0
k61_6167 403 22 0
k61_6168 281 18 0
k61_6169 300 15 0
k61_6170 512 29 0
k61_6171 310 21 0
k61_6172 447 18 0
k61_6173 252 8 0
k61_6174 1198 125 0
k61_6175 229 8 0
k61_6176 497 46 0
k61_6177 208 10 0
k61_6178 603 44 0
k61_6179 756 81 0
k61_6180 536 41 0
k61_6183 548 25 0
k61_6184 201 8 0
k61_6185 475 37 0
k61_6186 248 9 0
k61_6187 453 32 0
k61_6188 215 15 0
k61_6189 1028 101 0
k61_6190 314 21 0
k61_6191 216 25 0
k61_6192 297 31 0
k61_6193 632 43 0
k61_6194 595 50 0
k61_6195 1086 85 0
k61_6196 285 18 0
k61_6197 586 44 0
k61_6198 202 7 0
k61_6199 382 26 0
k61_6200 231 16 0
k61_6201 370 14 0
k61_6202 503 40 0
k61_6203 245 14 0
k61_6204 1255 134 0
k61_6205 524 45 0
k61_6206 256 13 0
k61_6207 543 61 0
k61_6209 938 101 0
k61_6210 368 29 0
k61_6212 232 9 0
k61_6213 319 16 0
k61_6214 275 12 0
k61_6216 320 22 0
k61_6217 368 22 0
k61_6218 298 12 0
k61_6219 694 76 0
k61_6220 299 21 0
k61_6221 709 54 0
k61_6222 336 14 0
k61_6223 235 13 0
k61_6224 260 16 0
k61_6225 396 28 0
k61_6226 259 19 0
k61_6227 786 60 0
k61_6228 876 62 0
k61_6230 374 36 0
k61_6231 331 26 0
k61_6232 309 23 0
k61_6233 414 41 0
k61_6234 440 42 0
k61_6235 386 19 0
k61_6236 712 37 0
k61_6237 871 59 0
k61_6238 275 22 0
k61_6239 290 12 0
k61_6240 245 18 0
k61_6241 235 10 0
k61_6242 350 31 0
k61_6243 586 42 0
k61_6244 619 44 0
k61_6245 211 6 0
k61_6246 351 27 0
k61_6247 415 29 0
k61_6248 278 18 0
k61_6249 576 56 0
k61_6250 202 12 0
k61_6251 221 11 0
k61_6252 702 61 0
k61_6253 597 68 0
k61_6254 605 74 0
k61_6255 208 9 0
k61_6256 230 13 0
k61_6258 570 64 0
k61_6259 266 11 0
k61_6260 479 32 0
k61_6261 411 20 0
k61_6262 251 16 0
k61_6263 296 26 0
k61_6264 1084 101 0
k61_6266 308 32 0
k61_6267 685 64 0
k61_6268 298 28 0
k61_6269 693 69 0
k61_6270 231 22 0
k61_6271 585 52 0
k61_6272 229 15 0
k61_6273 214 8 0
k61_6274 274 16 0
k61_6275 215 8 0
k61_6276 539 56 0
k61_6277 428 33 0
k61_6278 254 10 0
k61_6279 359 16 0
k61_6280 208 21 0
k61_6281 647 48 0
k61_6282 549 45 0
k61_6283 321 16 0
k61_6284 242 8 0
k61_6285 655 59 0
k61_6286 561 48 0
k61_6287 378 26 0
k61_6288 269 18 0
k61_6289 240 7 0
k61_6290 333 18 0
k61_6291 732 62 0
k61_6292 462 44 0
k61_6293 202 8 0
k61_6294 229 26 0
k61_6296 318 18 0
k61_6297 762 63 0
k61_6298 414 30 0
k61_6299 640 64 0
k61_6300 409 36 0
k61_6301 217 12 0
k61_6302 389 24 0
k61_6303 235 11 0
k61_6304 234 11 0
k61_6305 571 47 0
k61_6306 279 18 0
k61_6307 637 61 0
k61_6308 293 18 0
k61_6309 404 22 0
k61_6310 345 25 0
k61_6312 1071 99 0
k61_6313 214 11 0
k61_6314 229 18 0
k61_6315 206 13 0
k61_6316 651 77 0
k61_6317 857 84 0
k61_6318 748 75 0
k61_6319 477 29 0
k61_6320 920 109 0
k61_6322 353 26 0
k61_6323 227 10 0
k61_6324 608 49 0
k61_6326 226 16 0
k61_6327 429 36 0
k61_6328 724 61 0
k61_6331 536 48 0
k61_6332 272 21 0
k61_6333 271 19 0
k61_6334 343 22 0
k61_6335 470 30 0
k61_6336 803 78 0
k61_6337 279 16 0
k61_6338 249 9 0
k61_6339 216 6 0
k61_6340 601 44 0
k61_6341 230 10 0
k61_6342 245 15 0
k61_6345 205 7 0
k61_6346 881 94 0
k61_6348 366 20 0
k61_6349 216 13 0
k61_6350 237 19 0
k61_6351 254 9 0
k61_6353 537 61 0
k61_6354 578 52 0
k61_6355 364 25 0
k61_6356 335 34 0
k61_6357 225 6 0
k61_6358 215 10 0
k61_6359 241 10 0
k61_6360 268 17 0
k61_6361 207 13 0
k61_6362 250 12 0
k61_6363 324 19 0
k61_6366 217 8 0
k61_6367 212 12 0
k61_6368 247 12 0
k61_6369 232 16 0
k61_6370 292 18 0
k61_6371 210 10 0
k61_6372 1048 69 0
k61_6373 727 57 0
k61_6374 1064 141 0
k61_6375 258 18 0
k61_6376 296 25 0
k61_6377 205 10 0
k61_6378 262 7 0
k61_6379 317 19 0
k61_6380 463 42 0
k61_6381 501 57 0
k61_6382 1087 114 0
k61_6383 243 7 0
k61_6384 474 43 0
k61_6385 312 31 0
k61_6386 202 16 0
k61_6387 490 44 0
k61_6390 379 31 0
k61_6391 394 31 0
k61_6392 325 35 0
k61_6394 393 36 0
k61_6395 543 37 0
k61_6396 2072 259 0
k61_6397 676 73 0
k61_6398 316 19 0
k61_6399 230 11 0
k61_6400 262 24 0
k61_6401 389 27 0
k61_6402 412 22 0
k61_6403 247 13 0
k61_6405 448 32 0
k61_6406 240 37 0
k61_6407 708 53 0
k61_6409 458 56 0
k61_6412 483 36 0
k61_6413 833 86 0
k61_6415 663 75 0
k61_6416 369 31 0
k61_6418 704 55 0
k61_6419 261 13 0
k61_6420 1748 192 0
k61_6421 247 14 0
k61_6422 239 17 0
k61_6423 207 16 0
k61_6424 291 31 0
k61_6425 256 29 0
k61_6426 224 12 0
k61_6427 1311 130 0
k61_6428 278 23 0
k61_6429 465 29 0
k61_6430 855 71 0
k61_6431 338 21 0
k61_6432 856 88 0
k61_6433 970 84 0
k61_6434 664 72 0
k61_6435 380 18 0
k61_6436 453 35 0
k61_6437 503 39 0
k61_6438 218 13 0
k61_6439 345 25 0
k61_6440 201 21 0
k61_6441 391 21 0
k61_6442 333 17 0
k61_6444 222 11 0
k61_6445 228 16 0
k61_6446 647 58 0
k61_6447 331 22 0
k61_6449 218 10 0
k61_6450 216 28 0
k61_6452 289 26 0
k61_6453 578 42 0
k61_6454 873 107 0
k61_6456 521 49 0
k61_6457 293 17 0
k61_6458 255 19 0
k61_6459 258 15 0
k61_6461 220 12 0
k61_6462 234 13 0
k61_6463 841 76 0
k61_6464 239 53 0
k61_6465 406 22 0
k61_6466 222 9 0
k61_6469 224 24 0
k61_6470 1051 82 0
k61_6471 263 21 0
k61_6473 1128 96 0
k61_6474 385 22 0
k61_6475 346 16 0
k61_6476 454 24 0
k61_6477 599 72 0
k61_6478 570 49 0
k61_6479 256 13 0
k61_6480 372 32 0
k61_6481 273 18 0
k61_6482 392 16 0
k61_6483 879 73 0
k61_6484 1206 100 0
k61_6485 622 85 0
k61_6486 376 19 0
k61_6487 209 12 0
k61_6488 209 11 0
k61_6489 277 13 0
k61_6491 211 7 0
k61_6492 456 35 0
k61_6493 1076 116 0
k61_6494 1052 94 0
k61_6495 448 49 0
k61_6496 230 5 0
k61_6497 212 8 0
k61_6498 584 51 0
k61_6499 248 10 0
k61_6500 859 97 0
k61_6501 329 27 0
k61_6502 1000 85 0
k61_6503 232 17 0
k61_6504 1162 134 0
k61_6505 253 27 0
k61_6506 210 7 0
k61_6507 680 43 0
k61_6508 540 49 0
k61_6509 298 18 0
k61_6510 360 23 0
k61_6511 648 41 0
k61_6512 735 61 0
k61_6513 364 36 0
k61_6514 365 27 0
k61_6515 713 59 0
k61_6516 224 13 0
k61_6517 284 18 0
k61_6518 425 36 0
k61_6519 202 12 0
k61_6520 269 17 0
k61_6521 542 52 0
k61_6522 1021 71 0
k61_6523 257 16 0
k61_6525 214 6 0
k61_6526 664 42 0
k61_6527 396 25 0
k61_6530 220 14 0
k61_6532 403 19 0
k61_6533 376 23 0
k61_6534 257 8 0
k61_6535 250 19 0
k61_6537 227 20 0
k61_6538 370 20 0
k61_6539 248 15 0
k61_6540 310 22 0
k61_6541 282 9 0
k61_6542 589 45 0
k61_6543 447 43 0
k61_6544 248 6 0
k61_6545 709 60 0
k61_6546 251 12 0
k61_6547 231 10 0
k61_6548 471 52 0
k61_6549 392 25 0
k61_6550 333 35 0
k61_6551 464 26 0
k61_6552 471 25 0
k61_6553 604 47 0
k61_6555 400 39 0
k61_6556 226 24 0
k61_6557 444 23 0
k61_6559 243 20 0
k61_6560 607 50 0
k61_6561 685 49 0
k61_6563 203 6 0
k61_6564 649 56 0
k61_6565 219 12 0
k61_6566 232 13 0
k61_6567 263 28 0
k61_6568 330 14 0
k61_6569 399 15 0
k61_6570 681 65 0
k61_6571 295 10 0
k61_6572 319 19 0
k61_6573 222 13 0
k61_6574 378 25 0
k61_6575 211 21 0
k61_6576 287 25 0
k61_6577 239 6 0
k61_6578 216 17 0
k61_6579 650 55 0
k61_6581 283 26 0
k61_6582 529 45 0
k61_6583 770 48 0
k61_6584 555 35 0
k61_6585 653 102 0
k61_6586 544 42 0
k61_6588 313 22 0
k61_6589 234 23 0
k61_6590 526 42 0
k61_6591 240 6 0
k61_6592 526 47 0
k61_6593 1110 104 0
k61_6594 367 16 0
k61_6595 349 16 0
k61_6596 248 11 0
k61_6597 473 31 0
k61_6598 406 25 0
k61_6599 634 65 0
k61_6600 368 25 0
k61_6601 1054 124 0
k61_6602 392 32 0
k61_6603 453 43 0
k61_6604 340 28 0
k61_6605 3018 797 0
k61_6606 561 31 0
k61_6607 214 18 0
k61_6608 260 20 0
k61_6609 785 53 0
k61_6610 245 9 0
k61_6612 284 14 0
k61_6613 3069 301 0
k61_6614 360 29 0
k61_6617 327 23 0
k61_6618 343 30 0
k61_6619 889 48 0
k61_6620 542 50 0
k61_6621 275 26 0
k61_6622 426 19 0
k61_6623 537 49 0
k61_6625 231 12 0
k61_6628 582 58 0
k61_6629 784 70 0
k61_6630 203 12 0
k61_6631 435 31 0
k61_6632 344 30 0
k61_6634 496 46 0
k61_6635 338 31 0
k61_6636 350 29 0
k61_6637 225 12 0
k61_6638 259 22 0
k61_6639 347 24 0
k61_6640 1008 92 0
k61_6642 374 36 0
k61_6643 208 13 0
k61_6646 321 25 0
k61_6647 334 26 0
k61_6648 512 38 0
k61_6649 419 36 0
k61_6650 672 48 0
k61_6651 353 15 0
k61_6653 458 39 0
k61_6654 760 75 0
k61_6655 236 15 0
k61_6656 658 54 0
k61_6657 230 7 0
k61_6658 232 7 0
k61_6659 349 14 0
k61_6660 216 11 0
k61_6661 321 14 0
k61_6662 1139 113 0
k61_6664 284 20 0
k61_6665 382 38 0
k61_6666 204 11 0
k61_6667 752 33 0
k61_6668 231 7 0
k61_6669 285 26 0
k61_6670 286 21 0
k61_6671 222 19 0
k61_6672 219 9 0
k61_6673 270 25 0
k61_6674 240 12 0
k61_6675 327 25 0
k61_6676 574 50 0
k61_6677 481 46 0
k61_6678 380 25 0
k61_6679 458 32 0
k61_6680 846 88 0
k61_6681 206 10 0
k61_6682 204 8 0
k61_6684 298 21 0
k61_6687 387 16 0
k61_6688 224 10 0
k61_6689 248 26 0
k61_6690 245 8 0
k61_6691 786 81 0
k61_6692 310 26 0
k61_6693 212 16 0
k61_6694 202 18 0
k61_6695 974 109 0
k61_6696 214 13 0
k61_6697 656 66 0
k61_6698 764 72 0
k61_6700 563 50 0
k61_6701 438 24 0
k61_6702 535 52 0
k61_6704 327 21 0
k61_6705 1601 240 0
k61_6706 640 70 0
k61_6708 301 13 0
k61_6709 796 79 0
k61_6710 220 9 0
k61_6711 378 25 0
k61_6712 387 26 0
k61_6713 611 75 0
k61_6714 523 31 0
k61_6715 491 55 0
k61_6716 427 30 0
k61_6717 465 45 0
k61_6718 282 18 0
k61_6719 798 43 0
k61_6720 215 14 0
k61_6722 361 18 0
k61_6723 1658 185 0
k61_6724 361 27 0
k61_6726 532 40 0
k61_6727 439 31 0
k61_6729 203 9 0
k61_6730 638 50 0
k61_6732 268 16 0
k61_6734 456 45 0
k61_6735 832 55 0
k61_6736 688 56 0
k61_6737 2317 298 0
k61_6738 229 11 0
k61_6739 253 26 0
k61_6740 308 24 0
k61_6741 517 36 0
k61_6742 203 8 0
k61_6743 770 79 0
k61_6744 277 23 0
k61_6745 745 60 0
k61_6746 328 28 0
k61_6747 283 22 0
k61_6748 206 11 0
k61_6749 228 6 0
k61_6750 249 9 0
k61_6751 222 29 0
k61_6753 206 16 0
k61_6754 224 13 0
k61_6755 245 20 0
k61_6756 223 8 0
k61_6757 233 13 0
k61_6758 310 13 0
k61_6759 302 13 0
k61_6760 854 70 0
k61_6761 230 15 0
k61_6763 232 12 0
k61_6764 726 93 0
k61_6766 306 43 0
k61_6767 572 42 0
k61_6768 586 55 0
k61_6769 213 22 0
k61_6770 712 35 0
k61_6771 402 29 0
k61_6772 278 20 0
k61_6773 326 29 0
k61_6774 574 40 0
k61_6775 236 8 0
k61_6776 260 13 0
k61_6777 479 58 0
k61_6778 447 49 0
k61_6779 253 31 0
k61_6780 209 12 0
k61_6781 408 40 0
k61_6782 240 17 0
k61_6783 705 55 0
k61_6784 562 54 0
k61_6785 616 60 0
k61_6786 460 47 0
k61_6788 494 34 0
k61_6789 1707 181 0
k61_6790 448 41 0
k61_6791 276 22 0
k61_6792 507 36 0
k61_6793 1184 98 0
k61_6794 381 23 0
k61_6795 331 26 0
k61_6796 338 31 0
k61_6797 845 69 0
k61_6798 249 17 0
k61_6799 458 28 0
k61_6800 374 28 0
k61_6801 238 11 0
k61_6802 326 19 0
k61_6803 561 46 0
k61_6804 426 53 0
k61_6806 276 31 0
k61_6807 793 58 0
k61_6808 227 13 0
k61_6809 219 10 0
k61_6810 335 30 0
k61_6813 365 27 0
k61_6814 361 27 0
k61_6815 777 61 0
k61_6817 209 8 0
k61_6818 216 12 0
k61_6819 216 14 0
k61_6820 985 65 0
k61_6821 216 15 0
k61_6823 1306 122 0
k61_6824 916 74 0
k61_6825 470 37 0
k61_6826 329 23 0
k61_6827 464 24 0
k61_6828 257 22 0
k61_6829 207 8 0
k61_6830 1347 153 0
k61_6831 285 22 0
k61_6832 420 30 0
k61_6833 275 26 0
k61_6834 399 37 0
k61_6835 1202 109 0
k61_6836 221 11 0
k61_6837 495 37 0
k61_6838 241 8 0
k61_6839 228 25 0
k61_6840 305 31 0
k61_6842 294 16 0
k61_6843 229 20 0
k61_6844 462 38 0
k61_6845 298 13 0
k61_6846 224 18 0
k61_6847 262 12 0
k61_6848 299 20 0
k61_6849 203 9 0
k61_6850 332 19 0
k61_6851 381 32 0
k61_6852 299 29 0
k61_6853 304 20 0
k61_6854 283 14 0
k61_6855 514 33 0
k61_6856 217 21 0
k61_6858 1162 142 0
k61_6859 565 45 0
k61_6860 472 38 0
k61_6861 218 9 0
k61_6863 335 13 0
k61_6864 229 11 0
k61_6865 540 34 0
k61_6866 501 30 0
k61_6867 211 10 0
k61_6868 302 20 0
k61_6869 260 23 0
k61_6870 208 10 0
k61_6872 276 17 0
k61_6873 224 9 0
k61_6874 478 46 0
k61_6875 707 50 0
k61_6876 749 59 0
k61_6877 530 39 0
k61_6878 389 25 0
k61_6880 321 17 0
k61_6881 753 83 0
k61_6882 462 38 0
k61_6883 962 120 0
k61_6885 214 8 0
k61_6886 320 19 0
k61_6889 395 22 0
k61_6890 375 35 0
k61_6891 268 21 0
k61_6892 416 35 0
k61_6893 482 97 0
k61_6894 1291 146 0
k61_6895 242 15 0
k61_6896 209 7 0
k61_6897 328 29 0
k61_6898 210 12 0
k61_6899 955 84 0
k61_6900 233 11 0
k61_6901 805 55 0
k61_6903 1061 92 0
k61_6904 382 28 0
k61_6906 2153 2560 0
k61_6908 242 8 0
k61_6909 353 25 0
k61_6910 348 27 0
k61_6911 507 36 0
k61_6912 434 43 0
k61_6913 280 16 0
k61_6914 382 21 0
k61_6915 495 35 0
k61_6916 443 52 0
k61_6917 536 28 0
k61_6918 222 9 0
k61_6919 381 37 0
k61_6920 346 35 0
k61_6921 251 15 0
k61_6922 384 25 0
k61_6923 229 12 0
k61_6924 281 16 0
k61_6925 878 84 0
k61_6926 1015 105 0
k61_6927 478 90 0
k61_6928 692 423 0
k61_6929 755 42 0
k61_6930 352 29 0
k61_6931 280 24 0
k61_6932 388 23 0
k61_6933 234 9 0
k61_6934 284 30 0
k61_6935 630 58 0
k61_6936 540 48 0
k61_6937 239 12 0
k61_6938 469 27 0
k61_6939 300 20 0
k61_6940 684 71 0
k61_6941 261 27 0
k61_6942 272 18 0
k61_6943 994 91 0
k61_6944 1002 107 0
k61_6945 340 26 0
k61_6946 705 72 0
k61_6947 396 36 0
k61_6948 243 16 0
k61_6949 940 77 0
k61_6950 401 32 0
k61_6951 688 74 0
k61_6952 309 23 0
k61_6953 221 14 0
k61_6954 203 7 0
k61_6955 252 29 0
k61_6956 2366 269 0
k61_6958 375 24 0
k61_6959 874 97 0
k61_6960 214 12 0
k61_6961 744 71 0
k61_6962 541 32 0
k61_6963 687 63 0
k61_6964 278 13 0
k61_6965 210 14 0
k61_6966 240 10 0
k61_6967 740 71 0
k61_6968 251 13 0
k61_6969 238 16 0
k61_6970 498 26 0
k61_6971 715 78 0
k61_6972 1037 115 0
k61_6974 636 53 0
k61_6975 215 12 0
k61_6976 206 7 0
k61_6977 490 33 0
k61_6978 446 33 0
k61_6980 808 101 0
k61_6981 439 25 0
k61_6982 390 31 0
k61_6983 349 22 0
k61_6984 217 9 0
k61_6985 641 48 0
k61_6986 1495 182 0
k61_6987 370 21 0
k61_6988 248 19 0
k61_6989 330 20 0
k61_6990 282 31 0
k61_6991 328 21 0
k61_6992 302 16 0
k61_6993 202 14 0
k61_6994 558 41 0
k61_6995 226 12 0
k61_6997 716 55 0
k61_6998 1595 602 0
k61_6999 317 18 0
k61_7000 361 28 0
k61_7002 283 20 0
k61_7003 695 43 0
k61_7004 508 48 0
k61_7005 211 10 0
k61_7006 1101 110 0
k61_7007 314 33 0
k61_7008 865 56 0
k61_7009 319 18 0
k61_7010 349 18 0
k61_7011 396 39 0
k61_7012 770 73 0
k61_7013 290 14 0
k61_7014 233 15 0
k61_7015 329 24 0
k61_7016 243 16 0
k61_7017 292 16 0
k61_7018 410 46 0
k61_7019 858 1007 0
k61_7021 270 16 0
k61_7022 466 55 0
k61_7023 395 30 0
k61_7024 406 32 0
k61_7025 283 127 0
k61_7026 503 61 0
k61_7027 576 49 0
k61_7028 235 7 0
k61_7029 699 99 0
k61_7030 388 37 0
k61_7031 456 28 0
k61_7032 322 12 0
k61_7033 314 12 0
k61_7034 262 17 0
k61_7037 1433 221 0
k61_7038 817 63 0
k61_7039 372 14 0
k61_7040 212 12 0
k61_7041 233 11 0
k61_7042 210 7 0
k61_7043 228 14 0
k61_7044 427 27 0
k61_7045 212 12 0
k61_7046 274 11 0
k61_7047 673 66 0
k61_7048 538 38 0
k61_7049 359 18 0
k61_7051 334 19 0
k61_7052 339 15 0
k61_7054 582 45 0
k61_7055 393 26 0
k61_7056 392 21 0
k61_7057 284 16 0
k61_7058 717 66 0
k61_7059 814 82 0
k61_7060 245 21 0
k61_7061 242 14 0
k61_7062 1513 134 0
k61_7063 950 86 0
k61_7064 206 16 0
k61_7065 392 20 0
k61_7067 458 23 0
k61_7068 253 22 0
k61_7069 648 59 0
k61_7071 995 79 0
k61_7072 493 49 0
k61_7073 306 27 0
k61_7074 222 10 0
k61_7075 313 23 0
k61_7076 881 63 0
k61_7077 290 13 0
k61_7078 205 5 0
k61_7079 294 20 0
k61_7080 408 48 0
k61_7081 387 26 0
k61_7082 341 25 0
k61_7083 242 21 0
k61_7085 515 35 0
k61_7086 400 21 0
k61_7087 433 26 0
k61_7088 261 12 0
k61_7089 471 29 0
k61_7090 241 5 0
k61_7091 230 8 0
k61_7092 245 5 0
k61_7093 1297 128 0
k61_7095 553 42 0
k61_7096 280 17 0
k61_7097 1047 85 0
k61_7098 375 26 0
k61_7099 712 68 0
k61_7100 276 17 0
k61_7101 244 20 0
k61_7102 244 12 0
k61_7103 320 24 0
k61_7104 339 19 0
k61_7105 998 89 0
k61_7107 776 62 0
k61_7108 329 21 0
k61_7109 1348 116 0
k61_7110 3825 6512 0
k61_7111 323 21 0
k61_7112 592 47 0
k61_7113 433 35 0
k61_7114 1598 175 0
k61_7115 303 26 0
k61_7117 596 45 0
k61_7118 560 50 0
k61_7119 488 56 0
k61_7120 453 38 0
k61_7121 250 13 0
k61_7122 329 21 0
k61_7123 201 14 0
k61_7124 311 13 0
k61_7125 1392 156 0
k61_7126 231 10 0
k61_7127 526 56 0
k61_7128 229 13 0
k61_7129 221 6 0
k61_7130 420 21 0
k61_7131 268 30 0
k61_7132 205 7 0
k61_7133 246 19 0
k61_7134 848 91 0
k61_7135 334 19 0
k61_7136 278 18 0
k61_7138 410 25 0
k61_7139 214 10 0
k61_7140 225 17 0
k61_7141 626 75 0
k61_7142 219 17 0
k61_7144 256 12 0
k61_7145 378 42 0
k61_7146 201 7 0
k61_7147 270 7 0
k61_7148 620 52 0
k61_7149 390 22 0
k61_7150 410 20 0
k61_7151 215 10 0
k61_7152 510 44 0
k61_7153 529 33 0
k61_7154 269 9 0
k61_7155 2528 306 0
k61_7156 272 13 0
k61_7157 432 32 0
k61_7158 536 39 0
k61_7159 526 38 0
k61_7160 441 36 0
k61_7161 936 85 0
k61_7162 259 16 0
k61_7163 585 41 0
k61_7164 2248 248 0
k61_7165 243 12 0
k61_7166 446 45 0
k61_7167 681 75 0
k61_7168 449 45 0
k61_7169 449 51 0
k61_7170 210 12 0
k61_7171 228 6 0
k61_7172 784 75 0
k61_7173 461 38 0
k61_7174 267 20 0
k61_7175 1390 130 0
k61_7176 475 29 0
k61_7178 650 49 0
k61_7179 346 25 0
k61_7180 282 18 0
k61_7181 658 60 0
k61_7182 376 19 0
k61_7183 412 36 0
k61_7184 297 25 0
k61_7185 1365 147 0
k61_7187 334 18 0
k61_7188 661 64 0
k61_7190 396 25 0
k61_7192 741 72 0
k61_7193 218 12 0
k61_7194 253 22 0
k61_7195 664 53 0
k61_7196 512 53 0
k61_7197 230 18 0
k61_7198 224 12 0
k61_7199 241 26 0
k61_7200 450 58 0
k61_7201 208 17 0
k61_7202 807 51 0
k61_7203 1327 133 0
k61_7204 991 109 0
k61_7205 406 35 0
k61_7206 205 7 0
k61_7207 412 34 0
k61_7208 695 53 0
k61_7209 444 34 0
k61_7210 268 18 0
k61_7211 278 9 0
k61_7212 840 68 0
k61_7213 417 36 0
k61_7214 254 28 0
k61_7215 956 90 0
k61_7216 349 27 0
k61_7217 269 15 0
k61_7218 383 30 0
k61_7219 206 10 0
k61_7220 371 32 0
k61_7221 606 43 0
k61_7222 421 32 0
k61_7223 494 43 0
k61_7224 327 24 0
k61_7225 220 12 0
k61_7226 241 15 0
k61_7227 554 54 0
k61_7228 646 43 0
k61_7229 246 14 0
k61_7230 205 7 0
k61_7231 1021 73 0
k61_7232 367 23 0
k61_7233 256 17 0
k61_7234 1705 142 0
k61_7235 272 15 0
k61_7237 335 22 0
k61_7238 385 32 0
k61_7240 207 16 0
k61_7241 255 11 0
k61_7242 551 39 0
k61_7243 532 39 0
k61_7244 853 106 0
k61_7245 267 11 0
k61_7246 463 34 0
k61_7247 366 25 0
k61_7248 264 22 0
k61_7249 216 6 0
k61_7250 637 50 0
k61_7251 482 37 0
k61_7252 1668 158 0
k61_7253 205 19 0
k61_7255 210 24 0
k61_7256 259 15 0
k61_7258 229 20 0
k61_7259 239 9 0
k61_7260 681 57 0
k61_7262 210 12 0
k61_7263 246 16 0
k61_7264 351 29 0
k61_7265 205 11 0
k61_7266 555 41 0
k61_7267 365 39 0
k61_7268 326 27 0
k61_7269 485 47 0
k61_7270 572 48 0
k61_7271 200 8 0
k61_7272 382 28 0
k61_7273 484 55 0
k61_7274 256 25 0
k61_7275 240 16 0
k61_7276 425 29 0
k61_7277 208 8 0
k61_7278 270 17 0
k61_7279 354 25 0
k61_7280 206 8 0
k61_7281 200 13 0
k61_7282 244 9 0
k61_7283 391 35 0
k61_7284 209 17 0
k61_7285 487 30 0
k61_7286 533 45 0
k61_7287 312 30 0
k61_7288 315 26 0
k61_7289 269 21 0
k61_7290 300 15 0
k61_7291 874 77 0
k61_7292 1300 130 0
k61_7293 459 45 0
k61_7295 664 76 0
k61_7296 272 11 0
k61_7298 257 12 0
k61_7299 1319 125 0
k61_7300 446 56 0
k61_7301 220 20 0
k61_7302 923 89 0
k61_7303 323 20 0
k61_7304 227 17 0
k61_7305 658 51 0
k61_7306 1066 102 0
k61_7307 207 20 0
k61_7308 338 15 0
k61_7309 610 60 0
k61_7310 255 19 0
k61_7311 310 24 0
k61_7312 380 29 0
k61_7313 414 16 0
k61_7314 382 15 0
k61_7315 1035 89 0
k61_7316 798 69 0
k61_7317 201 7 0
k61_7318 281 16 0
k61_7319 254 18 0
k61_7320 296 11 0
k61_7321 519 58 0
k61_7322 260 8 0
k61_7323 406 44 0
k61_7324 256 24 0
k61_7325 359 29 0
k61_7326 408 24 0
k61_7328 298 12 0
k61_7329 419 25 0
k61_7330 519 40 0
k61_7331 268 24 0
k61_7332 473 39 0
k61_7334 392 30 0
k61_7335 276 22 0
k61_7337 777 88 0
k61_7338 620 53 0
k61_7339 435 43 0
k61_7340 208 7 0
k61_7341 928 97 0
k61_7343 296 36 0
k61_7344 1135 96 0
k61_7345 327 69 0
k61_7346 246 10 0
k61_7347 501 43 0
k61_7348 379 26 0
k61_7349 525 48 0
k61_7350 203 14 0
k61_7351 361 15 0
k61_7352 223 5 0
k61_7353 357 18 0
k61_7355 252 12 0
k61_7356 251 18 0
k61_7358 227 9 0
k61_7359 255 26 0
k61_7360 352 18 0
k61_7361 375 23 0
k61_7362 209 12 0
k61_7363 1233 108 0
k61_7364 355 31 0
k61_7365 943 74 0
k61_7366 1630 151 0
k61_7367 296 10 0
k61_7368 275 21 0
k61_7369 398 27 0
k61_7371 351 35 0
k61_7372 551 48 0
k61_7374 299 18 0
k61_7375 297 30 0
k61_7376 219 23 0
k61_7377 259 16 0
k61_7378 665 48 0
k61_7379 293 21 0
k61_7380 444 28 0
k61_7381 237 8 0
k61_7382 229 9 0
k61_7383 212 8 0
k61_7384 305 28 0
k61_7385 512 36 0
k61_7386 208 21 0
k61_7387 544 48 0
k61_7388 666 43 0
k61_7389 512 44 0
k61_7391 254 22 0
k61_7392 1007 84 0
k61_7394 229 9 0
k61_7395 1445 164 0
k61_7396 225 16 0
k61_7397 1451 125 0
k61_7398 320 20 0
k61_7399 330 27 0
k61_7400 246 7 0
k61_7401 649 54 0
k61_7402 384 22 0
k61_7403 816 65 0
k61_7405 533 58 0
k61_7407 201 8 0
k61_7408 1215 130 0
k61_7409 318 23 0
k61_7411 291 28 0
k61_7412 200 9 0
k61_7413 674 66 0
k61_7414 651 59 0
k61_7415 299 17 0
k61_7416 753 83 0
k61_7417 261 20 0
k61_7418 592 73 0
k61_7420 245 15 0
k61_7421 203 38 0
k61_7422 428 34 0
k61_7423 281 16 0
k61_7424 578 46 0
k61_7425 201 15 0
k61_7426 225 20 0
k61_7427 556 34 0
k61_7428 271 19 0
k61_7429 348 23 0
k61_7431 214 9 0
k61_7432 579 64 0
k61_7433 229 15 0
k61_7434 272 27 0
k61_7435 2170 219 0
k61_7436 203 6 0
k61_7438 250 8 0
k61_7439 366 20 0
k61_7440 737 55 0
k61_7441 539 40 0
k61_7442 211 14 0
k61_7443 278 14 0
k61_7444 229 19 0
k61_7445 295 15 0
k61_7447 616 32 0
k61_7448 387 31 0
k61_7449 680 52 0
k61_7450 236 22 0
k61_7451 449 32 0
k61_7452 333 28 0
k61_7453 344 19 0
k61_7454 466 42 0
k61_7456 304 15 0
k61_7457 242 15 0
k61_7458 933 102 0
k61_7459 500 56 0
k61_7460 351 22 0
k61_7461 399 25 0
k61_7462 577 51 0
k61_7463 486 32 0
k61_7464 489 41 0
k61_7465 749 62 0
k61_7466 261 18 0
k61_7467 201 10 0
k61_7468 720 67 0
k61_7469 458 32 0
k61_7470 689 45 0
k61_7471 248 9 0
k61_7472 328 17 0
k61_7474 441 86 0
k61_7476 248 35 0
k61_7477 633 56 0
k61_7478 218 10 0
k61_7479 305 16 0
k61_7480 267 26 0
k61_7481 249 7 0
k61_7483 760 64 0
k61_7484 774 57 0
k61_7486 406 31 0
k61_7487 479 21 0
k61_7488 290 16 0
k61_7489 216 8 0
k61_7490 435 26 0
k61_7491 322 25 0
k61_7492 232 9 0
k61_7493 772 69 0
k61_7494 308 20 0
k61_7496 236 11 0
k61_7497 228 23 0
k61_7498 314 13 0
k61_7499 1316 110 0
k61_7500 313 13 0
k61_7502 208 10 0
k61_7503 210 8 0
k61_7504 552 69 0
k61_7505 606 71 0
k61_7506 275 27 0
k61_7507 813 51 0
k61_7508 1460 136 0
k61_7510 210 8 0
k61_7511 265 20 0
k61_7512 533 48 0
k61_7513 220 14 0
k61_7514 403 37 0
k61_7515 223 13 0
k61_7516 508 44 0
k61_7517 302 28 0
k61_7518 427 33 0
k61_7519 465 35 0
k61_7520 245 24 0
k61_7521 779 84 0
k61_7522 1921 215 0
k61_7523 313 27 0
k61_7525 631 73 0
k61_7526 736 47 0
k61_7527 360 18 0
k61_7528 244 9 0
k61_7529 249 17 0
k61_7530 208 9 0
k61_7531 227 7 0
k61_7532 279 27 0
k61_7533 851 69 0
k61_7534 328 16 0
k61_7535 528 45 0
k61_7536 520 53 0
k61_7537 528 32 0
k61_7538 323 15 0
k61_7539 1094 109 0
k61_7540 443 37 0
k61_7541 217 8 0
k61_7542 273 25 0
k61_7543 250 16 0
k61_7544 205 13 0
k61_7545 238 6 0
k61_7546 458 49 0
k61_7547 257 10 0
k61_7548 242 30 0
k61_7549 418 44 0
k61_7550 287 15 0
k61_7551 1147 93 0
k61_7552 299 17 0
k61_7553 221 9 0
k61_7554 206 5 0
k61_7555 221 11 0
k61_7556 1204 129 0
k61_7557 860 92 0
k61_7558 1166 102 0
k61_7559 304 20 0
k61_7560 389 38 0
k61_7561 254 13 0
k61_7562 954 77 0
k61_7563 537 37 0
k61_7564 338 36 0
k61_7566 208 6 0
k61_7567 241 15 0
k61_7568 294 28 0
k61_7569 389 17 0
k61_7570 296 20 0
k61_7571 267 22 0
k61_7572 380 43 0
k61_7573 583 45 0
k61_7574 258 14 0
k61_7575 265 15 0
k61_7577 315 34 0
k61_7579 409 25 0
k61_7580 346 18 0
k61_7581 305 17 0
k61_7583 408 47 0
k61_7584 310 11 0
k61_7585 727 66 0
k61_7586 452 28 0
k61_7588 316 23 0
k61_7589 219 9 0
k61_7591 1268 111 0
k61_7592 248 13 0
k61_7593 359 26 0
k61_7594 225 15 0
k61_7595 956 99 0
k61_7596 243 11 0
k61_7597 4518 1003 0
k61_7598 366 34 0
k61_7599 403 31 0
k61_7600 228 7 0
k61_7601 304 18 0
k61_7602 362 10 0
k61_7603 306 17 0
k61_7604 881 78 0
k61_7605 470 33 0
k61_7606 552 37 0
k61_7608 734 74 0
k61_7609 464 46 0
k61_7610 213 12 0
k61_7611 359 22 0
k61_7612 276 20 0
k61_7613 203 7 0
k61_7615 267 16 0
k61_7616 712 66 0
k61_7617 1929 210 0
k61_7618 278 16 0
k61_7619 460 39 0
k61_7620 390 18 0
k61_7621 908 84 0
k61_7622 315 29 0
k61_7625 388 31 0
k61_7626 630 78 0
k61_7627 505 43 0
k61_7628 299 38 0
k61_7630 201 13 0
k61_7631 388 31 0
k61_7632 501 57 0
k61_7633 253 18 0
k61_7634 321 26 0
k61_7636 916 110 0
k61_7637 255 33 0
k61_7638 308 22 0
k61_7639 422 22 0
k61_7640 330 21 0
k61_7641 210 17 0
k61_7643 289 12 0
k61_7645 416 47 0
k61_7647 458 44 0
k61_7648 218 16 0
k61_7649 412 49 0
k61_7650 947 79 0
k61_7651 259 18 0
k61_7652 350 18 0
k61_7653 250 10 0
k61_7654 684 63 0
k61_7655 215 17 0
k61_7656 584 38 0
k61_7657 205 15 0
k61_7658 245 19 0
k61_7659 226 12 0
k61_7660 204 12 0
k61_7661 200 8 0
k61_7662 662 60 0
k61_7663 291 20 0
k61_7664 322 12 0
k61_7665 404 52 0
k61_7668 246 10 0
k61_7669 376 15 0
k61_7670 701 59 0
k61_7671 1326 112 0
k61_7672 302 16 0
k61_7673 259 10 0
k61_7675 235 9 0
k61_7676 414 31 0
k61_7677 420 34 0
k61_7678 317 13 0
k61_7679 202 8 0
k61_7680 256 12 0
k61_7681 275 21 0
k61_7682 203 15 0
k61_7683 911 110 0
k61_7684 1383 229 0
k61_7685 312 23 0
k61_7686 535 56 0
k61_7687 265 8 0
k61_7688 708 69 0
k61_7689 355 20 0
k61_7690 223 8 0
k61_7691 909 73 0
k61_7692 236 14 0
k61_7693 564 46 0
k61_7694 1569 344 0
k61_7696 209 10 0
k61_7698 216 10 0
k61_7699 215 8 0
k61_7701 414 35 0
k61_7702 317 29 0
k61_7703 1357 157 0
k61_7704 552 58 0
k61_7706 387 21 0
k61_7707 511 37 0
k61_7708 592 38 0
k61_7709 798 94 0
k61_7710 448 30 0
k61_7711 239 20 0
k61_7712 331 25 0
k61_7713 309 17 0
k61_7714 1020 81 0
k61_7715 551 54 0
k61_7717 252 30 0
k61_7718 564 42 0
k61_7719 456 47 0
k61_7720 963 70 0
k61_7721 305 11 0
k61_7722 320 22 0
k61_7723 1237 128 0
k61_7725 314 26 0
k61_7726 308 28 0
k61_7727 235 22 0
k61_7728 253 23 0
k61_7729 624 52 0
k61_7730 220 11 0
k61_7731 394 24 0
k61_7733 401 25 0
k61_7734 292 10 0
k61_7736 372 22 0
k61_7738 497 52 0
k61_7739 404 33 0
k61_7741 390 25 0
k61_7742 204 7 0
k61_7743 352 25 0
k61_7744 206 14 0
k61_7745 354 18 0
k61_7746 262 21 0
k61_7747 448 19 0
k61_7749 426 12 0
k61_7750 571 61 0
k61_7751 720 54 0
k61_7752 291 13 0
k61_7754 454 37 0
k61_7755 615 44 0
k61_7756 410 26 0
k61_7758 221 12 0
k61_7760 1087 80 0
k61_7761 484 39 0
k61_7762 276 18 0
k61_7763 410 24 0
k61_7764 263 25 0
k61_7765 353 20 0
k61_7766 204 6 0
k61_7767 246 12 0
k61_7768 671 72 0
k61_7770 537 43 0
k61_7772 938 107 0
k61_7774 801 47 0
k61_7775 362 46 0
k61_7776 227 20 0
k61_7777 707 52 0
k61_7778 527 40 0
k61_7779 339 15 0
k61_7780 292 12 0
k61_7781 234 13 0
k61_7782 403 22 0
k61_7783 430 32 0
k61_7784 834 86 0
k61_7786 2991 345 0
k61_7787 656 59 0
k61_7788 306 10 0
k61_7790 320 16 0
k61_7791 240 22 0
k61_7793 413 37 0
k61_7794 240 11 0
k61_7796 333 19 0
k61_7799 400 85 0
k61_7800 432 44 0
k61_7801 438 38 0
k61_7802 214 5 0
k61_7803 479 28 0
k61_7804 232 20 0
k61_7805 256 20 0
k61_7806 774 78 0
k61_7807 332 15 0
k61_7808 235 11 0
k61_7809 1199 107 0
k61_7810 796 60 0
k61_7812 896 72 0
k61_7813 212 9 0
k61_7814 237 14 0
k61_7816 221 11 0
k61_7817 239 9 0
k61_7818 346 36 0
k61_7819 355 23 0
k61_7820 418 31 0
k61_7821 362 18 0
k61_7822 253 9 0
k61_7824 316 20 0
k61_7825 471 39 0
k61_7826 205 13 0
k61_7828 295 22 0
k61_7830 736 65 0
k61_7831 1139 73 0
k61_7832 217 14 0
k61_7833 472 45 0
k61_7834 426 49 0
k61_7835 412 38 0
k61_7836 351 21 0
k61_7837 698 60 0
k61_7838 324 24 0
k61_7839 284 21 0
k61_7840 256 23 0
k61_7841 311 20 0
k61_7842 312 31 0
k61_7843 253 9 0
k61_7845 343 19 0
k61_7846 656 49 0
k61_7847 207 11 0
k61_7849 326 29 0
k61_7851 219 18 0
k61_7852 1200 121 0
k61_7853 941 78 0
k61_7854 389 21 0
k61_7855 268 16 0
k61_7856 352 23 0
k61_7857 300 13 0
k61_7858 237 9 0
k61_7859 300 20 0
k61_7860 296 27 0
k61_7861 202 19 0
k61_7862 974 75 0
k61_7863 478 37 0
k61_7865 904 59 0
k61_7866 335 28 0
k61_7867 212 23 0
k61_7868 390 37 0
k61_7869 1385 137 0
k61_7870 275 22 0
k61_7871 365 34 0
k61_7872 863 88 0
k61_7873 277 17 0
k61_7874 838 87 0
k61_7875 317 26 0
k61_7876 308 19 0
k61_7877 974 111 0
k61_7878 494 33 0
k61_7879 264 11 0
k61_7880 238 8 0
k61_7881 229 18 0
k61_7882 1559 122 0
k61_7883 222 11 0
k61_7884 1200 122 0
k61_7885 1043 102 0
k61_7886 601 70 0
k61_7887 240 13 0
k61_7888 368 32 0
k61_7889 340 24 0
k61_7890 256 20 0
k61_7891 256 17 0
k61_7892 2134 283 0
k61_7893 486 42 0
k61_7894 589 41 0
k61_7895 402 39 0
k61_7896 204 25 0
k61_7897 267 15 0
k61_7898 295 15 0
k61_7899 292 15 0
k61_7900 542 45 0
k61_7901 202 10 0
k61_7902 205 8 0
k61_7903 201 7 0
k61_7904 219 17 0
k61_7905 229 12 0
k61_7906 466 36 0
k61_7907 365 33 0
k61_7908 248 24 0
k61_7909 235 16 0
k61_7910 412 36 0
k61_7911 219 35 0
k61_7914 609 57 0
k61_7915 220 11 0
k61_7916 424 30 0
k61_7917 228 12 0
k61_7918 291 26 0
k61_7919 644 59 0
k61_7920 318 20 0
k61_7921 227 13 0
k61_7922 335 18 0
k61_7923 204 5 0
k61_7924 653 64 0
k61_7925 298 25 0
k61_7926 283 21 0
k61_7927 229 9 0
k61_7928 256 21 0
k61_7929 250 20 0
k61_7930 222 12 0
k61_7931 281 17 0
k61_7933 201 9 0
k61_7934 264 23 0
k61_7935 1014 68 0
k61_7936 232 7 0
k61_7937 209 14 0
k61_7939 427 24 0
k61_7940 608 51 0
k61_7941 639 79 0
k61_7942 409 41 0
k61_7943 634 34 0
k61_7944 216 12 0
k61_7945 292 28 0
k61_7946 912 83 0
k61_7947 284 9 0
k61_7948 395 28 0
k61_7949 1484 140 0
k61_7950 775 73 0
k61_7951 255 35 0
k61_7952 301 13 0
k61_7953 284 14 0
k61_7954 334 30 0
k61_7955 444 30 0
k61_7956 290 8 0
k61_7957 276 15 0
k61_7958 327 26 0
k61_7959 430 30 0
k61_7960 553 47 0
k61_7961 759 63 0
k61_7962 343 19 0
k61_7964 242 22 0
k61_7965 412 35 0
k61_7966 494 61 0
k61_7967 285 22 0
k61_7968 267 23 0
k61_7969 277 14 0
k61_7970 351 26 0
k61_7971 208 19 0
k61_7972 203 12 0
k61_7973 402 32 0
k61_7974 464 44 0
k61_7975 273 20 0
k61_7976 269 24 0
k61_7977 383 26 0
k61_7978 306 21 0
k61_7980 243 16 0
k61_7981 494 41 0
k61_7982 276 22 0
k61_7983 234 14 0
k61_7984 352 24 0
k61_7985 899 84 0
k61_7987 417 37 0
k61_7988 353 30 0
k61_7990 646 59 0
k61_7991 279 20 0
k61_7992 385 38 0
k61_7993 492 34 0
k61_7994 1435 144 0
k61_7995 576 50 0
k61_7996 761 51 0
k61_7997 421 36 0
k61_7998 210 8 0
k61_8000 360 37 0
k61_8001 254 11 0
k61_8002 378 52 0
k61_8003 908 79 0
k61_8004 626 58 0
k61_8005 274 24 0
k61_8006 836 71 0
k61_8007 394 34 0
k61_8008 894 72 0
k61_8009 520 44 0
k61_8010 431 42 0
k61_8011 234 15 0
k61_8012 339 16 0
k61_8014 335 39 0
k61_8015 269 22 0
k61_8016 284 10 0
k61_8017 212 10 0
k61_8018 435 33 0
k61_8019 248 14 0
k61_8020 466 29 0
k61_8021 394 23 0
k61_8022 828 108 0
k61_8023 548 41 0
k61_8024 395 22 0
k61_8025 528 42 0
k61_8026 231 7 0
k61_8027 455 35 0
k61_8028 263 9 0
k61_8029 508 45 0
k61_8030 285 13 0
k61_8031 290 17 0
k61_8032 331 12 0
k61_8033 677 61 0
k61_8034 239 11 0
k61_8035 1277 99 0
k61_8036 613 58 0
k61_8037 488 44 0
k61_8038 227 10 0
k61_8039 408 29 0
k61_8040 254 17 0
k61_8041 244 24 0
k61_8042 274 10 0
k61_8043 230 14 0
k61_8044 224 8 0
k61_8045 261 14 0
k61_8046 300 44 0
k61_8047 1172 97 0
k61_8048 337 26 0
k61_8049 1620 190 0
k61_8050 436 26 0
k61_8051 1138 108 0
k61_8052 214 19 0
k61_8053 266 28 0
k61_8054 350 15 0
k61_8055 394 23 0
k61_8058 283 22 0
k61_8059 313 17 0
k61_8060 206 7 0
k61_8061 876 62 0
k61_8062 734 66 0
k61_8064 200 6 0
k61_8065 232 11 0
k61_8067 289 15 0
k61_8069 245 10 0
k61_8070 460 22 0
k61_8073 304 11 0
k61_8074 298 17 0
k61_8075 231 16 0
k61_8076 400 24 0
k61_8077 302 27 0
k61_8078 475 43 0
k61_8079 1256 112 0
k61_8080 224 15 0
k61_8082 309 11 0
k61_8083 677 63 0
k61_8084 900 94 0
k61_8085 332 27 0
k61_8086 378 23 0
k61_8087 280 23 0
k61_8088 328 16 0
k61_8089 1533 138 0
k61_8090 224 7 0
k61_8092 293 15 0
k61_8093 232 12 0
k61_8094 218 18 0
k61_8095 224 7 0
k61_8096 451 50 0
k61_8098 670 58 0
k61_8099 639 66 0
k61_8101 446 33 0
k61_8102 261 14 0
k61_8103 502 46 0
k61_8105 286 17 0
k61_8106 503 65 0
k61_8107 228 6 0
k61_8108 209 8 0
k61_8110 498 40 0
k61_8111 232 12 0
k61_8112 330 19 0
k61_8113 432 31 0
k61_8114 309 25 0
k61_8115 568 52 0
k61_8116 420 25 0
k61_8117 429 17 0
k61_8118 936 72 0
k61_8119 391 29 0
k61_8121 204 10 0
k61_8122 459 33 0
k61_8123 283 15 0
k61_8124 1080 110 0
k61_8125 473 43 0
k61_8128 267 17 0
k61_8129 218 8 0
k61_8130 372 26 0
k61_8131 448 32 0
k61_8132 258 15 0
k61_8133 235 20 0
k61_8134 210 6 0
k61_8135 234 26 0
k61_8136 211 5 0
k61_8137 311 17 0
k61_8138 229 11 0
k61_8139 498 37 0
k61_8140 432 50 0
k61_8141 221 12 0
k61_8142 1001 80 0
k61_8143 1179 100 0
k61_8144 245 10 0
k61_8145 202 9 0
k61_8146 220 8 0
k61_8147 316 28 0
k61_8148 1161 129 0
k61_8149 256 23 0
k61_8152 422 31 0
k61_8153 354 19 0
k61_8154 265 13 0
k61_8155 350 24 0
k61_8156 374 27 0
k61_8157 679 44 0
k61_8158 573 52 0
k61_8159 481 37 0
k61_8160 254 15 0
k61_8161 340 41 0
k61_8162 398 37 0
k61_8163 240 20 0
k61_8164 403 28 0
k61_8165 205 8 0
k61_8166 209 8 0
k61_8167 329 49 0
k61_8168 349 18 0
k61_8169 1310 104 0
k61_8170 277 14 0
k61_8171 203 8 0
k61_8172 438 20 0
k61_8173 206 8 0
k61_8174 238 10 0
k61_8175 569 49 0
k61_8176 401 39 0
k61_8177 339 21 0
k61_8178 251 13 0
k61_8179 405 22 0
k61_8180 222 18 0
k61_8181 257 20 0
k61_8182 286 12 0
k61_8183 460 56 0
k61_8184 293 38 0
k61_8185 322 36 0
k61_8186 313 20 0
k61_8187 501 38 0
k61_8188 373 39 0
k61_8189 462 40 0
k61_8190 331 21 0
k61_8191 559 46 0
k61_8192 551 44 0
k61_8193 414 41 0
k61_8194 419 39 0
k61_8195 220 7 0
k61_8197 252 8 0
k61_8198 1544 147 0
k61_8199 237 16 0
k61_8200 306 20 0
k61_8201 588 46 0
k61_8203 1093 124 0
k61_8204 241 8 0
k61_8205 894 115 0
k61_8206 2130 231 0
k61_8207 214 10 0
k61_8208 316 29 0
k61_8209 375 23 0
k61_8210 426 34 0
k61_8212 266 24 0
k61_8213 235 13 0
k61_8214 1140 123 0
k61_8218 272 19 0
k61_8219 407 32 0
k61_8220 389 32 0
k61_8221 364 137 0
k61_8222 289 32 0
k61_8223 245 16 0
k61_8224 204 23 0
k61_8226 600 40 0
k61_8227 904 77 0
k61_8228 259 17 0
k61_8229 550 63 0
k61_8230 617 65 0
k61_8231 1573 256 0
k61_8232 340 26 0
k61_8234 692 62 0
k61_8236 251 11 0
k61_8237 495 38 0
k61_8238 213 6 0
k61_8239 268 22 0
k61_8240 575 211 0
k61_8241 405 34 0
k61_8242 337 24 0
k61_8243 257 8 0
k61_8244 635 45 0
k61_8245 223 8 0
k61_8246 214 16 0
k61_8247 264 16 0
k61_8248 287 16 0
k61_8249 202 6 0
k61_8250 394 25 0
k61_8252 404 29 0
k61_8253 451 38 0
k61_8254 450 22 0
k61_8255 985 95 0
k61_8256 1025 112 0
k61_8257 234 8 0
k61_8258 211 12 0
k61_8259 556 40 0
k61_8260 207 17 0
k61_8261 212 16 0
k61_8263 329 28 0
k61_8265 2015 232 0
k61_8266 338 15 0
k61_8267 361 29 0
k61_8268 1033 89 0
k61_8269 441 42 0
k61_8270 457 33 0
k61_8271 474 41 0
k61_8272 371 22 0
k61_8273 683 40 0
k61_8274 236 11 0
k61_8275 271 11 0
k61_8276 1059 93 0
k61_8278 211 9 0
k61_8280 320 26 0
k61_8281 349 19 0
k61_8282 240 16 0
k61_8283 711 89 0
k61_8284 1068 105 0
k61_8285 1034 115 0
k61_8286 1544 145 0
k61_8287 7999 4036 0
k61_8288 753 64 0
k61_8289 551 37 0
k61_8290 493 35 0
k61_8291 232 9 0
k61_8292 296 11 0
k61_8293 320 20 0
k61_8294 326 32 0
k61_8295 560 44 0
k61_8296 502 27 0
k61_8297 372 35 0
k61_8299 453 35 0
k61_8300 214 16 0
k61_8301 721 84 0
k61_8302 252 16 0
k61_8303 212 10 0
k61_8304 287 18 0
k61_8305 370 17 0
k61_8306 261 19 0
k61_8307 991 87 0
k61_8308 466 32 0
k61_8309 453 59 0
k61_8310 755 74 0
k61_8311 645 76 0
k61_8312 714 60 0
k61_8314 693 64 0
k61_8315 555 54 0
k61_8316 497 58 0
k61_8317 234 17 0
k61_8318 482 28 0
k61_8319 217 12 0
k61_8320 766 49 0
k61_8321 245 22 0
k61_8322 430 25 0
k61_8324 867 57 0
k61_8325 501 67 0
k61_8326 226 16 0
k61_8327 226 6 0
k61_8328 239 23 0
k61_8329 327 25 0
k61_8330 243 23 0
k61_8331 524 34 0
k61_8332 567 49 0
k61_8333 214 9 0
k61_8334 249 10 0
k61_8335 313 26 0
k61_8336 248 16 0
k61_8337 261 16 0
k61_8338 211 5 0
k61_8339 439 30 0
k61_8340 691 42 0
k61_8341 211 14 0
k61_8342 571 46 0
k61_8343 448 46 0
k61_8345 265 14 0
k61_8346 258 17 0
k61_8347 386 24 0
k61_8348 458 38 0
k61_8350 857 69 0
k61_8351 317 47 0
k61_8352 306 17 0
k61_8353 305 20 0
k61_8354 276 12 0
k61_8355 255 20 0
k61_8356 256 23 0
k61_8357 250 15 0
k61_8358 599 45 0
k61_8359 238 9 0
k61_8360 264 17 0
k61_8361 281 15 0
k61_8362 798 138 0
k61_8363 200 17 0
k61_8364 299 38 0
k61_8365 221 23 0
k61_8366 294 16 0
k61_8367 506 41 0
k61_8368 414 36 0
k61_8369 347 25 0
k61_8370 216 14 0
k61_8371 226 11 0
k61_8372 227 20 0
k61_8373 485 30 0
k61_8374 200 9 0
k61_8375 211 16 0
k61_8376 1198 130 0
k61_8377 218 15 0
k61_8378 235 22 0
k61_8379 932 93 0
k61_8380 864 82 0
k61_8381 228 17 0
k61_8382 576 36 0
k61_8383 311 18 0
k61_8384 426 42 0
k61_8385 433 35 0
k61_8386 478 35 0
k61_8387 291 24 0
k61_8388 737 46 0
k61_8389 559 46 0
k61_8390 298 15 0
k61_8391 211 15 0
k61_8392 208 21 0
k61_8393 335 15 0
k61_8394 927 69 0
k61_8395 511 47 0
k61_8396 227 16 0
k61_8397 350 22 0
k61_8398 396 23 0
k61_8399 241 13 0
k61_8400 244 17 0
k61_8401 230 14 0
k61_8402 618 60 0
k61_8403 596 53 0
k61_8404 775 67 0
k61_8405 1369 160 0
k61_8406 1081 123 0
k61_8407 410 25 0
k61_8408 238 17 0
k61_8409 626 62 0
k61_8410 353 24 0
k61_8411 236 13 0
k61_8412 471 24 0
k61_8413 505 23 0
k61_8414 711 69 0
k61_8415 258 24 0
k61_8416 1186 123 0
k61_8417 978 73 0
k61_8418 214 10 0
k61_8420 605 61 0
k61_8421 324 19 0
k61_8422 401 34 0
k61_8423 723 54 0
k61_8424 545 48 0
k61_8425 485 36 0
k61_8426 354 27 0
k61_8427 312 21 0
k61_8428 492 51 0
k61_8429 555 43 0
k61_8430 472 41 0
k61_8431 258 14 0
k61_8432 302 21 0
k61_8433 315 26 0
k61_8434 253 23 0
k61_8435 392 56 0
k61_8436 278 14 0
k61_8437 207 14 0
k61_8438 589 64 0
k61_8439 531 47 0
k61_8440 247 8 0
k61_8441 201 18 0
k61_8442 1057 80 0
k61_8443 296 14 0
k61_8444 385 36 0
k61_8445 405 21 0
k61_8446 230 15 0
k61_8447 1246 98 0
k61_8448 200 14 0
k61_8449 568 47 0
k61_8450 540 47 0
k61_8452 233 17 0
k61_8454 827 83 0
k61_8455 1247 129 0
k61_8456 468 44 0
k61_8458 583 51 0
k61_8459 200 12 0
k61_8460 460 35 0
k61_8461 357 23 0
k61_8462 942 66 0
k61_8463 343 23 0
k61_8464 426 34 0
k61_8465 410 27 0
k61_8467 202 13 0
k61_8468 930 85 0
k61_8469 349 22 0
k61_8470 381 26 0
k61_8471 302 16 0
k61_8472 552 47 0
k61_8473 258 12 0
k61_8474 337 23 0
k61_8475 245 20 0
k61_8476 219 18 0
k61_8477 265 14 0
k61_8478 462 43 0
k61_8479 436 39 0
k61_8480 223 11 0
k61_8481 509 42 0
k61_8482 538 63 0
k61_8483 489 44 0
k61_8485 231 26 0
k61_8487 388 32 0
k61_8488 248 16 0
k61_8489 217 7 0
k61_8490 707 45 0
k61_8491 491 27 0
k61_8492 204 7 0
k61_8493 214 10 0
k61_8494 446 25 0
k61_8495 352 30 0
k61_8496 228 12 0
k61_8497 616 69 0
k61_8498 283 14 0
k61_8499 1181 101 0
k61_8500 370 33 0
k61_8503 652 56 0
k61_8504 455 28 0
k61_8506 281 19 0
k61_8507 415 41 0
k61_8508 295 15 0
k61_8509 1013 73 0
k61_8510 200 9 0
k61_8511 413 25 0
k61_8513 448 21 0
k61_8514 201 5 0
k61_8515 574 53 0
k61_8516 513 59 0
k61_8517 996 99 0
k61_8518 219 10 0
k61_8519 522 43 0
k61_8520 203 11 0
k61_8521 249 20 0
k61_8522 259 14 0
k61_8523 287 10 0
k61_8524 458 49 0
k61_8525 245 28 0
k61_8526 212 8 0
k61_8527 616 42 0
k61_8528 286 24 0
k61_8529 308 21 0
k61_8530 221 18 0
k61_8531 268 17 0
k61_8532 896 175 0
k61_8533 475 49 0
k61_8534 453 19 0
k61_8536 297 19 0
k61_8537 482 31 0
k61_8538 271 15 0
k61_8539 519 39 0
k61_8540 266 28 0
k61_8541 261 15 0
k61_8542 387 33 0
k61_8543 217 14 0
k61_8544 252 18 0
k61_8545 205 6 0
k61_8546 279 17 0
k61_8547 529 36 0
k61_8548 543 38 0
k61_8549 340 23 0
k61_8550 593 52 0
k61_8551 409 40 0
k61_8552 554 110 0
k61_8553 610 50 0
k61_8554 217 17 0
k61_8555 215 15 0
k61_8556 414 24 0
k61_8558 942 81 0
k61_8559 636 52 0
k61_8560 314 18 0
k61_8561 443 31 0
k61_8562 376 23 0
k61_8563 668 57 0
k61_8564 1599 221 0
k61_8565 430 28 0
k61_8566 283 21 0
k61_8567 629 54 0
k61_8568 385 26 0
k61_8569 365 29 0
k61_8570 763 75 0
k61_8573 469 36 0
k61_8574 486 33 0
k61_8575 247 8 0
k61_8576 285 23 0
k61_8577 459 39 0
k61_8578 219 5 0
k61_8579 278 28 0
k61_8580 402 20 0
k61_8581 284 14 0
k61_8582 296 23 0
k61_8583 211 16 0
k61_8584 307 10 0
k61_8585 527 29 0
k61_8586 298 16 0
k61_8587 835 76 0
k61_8588 513 41 0
k61_8589 259 26 0
k61_8590 681 67 0
k61_8591 262 14 0
k61_8594 259 14 0
k61_8595 410 24 0
k61_8597 779 64 0
k61_8598 209 11 0
k61_8599 215 9 0
k61_8601 271 12 0
k61_8602 367 39 0
k61_8603 336 23 0
k61_8604 758 67 0
k61_8605 212 15 0
k61_8606 202 8 0
k61_8607 215 18 0
k61_8608 274 25 0
k61_8610 231 22 0
k61_8611 202 10 0
k61_8612 794 90 0
k61_8613 361 29 0
k61_8614 836 85 0
k61_8615 296 56 0
k61_8616 384 21 0
k61_8617 233 10 0
k61_8618 281 33 0
k61_8619 346 21 0
k61_8620 273 17 0
k61_8621 723 82 0
k61_8622 247 9 0
k61_8623 204 23 0
k61_8624 477 52 0
k61_8625 246 15 0
k61_8626 210 18 0
k61_8627 212 9 0
k61_8628 349 23 0
k61_8629 395 20 0
k61_8630 979 68 0
k61_8631 228 16 0
k61_8632 219 13 0
k61_8633 1140 88 0
k61_8634 392 34 0
k61_8635 947 95 0
k61_8636 229 11 0
k61_8637 273 28 0
k61_8638 240 25 0
k61_8639 263 18 0
k61_8640 283 15 0
k61_8641 213 12 0
k61_8642 252 12 0
k61_8643 334 39 0
k61_8644 472 31 0
k61_8645 1628 170 0
k61_8646 431 19 0
k61_8647 344 27 0
k61_8648 332 21 0
k61_8649 207 10 0
k61_8650 257 7 0
k61_8651 217 9 0
k61_8652 1437 109 0
k61_8654 277 16 0
k61_8655 577 52 0
k61_8657 384 22 0
k61_8658 517 41 0
k61_8659 284 25 0
k61_8660 362 34 0
k61_8661 296 20 0
k61_8662 339 28 0
k61_8663 263 20 0
k61_8664 292 20 0
k61_8665 256 14 0
k61_8666 231 15 0
k61_8667 1360 148 0
k61_8668 211 12 0
k61_8669 496 40 0
k61_8670 380 23 0
k61_8671 697 76 0
k61_8672 467 41 0
k61_8673 897 103 0
k61_8674 312 27 0
k61_8675 282 31 0
k61_8678 706 66 0
k61_8679 375 29 0
k61_8680 2491 183 0
k61_8681 205 13 0
k61_8682 395 49 0
k61_8683 304 25 0
k61_8684 260 11 0
k61_8685 226 7 0
k61_8686 1020 77 0
k61_8687 334 28 0
k61_8688 231 9 0
k61_8689 642 42 0
k61_8690 329 26 0
k61_8691 389 36 0
k61_8692 372 37 0
k61_8693 570 37 0
k61_8694 225 8 0
k61_8696 757 75 0
k61_8697 266 16 0
k61_8698 443 35 0
k61_8700 624 38 0
k61_8701 879 75 0
k61_8702 418 32 0
k61_8703 300 27 0
k61_8704 379 24 0
k61_8705 406 19 0
k61_8706 695 45 0
k61_8708 358 25 0
k61_8709 1196 89 0
k61_8710 329 21 0
k61_8712 816 70 0
k61_8713 222 9 0
k61_8714 273 14 0
k61_8716 231 11 0
k61_8717 432 25 0
k61_8718 492 39 0
k61_8719 283 11 0
k61_8720 988 97 0
k61_8721 491 33 0
k61_8722 258 12 0
k61_8723 343 12 0
k61_8724 268 19 0
k61_8725 343 15 0
k61_8726 249 7 0
k61_8727 288 24 0
k61_8728 266 26 0
k61_8731 732 50 0
k61_8732 231 8 0
k61_8733 371 28 0
k61_8735 551 55 0
k61_8736 777 66 0
k61_8737 201 10 0
k61_8739 842 80 0
k61_8740 316 21 0
k61_8741 313 9 0
k61_8742 240 11 0
k61_8743 330 27 0
k61_8744 384 38 0
k61_8747 401 40 0
k61_8749 404 31 0
k61_8750 200 9 0
k61_8751 242 19 0
k61_8752 238 16 0
k61_8753 462 26 0
k61_8754 303 15 0
k61_8755 343 24 0
k61_8756 244 12 0
k61_8757 494 38 0
k61_8758 323 17 0
k61_8760 847 69 0
k61_8761 247 21 0
k61_8762 240 11 0
k61_8763 235 16 0
k61_8764 218 16 0
k61_8765 367 26 0
k61_8766 276 17 0
k61_8767 297 20 0
k61_8768 228 10 0
k61_8770 311 28 0
k61_8771 1070 83 0
k61_8772 306 20 0
k61_8773 470 58 0
k61_8774 305 20 0
k61_8775 258 13 0
k61_8776 353 23 0
k61_8778 239 35 0
k61_8780 209 10 0
k61_8781 214 18 0
k61_8782 236 17 0
k61_8783 315 13 0
k61_8784 423 41 0
k61_8785 249 7 0
k61_8786 1065 78 0
k61_8788 433 24 0
k61_8789 284 14 0
k61_8790 500 33 0
k61_8791 220 26 0
k61_8792 320 30 0
k61_8793 474 28 0
k61_8794 1126 129 0
k61_8795 205 5 0
k61_8796 350 27 0
k61_8797 229 13 0
k61_8798 358 19 0
k61_8799 1064 76 0
k61_8800 325 25 0
k61_8801 479 35 0
k61_8802 676 55 0
k61_8803 224 11 0
k61_8804 761 58 0
k61_8805 466 42 0
k61_8806 269 15 0
k61_8807 1181 113 0
k61_8808 333 17 0
k61_8809 223 11 0
k61_8810 379 23 0
k61_8812 822 85 0
k61_8813 1472 368 0
k61_8814 885 93 0
k61_8815 267 21 0
k61_8816 315 24 0
k61_8817 306 28 0
k61_8818 616 46 0
k61_8819 405 59 0
k61_8820 514 29 0
k61_8821 294 13 0
k61_8822 270 14 0
k61_8823 249 20 0
k61_8825 238 14 0
k61_8826 835 81 0
k61_8827 295 22 0
k61_8828 580 40 0
k61_8829 308 12 0
k61_8830 212 17 0
k61_8831 226 6 0
k61_8832 292 22 0
k61_8833 311 21 0
k61_8834 274 15 0
k61_8835 347 30 0
k61_8836 311 13 0
k61_8838 202 11 0
k61_8839 390 25 0
k61_8840 367 17 0
k61_8841 315 16 0
k61_8842 421 22 0
k61_8843 329 24 0
k61_8844 511 43 0
k61_8845 301 20 0
k61_8846 397 19 0
k61_8849 419 24 0
k61_8850 775 55 0
k61_8851 551 39 0
k61_8852 889 69 0
k61_8853 249 8 0
k61_8854 227 20 0
k61_8855 216 14 0
k61_8856 970 90 0
k61_8857 301 15 0
k61_8859 280 12 0
k61_8860 250 15 0
k61_8861 1451 140 0
k61_8862 222 18 0
k61_8863 271 14 0
k61_8864 244 8 0
k61_8865 204 10 0
k61_8866 501 51 0
k61_8867 475 35 0
k61_8868 292 25 0
k61_8869 492 40 0
k61_8871 268 20 0
k61_8872 255 35 0
k61_8873 856 65 0
k61_8874 295 13 0
k61_8875 479 51 0
k61_8876 235 11 0
k61_8877 565 37 0
k61_8878 229 18 0
k61_8879 347 18 0
k61_8880 216 6 0
k61_8881 242 14 0
k61_8882 935 71 0
k61_8883 768 74 0
k61_8884 331 26 0
k61_8886 330 18 0
k61_8887 1030 79 0
k61_8888 380 26 0
k61_8889 988 76 0
k61_8890 488 39 0
k61_8891 2138 254 0
k61_8892 322 21 0
k61_8893 979 88 0
k61_8894 336 23 0
k61_8895 326 24 0
k61_8896 597 54 0
k61_8897 490 34 0
k61_8898 388 31 0
k61_8899 250 18 0
k61_8900 411 31 0
k61_8901 561 55 0
k61_8902 245 10 0
k61_8903 206 5 0
k61_8904 785 73 0
k61_8905 605 78 0
k61_8906 496 40 0
k61_8907 303 13 0
k61_8908 408 23 0
k61_8909 796 95 0
k61_8911 359 31 0
k61_8912 583 294 0
k61_8913 349 26 0
k61_8914 362 22 0
k61_8915 389 42 0
k61_8916 1472 155 0
k61_8917 575 41 0
k61_8918 209 13 0
k61_8919 1245 115 0
k61_8920 435 23 0
k61_8921 202 8 0
k61_8922 359 10 0
k61_8923 345 19 0
k61_8924 737 65 0
k61_8925 642 61 0
k61_8926 399 40 0
k61_8927 235 14 0
k61_8928 1095 179 0
k61_8929 863 58 0
k61_8930 542 39 0
k61_8933 223 11 0
k61_8934 324 25 0
k61_8935 625 41 0
k61_8936 353 20 0
k61_8937 245 22 0
k61_8938 555 49 0
k61_8939 767 61 0
k61_8940 645 52 0
k61_8941 257 13 0
k61_8942 797 71 0
k61_8943 962 83 0
k61_8944 475 33 0
k61_8946 359 21 0
k61_8947 515 44 0
k61_8948 260 19 0
k61_8950 220 15 0
k61_8951 300 11 0
k61_8953 348 16 0
k61_8954 373 32 0
k61_8955 281 9 0
k61_8956 223 10 0
k61_8958 268 19 0
k61_8959 1253 120 0
k61_8960 239 9 0
k61_8961 270 13 0
k61_8962 737 80 0
k61_8963 235 10 0
k61_8964 263 13 0
k61_8965 427 39 0
k61_8966 351 38 0
k61_8967 289 19 0
k61_8968 589 55 0
k61_8969 681 101 0
k61_8970 352 33 0
k61_8971 470 20 0
k61_8972 446 27 0
k61_8974 299 14 0
k61_8975 555 49 0
k61_8976 705 45 0
k61_8977 381 27 0
k61_8978 1099 127 0
k61_8979 706 66 0
k61_8980 289 21 0
k61_8981 561 66 0
k61_8982 292 23 0
k61_8983 563 45 0
k61_8984 674 59 0
k61_8986 497 39 0
k61_8987 260 19 0
k61_8988 258 16 0
k61_8990 205 10 0
k61_8991 1829 197 0
k61_8992 221 8 0
k61_8993 273 20 0
k61_8994 357 29 0
k61_8995 909 87 0
k61_8996 317 22 0
k61_8997 210 10 0
k61_8998 368 32 0
k61_8999 316 28 0
k61_9000 869 69 0
k61_9002 923 77 0
k61_9003 906 73 0
k61_9004 211 10 0
k61_9006 263 15 0
k61_9008 1201 117 0
k61_9009 494 41 0
k61_9010 258 11 0
k61_9011 237 14 0
k61_9012 369 29 0
k61_9013 594 45 0
k61_9014 533 56 0
k61_9015 368 27 0
k61_9016 863 81 0
k61_9017 225 11 0
k61_9018 398 23 0
k61_9019 651 45 0
k61_9020 232 8 0
k61_9021 234 45 0
k61_9024 228 14 0
k61_9025 202 10 0
k61_9026 505 50 0
k61_9027 461 34 0
k61_9028 1026 97 0
k61_9030 446 24 0
k61_9031 584 64 0
k61_9032 392 29 0
k61_9034 584 46 0
k61_9035 309 17 0
k61_9036 210 8 0
k61_9037 717 57 0
k61_9038 351 26 0
k61_9039 448 34 0
k61_9040 400 31 0
k61_9041 244 17 0
k61_9043 201 12 0
k61_9044 378 14 0
k61_9045 620 53 0
k61_9047 991 78 0
k61_9048 213 67 0
k61_9049 888 116 0
k61_9050 215 11 0
k61_9051 226 19 0
k61_9053 795 76 0
k61_9054 640 58 0
k61_9055 272 9 0
k61_9056 241 13 0
k61_9057 301 19 0
k61_9058 241 16 0
k61_9059 640 50 0
k61_9060 213 15 0
k61_9061 450 26 0
k61_9062 268 16 0
k61_9063 503 46 0
k61_9064 539 55 0
k61_9065 236 10 0
k61_9066 222 18 0
k61_9067 220 10 0
k61_9068 249 10 0
k61_9069 326 12 0
k61_9070 497 27 0
k61_9071 283 17 0
k61_9072 658 67 0
k61_9073 1153 110 0
k61_9074 279 9 0
k61_9075 317 16 0
k61_9076 253 19 0
k61_9077 391 24 0
k61_9078 611 52 0
k61_9079 883 79 0
k61_9080 575 55 0
k61_9081 279 16 0
k61_9082 203 9 0
k61_9083 340 13 0
k61_9084 315 33 0
k61_9085 270 10 0
k61_9086 284 11 0
k61_9087 672 44 0
k61_9088 224 11 0
k61_9089 230 10 0
k61_9090 305 17 0
k61_9091 790 60 0
k61_9092 271 17 0
k61_9093 375 22 0
k61_9094 214 8 0
k61_9095 257 14 0
k61_9097 242 23 0
k61_9098 246 16 0
k61_9100 419 46 0
k61_9101 301 15 0
k61_9102 243 9 0
k61_9103 220 9 0
k61_9104 389 53 0
k61_9105 377 24 0
k61_9106 756 71 0
k61_9107 238 13 0
k61_9108 462 29 0
k61_9109 299 13 0
k61_9111 245 21 0
k61_9112 327 17 0
k61_9113 228 26 0
k61_9114 258 34 0
k61_9115 324 18 0
k61_9116 420 47 0
k61_9117 474 36 0
k61_9118 965 118 0
k61_9119 216 6 0
k61_9120 469 42 0
k61_9121 589 55 0
k61_9122 384 28 0
k61_9123 612 57 0
k61_9124 213 9 0
k61_9125 227 11 0
k61_9126 300 30 0
k61_9127 250 21 0
k61_9128 822 61 0
k61_9129 255 13 0
k61_9130 1390 122 0
k61_9131 242 12 0
k61_9132 622 63 0
k61_9133 261 23 0
k61_9135 203 7 0
k61_9136 241 15 0
k61_9137 239 12 0
k61_9138 412 30 0
k61_9139 290 11 0
k61_9140 201 14 0
k61_9141 301 23 0
k61_9142 203 16 0
k61_9143 485 19 0
k61_9144 207 12 0
k61_9145 912 78 0
k61_9146 648 43 0
k61_9147 366 26 0
k61_9148 1007 87 0
k61_9149 241 9 0
k61_9150 213 15 0
k61_9151 214 9 0
k61_9152 302 14 0
k61_9153 232 17 0
k61_9154 254 13 0
k61_9155 399 29 0
k61_9156 230 14 0
k61_9157 229 128 0
k61_9158 450 42 0
k61_9159 349 16 0
k61_9160 937 66 0
k61_9163 372 18 0
k61_9164 243 8 0
k61_9165 281 11 0
k61_9166 424 35 0
k61_9167 2319 499 0
k61_9168 255 9 0
k61_9169 662 52 0
k61_9170 256 17 0
k61_9171 472 37 0
k61_9172 230 16 0
k61_9173 451 42 0
k61_9175 224 12 0
k61_9176 244 17 0
k61_9177 319 12 0
k61_9178 372 22 0
k61_9179 267 15 0
k61_9180 515 42 0
k61_9181 288 19 0
k61_9182 424 44 0
k61_9183 264 17 0
k61_9184 441 40 0
k61_9185 1120 92 0
k61_9186 282 21 0
k61_9187 211 15 0
k61_9188 276 27 0
k61_9189 602 53 0
k61_9190 328 26 0
k61_9191 228 10 0
k61_9192 327 22 0
k61_9193 242 19 0
k61_9194 552 32 0
k61_9196 754 89 0
k61_9197 247 9 0
k61_9198 435 43 0
k61_9199 360 10 0
k61_9200 351 26 0
k61_9201 539 34 0
k61_9202 782 62 0
k61_9203 611 48 0
k61_9204 864 82 0
k61_9205 1039 110 0
k61_9207 328 13 0
k61_9208 610 50 0
k61_9209 399 29 0
k61_9210 244 21 0
k61_9211 367 31 0
k61_9212 235 8 0
k61_9213 402 25 0
k61_9214 200 9 0
k61_9215 257 25 0
k61_9216 471 27 0
k61_9217 552 72 0
k61_9218 293 13 0
k61_9220 907 78 0
k61_9221 248 17 0
k61_9222 297 24 0
k61_9223 560 58 0
k61_9224 234 10 0
k61_9226 811 65 0
k61_9227 860 85 0
k61_9228 235 13 0
k61_9229 295 25 0
k61_9230 734 56 0
k61_9231 304 28 0
k61_9232 1011 89 0
k61_9233 431 45 0
k61_9234 2045 230 0
k61_9236 1071 119 0
k61_9237 858 79 0
k61_9238 251 24 0
k61_9240 238 18 0
k61_9241 343 25 0
k61_9242 374 35 0
k61_9243 251 10 0
k61_9244 277 21 0
k61_9245 378 23 0
k61_9246 231 13 0
k61_9247 518 37 0
k61_9248 274 21 0
k61_9249 376 29 0
k61_9250 203 14 0
k61_9251 320 17 0
k61_9252 832 81 0
k61_9253 229 8 0
k61_9254 539 43 0
k61_9255 376 19 0
k61_9256 244 17 0
k61_9257 757 63 0
k61_9258 351 22 0
k61_9259 380 25 0
k61_9260 213 8 0
k61_9261 309 21 0
k61_9262 368 27 0
k61_9263 202 14 0
k61_9264 912 86 0
k61_9266 1053 120 0
k61_9267 984 78 0
k61_9268 225 12 0
k61_9269 211 6 0
k61_9270 450 32 0
k61_9271 460 36 0
k61_9272 282 18 0
k61_9273 261 23 0
k61_9274 854 100 0
k61_9275 467 46 0
k61_9276 330 19 0
k61_9277 207 9 0
k61_9279 336 25 0
k61_9280 277 9 0
k61_9281 438 25 0
k61_9282 305 19 0
k61_9283 832 73 0
k61_9284 201 15 0
k61_9286 319 25 0
k61_9287 774 51 0
k61_9289 549 55 0
k61_9290 471 41 0
k61_9291 270 23 0
k61_9292 316 21 0
k61_9293 399 27 0
k61_9294 374 26 0
k61_9295 253 13 0
k61_9296 263 26 0
k61_9297 423 22 0
k61_9298 547 60 0
k61_9299 763 91 0
k61_9300 237 10 0
k61_9301 234 17 0
k61_9302 259 12 0
k61_9303 279 45 0
k61_9304 638 73 0
k61_9305 200 9 0
k61_9306 312 24 0
k61_9307 468 30 0
k61_9308 848 70 0
k61_9309 397 26 0
k61_9310 581 50 0
k61_9313 225 8 0
k61_9314 502 49 0
k61_9315 263 10 0
k61_9316 258 9 0
k61_9317 774 60 0
k61_9318 253 13 0
k61_9319 391 26 0
k61_9320 1922 167 0
k61_9321 570 53 0
k61_9323 380 23 0
k61_9324 939 86 0
k61_9325 234 29 0
k61_9326 243 11 0
k61_9327 720 60 0
k61_9328 391 27 0
k61_9329 813 72 0
k61_9330 344 26 0
k61_9331 481 36 0
k61_9332 336 21 0
k61_9333 367 33 0
k61_9334 1117 321 0
k61_9335 338 13 0
k61_9336 638 57 0
k61_9337 256 16 0
k61_9338 392 26 0
k61_9339 668 63 0
k61_9340 259 17 0
k61_9341 265 26 0
k61_9344 587 46 0
k61_9345 247 16 0
k61_9346 795 66 0
k61_9347 250 11 0
k61_9348 215 10 0
k61_9349 1080 116 0
k61_9350 211 20 0
k61_9351 227 16 0
k61_9352 1576 157 0
k61_9353 240 17 0
k61_9354 200 12 0
k61_9355 434 43 0
k61_9356 1015 74 0
k61_9357 231 12 0
k61_9358 558 61 0
k61_9359 483 33 0
k61_9360 1116 167 0
k61_9361 515 44 0
k61_9362 571 49 0
k61_9363 957 82 0
k61_9364 259 16 0
k61_9365 792 55 0
k61_9366 530 35 0
k61_9367 238 18 0
k61_9368 638 57 0
k61_9369 225 7 0
k61_9370 298 17 0
k61_9371 268 18 0
k61_9372 242 12 0
k61_9373 1598 169 0
k61_9374 414 45 0
k61_9375 208 19 0
k61_9377 250 14 0
k61_9378 609 46 0
k61_9380 446 19 0
k61_9381 211 18 0
k61_9382 262 27 0
k61_9383 460 31 0
k61_9385 460 43 0
k61_9386 210 9 0
k61_9387 366 19 0
k61_9388 561 52 0
k61_9389 212 11 0
k61_9390 267 14 0
k61_9391 429 42 0
k61_9392 295 19 0
k61_9393 617 46 0
k61_9394 418 28 0
k61_9395 243 26 0
k61_9396 278 17 0
k61_9397 373 34 0
k61_9398 433 21 0
k61_9399 206 6 0
k61_9400 1125 90 0
k61_9401 580 68 0
k61_9402 1367 100 0
k61_9403 693 49 0
k61_9407 210 22 0
k61_9408 221 19 0
k61_9410 321 28 0
k61_9411 453 23 0
k61_9412 393 30 0
k61_9413 503 47 0
k61_9414 536 43 0
k61_9415 292 17 0
k61_9416 201 7 0
k61_9417 336 26 0
k61_9419 219 16 0
k61_9420 767 79 0
k61_9421 323 19 0
k61_9422 432 33 0
k61_9423 354 28 0
k61_9424 271 13 0
k61_9425 843 87 0
k61_9426 349 20 0
k61_9428 6780 4383 0
k61_9429 565 36 0
k61_9430 568 53 0
k61_9431 246 23 0
k61_9432 1199 113 0
k61_9433 380 36 0
k61_9434 733 68 0
k61_9435 321 29 0
k61_9436 216 4 0
k61_9437 278 22 0
k61_9439 927 87 0
k61_9440 222 19 0
k61_9441 921 113 0
k61_9442 289 13 0
k61_9444 540 47 0
k61_9445 248 12 0
k61_9446 333 27 0
k61_9447 521 19 0
k61_9448 296 22 0
k61_9449 1108 140 0
k61_9450 781 56 0
k61_9451 205 12 0
k61_9452 592 52 0
k61_9453 266 22 0
k61_9454 206 14 0
k61_9455 266 12 0
k61_9456 269 22 0
k61_9457 287 12 0
k61_9458 309 17 0
k61_9459 212 14 0
k61_9460 248 10 0
k61_9461 237 8 0
k61_9462 207 18 0
k61_9463 308 18 0
k61_9465 644 43 0
k61_9466 1212 101 0
k61_9467 282 22 0
k61_9468 298 39 0
k61_9469 346 25 0
k61_9470 436 33 0
k61_9471 225 16 0
k61_9472 567 175 0
k61_9473 228 19 0
k61_9474 294 24 0
k61_9475 268 16 0
k61_9476 245 9 0
k61_9477 610 26 0
k61_9479 270 21 0
k61_9480 252 11 0
k61_9481 456 30 0
k61_9482 249 21 0
k61_9483 249 21 0
k61_9484 220 15 0
k61_9485 318 14 0
k61_9486 594 49 0
k61_9488 260 17 0
k61_9489 857 90 0
k61_9490 346 24 0
k61_9491 339 39 0
k61_9492 215 7 0
k61_9493 288 36 0
k61_9494 245 16 0
k61_9495 601 47 0
k61_9497 261 13 0
k61_9498 306 28 0
k61_9499 374 25 0
k61_9500 466 39 0
k61_9502 437 21 0
k61_9503 495 50 0
k61_9505 481 38 0
k61_9506 687 50 0
k61_9507 463 27 0
k61_9509 538 172 0
k61_9510 319 25 0
k61_9511 824 59 0
k61_9512 610 41 0
k61_9513 244 21 0
k61_9514 261 29 0
k61_9515 246 11 0
k61_9516 214 8 0
k61_9517 508 40 0
k61_9518 947 67 0
k61_9519 356 28 0
k61_9520 302 32 0
k61_9521 835 71 0
k61_9522 256 17 0
k61_9523 405 37 0
k61_9524 279 21 0
k61_9525 287 23 0
k61_9526 901 79 0
k61_9527 290 23 0
k61_9528 432 38 0
k61_9529 654 52 0
k61_9530 376 31 0
k61_9531 248 11 0
k61_9532 202 14 0
k61_9533 273 15 0
k61_9534 255 29 0
k61_9535 665 65 0
k61_9536 295 23 0
k61_9538 220 9 0
k61_9539 500 54 0
k61_9540 226 15 0
k61_9541 840 63 0
k61_9542 370 43 0
k61_9543 280 11 0
k61_9544 242 16 0
k61_9545 285 21 0
k61_9548 326 13 0
k61_9549 238 8 0
k61_9550 645 57 0
k61_9551 281 27 0
k61_9552 1426 153 0
k61_9553 797 78 0
k61_9554 380 26 0
k61_9555 966 79 0
k61_9556 766 81 0
k61_9557 1201 105 0
k61_9558 257 9 0
k61_9560 927 65 0
k61_9561 896 72 0
k61_9562 492 29 0
k61_9563 229 16 0
k61_9564 1988 192 0
k61_9565 418 34 0
k61_9566 303 26 0
k61_9567 289 19 0
k61_9569 497 71 0
k61_9570 589 47 0
k61_9571 302 21 0
k61_9573 204 12 0
k61_9574 636 45 0
k61_9575 284 10 0
k61_9576 1193 94 0
k61_9577 411 24 0
k61_9578 999 138 0
k61_9579 225 14 0
k61_9580 209 6 0
k61_9581 274 19 0
k61_9582 499 29 0
k61_9583 621 65 0
k61_9584 660 43 0
k61_9585 440 45 0
k61_9586 383 13 0
k61_9587 229 11 0
k61_9588 283 20 0
k61_9589 657 55 0
k61_9591 212 13 0
k61_9593 417 33 0
k61_9595 1313 131 0
k61_9596 659 59 0
k61_9597 427 41 0
k61_9598 223 21 0
k61_9599 265 23 0
k61_9600 226 18 0
k61_9603 368 25 0
k61_9604 1795 177 0
k61_9605 316 14 0
k61_9606 311 21 0
k61_9608 307 22 0
k61_9609 207 6 0
k61_9610 220 10 0
k61_9612 221 16 0
k61_9613 401 22 0
k61_9614 241 21 0
k61_9615 275 29 0
k61_9616 209 30 0
k61_9617 210 10 0
k61_9618 301 23 0
k61_9619 700 65 0
k61_9620 268 17 0
k61_9621 694 54 0
k61_9622 304 33 0
k61_9623 358 30 0
k61_9624 225 20 0
k61_9625 236 26 0
k61_9626 306 21 0
k61_9627 430 37 0
k61_9628 355 25 0
k61_9629 228 18 0
k61_9630 420 29 0
k61_9631 230 12 0
k61_9632 212 12 0
k61_9633 402 32 0
k61_9634 269 25 0
k61_9635 280 16 0
k61_9637 297 10 0
k61_9638 204 4 0
k61_9639 202 5 0
k61_9640 471 35 0
k61_9641 475 39 0
k61_9642 327 30 0
k61_9643 671 62 0
k61_9645 1146 122 0
k61_9646 338 15 0
k61_9647 207 12 0
k61_9648 572 47 0
k61_9649 318 24 0
k61_9651 255 12 0
k61_9652 207 12 0
k61_9653 310 10 0
k61_9654 239 17 0
k61_9655 322 16 0
k61_9656 339 15 0
k61_9657 430 55 0
k61_9658 371 24 0
k61_9659 796 77 0
k61_9660 427 37 0
k61_9661 521 54 0
k61_9663 219 8 0
k61_9664 248 9 0
k61_9665 630 45 0
k61_9666 819 63 0
k61_9667 248 13 0
k61_9668 729 62 0
k61_9669 232 9 0
k61_9670 302 10 0
k61_9671 297 19 0
k61_9672 544 70 0
k61_9673 443 29 0
k61_9674 7406 9872 0
k61_9676 273 13 0
k61_9677 266 8 0
k61_9678 220 7 0
k61_9679 503 67 0
k61_9680 928 74 0
k61_9681 208 9 0
k61_9682 260 16 0
k61_9683 404 37 0
k61_9684 461 34 0
k61_9685 408 32 0
k61_9688 224 5 0
k61_9689 204 10 0
k61_9690 274 15 0
k61_9691 1686 171 0
k61_9692 358 39 0
k61_9693 214 9 0
k61_9694 320 16 0
k61_9695 634 58 0
k61_9696 206 16 0
k61_9697 309 38 0
k61_9698 1146 122 0
k61_9699 374 55 0
k61_9704 438 17 0
k61_9707 725 65 0
k61_9708 508 52 0
k61_9709 389 21 0
k61_9710 480 52 0
k61_9711 479 31 0
k61_9712 294 21 0
k61_9713 352 15 0
k61_9714 215 7 0
k61_9715 433 33 0
k61_9716 910 97 0
k61_9717 1774 190 0
k61_9718 206 12 0
k61_9719 274 15 0
k61_9720 247 8 0
k61_9721 721 78 0
k61_9722 482 32 0
k61_9723 545 39 0
k61_9724 1913 200 0
k61_9725 394 35 0
k61_9726 226 13 0
k61_9727 269 21 0
k61_9728 210 11 0
k61_9729 308 22 0
k61_9730 431 39 0
k61_9731 285 13 0
k61_9732 202 13 0
k61_9733 835 73 0
k61_9734 730 43 0
k61_9735 2311 245 0
k61_9736 222 8 0
k61_9737 875 95 0
k61_9738 280 15 0
k61_9739 1609 166 0
k61_9740 270 19 0
k61_9741 256 13 0
k61_9742 209 14 0
k61_9743 317 32 0
k61_9744 291 16 0
k61_9745 514 34 0
k61_9746 697 81 0
k61_9748 280 22 0
k61_9749 360 17 0
k61_9751 238 11 0
k61_9752 300 15 0
k61_9753 376 21 0
k61_9754 1302 93 0
k61_9757 240 10 0
k61_9758 701 54 0
k61_9760 753 56 0
k61_9761 213 13 0
k61_9762 1224 124 0
k61_9763 449 42 0
k61_9764 1437 145 0
k61_9765 229 13 0
k61_9767 300 17 0
k61_9768 240 23 0
k61_9769 375 44 0
k61_9770 228 13 0
k61_9771 414 42 0
k61_9772 343 34 0
k61_9774 925 91 0
k61_9775 435 43 0
k61_9776 356 30 0
k61_9777 239 10 0
k61_9778 242 9 0
k61_9779 316 11 0
k61_9780 261 10 0
k61_9781 426 32 0
k61_9783 219 20 0
k61_9784 682 60 0
k61_9785 249 11 0
k61_9786 660 67 0
k61_9787 371 23 0
k61_9788 254 10 0
k61_9789 325 24 0
k61_9790 400 17 0
k61_9791 1252 102 0
k61_9792 232 19 0
k61_9794 449 59 0
k61_9797 248 15 0
k61_9798 219 18 0
k61_9799 725 60 0
k61_9801 372 23 0
k61_9802 206 9 0
k61_9803 545 50 0
k61_9804 432 36 0
k61_9805 287 25 0
k61_9806 627 82 0
k61_9807 358 30 0
k61_9808 278 9 0
k61_9809 229 13 0
k61_9810 247 12 0
k61_9811 321 25 0
k61_9812 602 46 0
k61_9813 230 13 0
k61_9814 247 8 0
k61_9815 506 31 0
k61_9816 428 36 0
k61_9817 1121 110 0
k61_9818 233 13 0
k61_9819 303 12 0
k61_9820 721 61 0
k61_9821 358 25 0
k61_9822 462 46 0
k61_9823 835 85 0
k61_9824 421 31 0
k61_9825 319 21 0
k61_9826 412 33 0
k61_9827 448 33 0
k61_9828 906 79 0
k61_9829 208 8 0
k61_9830 309 33 0
k61_9831 272 16 0
k61_9832 213 9 0
k61_9833 713 49 0
k61_9835 455 45 0
k61_9836 1272 143 0
k61_9837 448 65 0
k61_9838 275 18 0
k61_9839 325 32 0
k61_9840 353 17 0
k61_9841 631 57 0
k61_9842 1087 104 0
k61_9843 1289 128 0
k61_9844 201 9 0
k61_9845 211 10 0
k61_9846 228 5 0
k61_9847 351 26 0
k61_9848 1442 121 0
k61_9849 552 49 0
k61_9850 285 11 0
k61_9851 1039 96 0
k61_9854 976 118 0
k61_9855 291 12 0
k61_9856 292 14 0
k61_9857 314 28 0
k61_9858 278 15 0
k61_9860 733 54 0
k61_9862 223 7 0
k61_9863 222 18 0
k61_9864 861 105 0
k61_9867 939 120 0
k61_9868 735 62 0
k61_9869 385 27 0
k61_9870 401 38 0
k61_9872 328 19 0
k61_9873 261 12 0
k61_9874 391 34 0
k61_9875 1082 86 0
k61_9876 1056 103 0
k61_9878 1764 213 0
k61_9879 293 8 0
k61_9880 215 7 0
k61_9881 432 33 0
k61_9882 490 45 0
k61_9883 528 31 0
k61_9884 209 10 0
k61_9885 1061 122 0
k61_9886 458 50 0
k61_9887 202 8 0
k61_9888 324 31 0
k61_9889 355 25 0
k61_9890 272 10 0
k61_9891 359 18 0
k61_9893 227 10 0
k61_9894 435 21 0
k61_9896 269 13 0
k61_9897 389 18 0
k61_9898 214 24 0
k61_9900 707 55 0
k61_9901 588 40 0
k61_9902 211 15 0
k61_9904 249 13 0
k61_9905 216 10 0
k61_9906 431 38 0
k61_9907 700 63 0
k61_9908 223 14 0
k61_9909 488 42 0
k61_9910 354 45 0
k61_9911 208 9 0
k61_9912 443 28 0
k61_9913 482 42 0
k61_9914 305 31 0
k61_9915 200 9 0
k61_9916 441 31 0
k61_9917 374 24 0
k61_9918 474 46 0
k61_9920 643 80 0
k61_9921 349 27 0
k61_9922 791 63 0
k61_9923 334 16 0
k61_9924 201 9 0
k61_9925 404 19 0
k61_9926 500 45 0
k61_9927 215 7 0
k61_9928 502 41 0
k61_9929 350 24 0
k61_9930 346 21 0
k61_9931 241 16 0
k61_9932 218 9 0
k61_9933 275 24 0
k61_9934 2163 256 0
k61_9935 1158 131 0
k61_9936 306 28 0
k61_9937 220 10 0
k61_9938 314 23 0
k61_9939 312 25 0
k61_9940 306 14 0
k61_9942 294 20 0
k61_9943 303 14 0
k61_9944 345 14 0
k61_9945 241 11 0
k61_9946 363 50 0
k61_9947 418 35 0
k61_9948 292 20 0
k61_9949 214 8 0
k61_9950 218 13 0
k61_9951 598 58 0
k61_9952 238 17 0
k61_9953 243 16 0
k61_9954 673 56 0
k61_9955 1070 135 0
k61_9956 600 69 0
k61_9957 630 68 0
k61_9958 909 111 0
k61_9959 299 8 0
k61_9960 281 27 0
k61_9961 597 32 0
k61_9962 842 70 0
k61_9963 384 38 0
k61_9964 250 24 0
k61_9965 217 10 0
k61_9966 207 10 0
k61_9967 232 7 0
k61_9968 564 72 0
k61_9969 371 29 0
k61_9970 282 23 0
k61_9971 279 13 0
k61_9972 287 14 0
k61_9973 209 12 0
k61_9974 1796 170 0
k61_9975 380 24 0
k61_9977 439 32 0
k61_9978 204 8 0
k61_9979 269 11 0
k61_9980 778 68 0
k61_9981 461 46 0
k61_9982 367 22 0
k61_9983 231 15 0
k61_9984 394 38 0
k61_9985 253 15 0
k61_9986 494 45 0
k61_9987 907 74 0
k61_9988 468 50 0
k61_9989 210 14 0
k61_9990 246 13 0
k61_9991 332 16 0
k61_9992 409 30 0
k61_9993 339 20 0
k61_9994 403 33 0
k61_9997 1130 91 0
k61_9998 255 10 0
k61_9999 519 40 0
k61_10000 215 19 0
k61_10001 667 45 0
k61_10002 657 53 0
k61_10003 1156 92 0
k61_10004 235 10 0
k61_10005 451 41 0
k61_10006 308 14 0
k61_10007 258 11 0
k61_10008 1372 122 0
k61_10009 252 14 0
k61_10010 454 40 0
k61_10011 387 20 0
k61_10013 287 22 0
k61_10014 509 48 0
k61_10015 338 21 0
k61_10016 792 59 0
k61_10017 400 29 0
k61_10018 435 21 0
k61_10020 731 79 0
k61_10021 393 31 0
k61_10022 261 8 0
k61_10023 1075 120 0
k61_10026 212 5 0
k61_10027 709 71 0
k61_10029 271 15 0
k61_10030 287 32 0
k61_10031 258 16 0
k61_10032 271 10 0
k61_10033 638 53 0
k61_10034 323 12 0
k61_10035 577 43 0
k61_10036 294 25 0
k61_10037 352 19 0
k61_10038 888 75 0
k61_10039 701 60 0
k61_10040 257 12 0
k61_10042 290 23 0
k61_10043 340 22 0
k61_10044 436 29 0
k61_10045 235 14 0
k61_10046 243 11 0
k61_10047 314 34 0
k61_10048 284 32 0
k61_10049 210 8 0
k61_10050 765 79 0
k61_10051 1335 149 0
k61_10052 233 14 0
k61_10053 444 45 0
k61_10054 202 10 0
k61_10055 818 45 0
k61_10056 227 16 0
k61_10057 365 41 0
k61_10058 220 8 0
k61_10059 384 35 0
k61_10060 220 20 0
k61_10062 299 25 0
k61_10064 1427 131 0
k61_10065 1869 200 0
k61_10067 970 109 0
k61_10068 246 11 0
k61_10069 253 17 0
k61_10070 205 14 0
k61_10071 217 8 0
k61_10072 558 37 0
k61_10073 800 67 0
k61_10074 337 28 0
k61_10075 239 15 0
k61_10076 439 50 0
k61_10077 398 26 0
k61_10078 341 24 0
k61_10079 380 38 0
k61_10080 271 14 0
k61_10081 2129 195 0
k61_10082 578 51 0
k61_10083 286 24 0
k61_10084 1468 123 0
k61_10085 221 14 0
k61_10086 378 26 0
k61_10087 237 15 0
k61_10090 1097 101 0
k61_10091 604 64 0
k61_10093 261 14 0
k61_10094 294 22 0
k61_10095 1126 245 0
k61_10096 259 12 0
k61_10097 207 8 0
k61_10098 869 75 0
k61_10099 410 33 0
k61_10100 300 14 0
k61_10101 207 6 0
k61_10105 1570 145 0
k61_10106 223 8 0
k61_10107 486 40 0
k61_10108 301 25 0
k61_10109 349 22 0
k61_10110 330 25 0
k61_10111 404 26 0
k61_10112 383 27 0
k61_10113 385 13 0
k61_10114 433 23 0
k61_10115 276 9 0
k61_10116 497 41 0
k61_10117 637 52 0
k61_10118 288 12 0
k61_10119 225 18 0
k61_10120 241 10 0
k61_10121 415 20 0
k61_10123 399 19 0
k61_10124 392 24 0
k61_10125 306 21 0
k61_10126 204 15 0
k61_10127 248 21 0
k61_10128 229 9 0
k61_10130 747 53 0
k61_10131 411 19 0
k61_10132 1028 99 0
k61_10133 391 20 0
k61_10134 464 32 0
k61_10135 353 34 0
k61_10136 488 27 0
k61_10137 573 63 0
k61_10138 201 6 0
k61_10139 855 63 0
k61_10140 213 11 0
k61_10141 299 36 0
k61_10142 282 19 0
k61_10143 293 19 0
k61_10144 248 9 0
k61_10145 582 66 0
k61_10146 395 29 0
k61_10147 373 30 0
k61_10148 260 29 0
k61_10150 1050 100 0
k61_10151 244 12 0
k61_10152 505 38 0
k61_10153 379 33 0
k61_10155 246 18 0
k61_10156 272 11 0
k61_10157 229 9 0
k61_10158 204 7 0
k61_10159 259 17 0
k61_10160 239 11 0
k61_10163 256 10 0
k61_10164 232 7 0
k61_10165 470 53 0
k61_10166 403 34 0
k61_10168 733 65 0
k61_10169 640 52 0
k61_10170 272 8 0
k61_10171 246 20 0
k61_10172 245 9 0
k61_10173 473 37 0
k61_10174 208 10 0
k61_10175 491 28 0
k61_10177 392 27 0
k61_10178 573 36 0
k61_10179 239 18 0
k61_10180 308 25 0
k61_10181 911 98 0
k61_10182 395 26 0
k61_10183 215 19 0
k61_10184 660 61 0
k61_10185 341 16 0
k61_10186 387 20 0
k61_10187 493 193 0
k61_10188 1962 197 0
k61_10189 263 16 0
k61_10190 275 13 0
k61_10191 424 31 0
k61_10192 200 8 0
k61_10193 533 39 0
k61_10194 356 31 0
k61_10195 450 39 0
k61_10196 221 11 0
k61_10197 231 7 0
k61_10198 289 21 0
k61_10199 202 15 0
k61_10200 232 16 0
k61_10202 859 78 0
k61_10203 365 40 0
k61_10204 204 14 0
k61_10205 201 10 0
k61_10206 228 10 0
k61_10207 226 25 0
k61_10208 269 32 0
k61_10209 320 16 0
k61_10210 283 29 0
k61_10211 354 38 0
k61_10213 213 15 0
k61_10214 302 15 0
k61_10215 457 42 0
k61_10216 418 17 0
k61_10217 211 8 0
k61_10218 588 50 0
k61_10219 372 27 0
k61_10220 215 10 0
k61_10221 677 56 0
k61_10222 1097 100 0
k61_10223 244 13 0
k61_10224 305 21 0
k61_10225 391 30 0
k61_10226 2192 223 0
k61_10227 814 93 0
k61_10228 621 63 0
k61_10229 417 26 0
k61_10230 232 10 0
k61_10231 718 61 0
k61_10232 662 60 0
k61_10233 1993 228 0
k61_10234 870 84 0
k61_10235 224 10 0
k61_10236 340 16 0
k61_10237 258 7 0
k61_10238 410 25 0
k61_10239 277 28 0
k61_10240 847 103 0
k61_10241 216 27 0
k61_10242 590 48 0
k61_10243 300 17 0
k61_10244 201 9 0
k61_10245 688 84 0
k61_10247 477 35 0
k61_10248 944 100 0
k61_10249 687 42 0
k61_10250 1061 111 0
k61_10252 209 12 0
k61_10253 264 24 0
k61_10254 404 38 0
k61_10255 228 12 0
k61_10256 958 86 0
k61_10257 405 31 0
k61_10258 306 24 0
k61_10260 237 19 0
k61_10261 392 35 0
k61_10262 992 88 0
k61_10263 1235 96 0
k61_10264 247 17 0
k61_10265 602 63 0
k61_10266 456 35 0
k61_10267 402 16 0
k61_10268 288 17 0
k61_10270 683 64 0
k61_10272 204 7 0
k61_10273 250 11 0
k61_10274 335 17 0
k61_10275 329 28 0
k61_10276 677 60 0
k61_10277 394 28 0
k61_10278 430 52 0
k61_10279 455 38 0
k61_10280 423 33 0
k61_10281 273 24 0
k61_10282 210 13 0
k61_10283 255 10 0
k61_10284 564 42 0
k61_10285 500 51 0
k61_10286 486 24 0
k61_10287 268 17 0
k61_10288 332 45 0
k61_10289 292 12 0
k61_10290 231 12 0
k61_10291 411 17 0
k61_10292 419 27 0
k61_10293 788 98 0
k61_10295 1101 106 0
k61_10298 210 7 0
k61_10299 582 57 0
k61_10300 905 69 0
k61_10302 555 49 0
k61_10303 219 19 0
k61_10305 315 24 0
k61_10306 412 42 0
k61_10307 991 70 0
k61_10308 256 7 0
k61_10309 971 79 0
k61_10310 240 10 0
k61_10311 549 81 0
k61_10312 211 12 0
k61_10313 394 44 0
k61_10314 374 40 0
k61_10315 235 8 0
k61_10316 239 11 0
k61_10317 212 6 0
k61_10319 767 103 0
k61_10321 205 7 0
k61_10322 561 48 0
k61_10323 365 28 0
k61_10324 334 34 0
k61_10325 576 50 0
k61_10327 618 36 0
k61_10328 1192 144 0
k61_10329 270 10 0
k61_10330 322 14 0
k61_10331 275 12 0
k61_10333 265 12 0
k61_10334 344 17 0
k61_10335 224 11 0
k61_10336 280 26 0
k61_10337 209 11 0
k61_10338 239 13 0
k61_10339 208 8 0
k61_10340 232 29 0
k61_10341 902 74 0
k61_10342 836 68 0
k61_10343 284 15 0
k61_10344 268 9 0
k61_10345 293 37 0
k61_10346 346 31 0
k61_10348 220 13 0
k61_10349 227 20 0
k61_10350 441 46 0
k61_10351 395 39 0
k61_10352 331 21 0
k61_10354 823 72 0
k61_10355 249 22 0
k61_10356 284 19 0
k61_10357 985 81 0
k61_10358 501 42 0
k61_10359 290 19 0
k61_10360 324 27 0
k61_10361 421 26 0
k61_10362 217 6 0
k61_10363 382 22 0
k61_10364 1316 135 0
k61_10365 880 78 0
k61_10368 217 5 0
k61_10369 332 20 0
k61_10371 379 27 0
k61_10372 362 21 0
k61_10373 434 48 0
k61_10374 279 13 0
k61_10376 206 7 0
k61_10377 384 32 0
k61_10378 228 10 0
k61_10379 308 16 0
k61_10380 640 57 0
k61_10382 221 12 0
k61_10383 494 29 0
k61_10384 528 33 0
k61_10385 244 12 0
k61_10386 411 17 0
k61_10388 354 37 0
k61_10389 485 50 0
k61_10390 234 13 0
k61_10391 687 52 0
k61_10392 571 55 0
k61_10393 698 53 0
k61_10394 294 15 0
k61_10395 229 12 0
k61_10397 334 24 0
k61_10398 302 23 0
k61_10399 491 40 0
k61_10400 455 29 0
k61_10401 303 30 0
k61_10402 490 43 0
k61_10403 460 19 0
k61_10404 565 32 0
k61_10405 247 11 0
k61_10406 499 36 0
k61_10408 244 11 0
k61_10409 290 34 0
k61_10410 213 9 0
k61_10411 473 41 0
k61_10412 262 11 0
k61_10413 336 29 0
k61_10415 257 13 0
k61_10416 286 17 0
k61_10417 216 6 0
k61_10418 474 33 0
k61_10420 281 24 0
k61_10421 538 53 0
k61_10422 628 39 0
k61_10423 374 15 0
k61_10424 599 71 0
k61_10425 694 70 0
k61_10426 497 43 0
k61_10427 416 27 0
k61_10428 207 5 0
k61_10429 260 15 0
k61_10430 321 22 0
k61_10431 245 12 0
k61_10432 267 15 0
k61_10433 281 17 0
k61_10434 241 21 0
k61_10435 230 10 0
k61_10436 315 14 0
k61_10437 457 52 0
k61_10438 257 15 0
k61_10439 323 27 0
k61_10440 587 54 0
k61_10441 462 43 0
k61_10442 224 6 0
k61_10444 462 39 0
k61_10446 451 39 0
k61_10447 348 34 0
k61_10449 464 20 0
k61_10450 485 38 0
k61_10451 253 19 0
k61_10453 1106 101 0
k61_10454 413 24 0
k61_10455 265 16 0
k61_10456 403 12 0
k61_10460 274 11 0
k61_10461 451 22 0
k61_10462 222 9 0
k61_10463 438 30 0
k61_10464 741 61 0
k61_10465 204 9 0
k61_10466 210 11 0
k61_10467 483 52 0
k61_10468 473 52 0
k61_10469 679 66 0
k61_10470 543 47 0
k61_10471 236 12 0
k61_10472 202 7 0
k61_10473 254 17 0
k61_10474 1122 90 0
k61_10475 265 21 0
k61_10476 205 7 0
k61_10477 281 11 0
k61_10478 267 7 0
k61_10479 322 35 0
k61_10481 505 46 0
k61_10483 430 38 0
k61_10484 1336 129 0
k61_10485 260 12 0
k61_10486 814 82 0
k61_10487 429 37 0
k61_10488 258 10 0
k61_10489 254 10 0
k61_10490 283 10 0
k61_10492 813 64 0
k61_10493 533 58 0
k61_10495 327 20 0
k61_10496 207 7 0
k61_10497 1440 140 0
k61_10498 693 63 0
k61_10499 346 17 0
k61_10500 534 33 0
k61_10501 600 45 0
k61_10502 380 30 0
k61_10503 402 51 0
k61_10504 295 12 0
k61_10505 383 38 0
k61_10506 434 36 0
k61_10507 694 59 0
k61_10508 1133 115 0
k61_10509 632 46 0
k61_10510 207 6 0
k61_10511 321 17 0
k61_10513 239 19 0
k61_10514 336 32 0
k61_10515 212 8 0
k61_10516 312 21 0
k61_10518 337 16 0
k61_10519 616 46 0
k61_10520 347 23 0
k61_10521 254 21 0
k61_10522 232 17 0
k61_10523 795 70 0
k61_10524 368 32 0
k61_10525 535 33 0
k61_10526 337 18 0
k61_10527 578 49 0
k61_10528 409 26 0
k61_10529 223 18 0
k61_10531 260 22 0
k61_10532 684 73 0
k61_10533 351 22 0
k61_10534 378 20 0
k61_10535 225 26 0
k61_10536 387 33 0
k61_10537 1290 125 0
k61_10538 459 18 0
k61_10539 285 26 0
k61_10540 391 35 0
k61_10541 466 43 0
k61_10543 223 9 0
k61_10544 270 20 0
k61_10545 397 31 0
k61_10546 718 68 0
k61_10547 280 20 0
k61_10548 499 43 0
k61_10549 304 15 0
k61_10550 259 16 0
k61_10551 394 25 0
k61_10552 208 7 0
k61_10553 2097 240 0
k61_10554 269 24 0
k61_10555 274 23 0
k61_10556 206 16 0
k61_10557 446 20 0
k61_10558 496 38 0
k61_10559 263 23 0
k61_10560 365 19 0
k61_10561 204 5 0
k61_10562 1032 85 0
k61_10563 715 63 0
k61_10564 786 63 0
k61_10565 276 13 0
k61_10566 265 17 0
k61_10567 420 34 0
k61_10568 450 29 0
k61_10569 244 16 0
k61_10570 436 27 0
k61_10571 460 34 0
k61_10572 454 54 0
k61_10573 609 63 0
k61_10574 1002 72 0
k61_10575 622 52 0
k61_10576 535 49 0
k61_10577 313 22 0
k61_10578 2678 271 0
k61_10579 964 63 0
k61_10580 210 18 0
k61_10581 951 65 0
k61_10582 261 17 0
k61_10583 941 115 0
k61_10584 303 12 0
k61_10585 282 11 0
k61_10586 279 20 0
k61_10587 250 14 0
k61_10588 258 20 0
k61_10590 769 76 0
k61_10591 698 65 0
k61_10592 267 17 0
k61_10593 277 23 0
k61_10594 388 24 0
k61_10595 501 40 0
k61_10596 454 47 0
k61_10597 907 79 0
k61_10598 1119 98 0
k61_10599 200 12 0
k61_10600 465 48 0
k61_10601 516 45 0
k61_10602 569 52 0
k61_10603 287 14 0
k61_10604 548 44 0
k61_10605 774 41 0
k61_10606 224 17 0
k61_10607 291 15 0
k61_10608 250 18 0
k61_10609 561 55 0
k61_10610 342 31 0
k61_10613 283 11 0
k61_10615 397 28 0
k61_10617 715 69 0
k61_10618 308 15 0
k61_10619 371 22 0
k61_10621 386 36 0
k61_10622 275 15 0
k61_10623 220 13 0
k61_10624 375 42 0
k61_10625 238 13 0
k61_10626 306 27 0
k61_10627 604 48 0
k61_10628 358 31 0
k61_10629 244 18 0
k61_10630 285 26 0
k61_10631 373 33 0
k61_10632 1326 125 0
k61_10633 804 67 0
k61_10634 281 14 0
k61_10635 535 37 0
k61_10636 441 32 0
k61_10637 246 14 0
k61_10638 326 24 0
k61_10639 331 31 0
k61_10640 347 17 0
k61_10641 353 24 0
k61_10642 1403 118 0
k61_10643 340 28 0
k61_10644 305 25 0
k61_10645 472 22 0
k61_10646 263 22 0
k61_10647 238 13 0
k61_10648 217 13 0
k61_10649 355 19 0
k61_10650 305 10 0
k61_10651 237 13 0
k61_10652 362 21 0
k61_10655 202 9 0
k61_10656 708 126 0
k61_10657 209 6 0
k61_10658 483 48 0
k61_10659 694 52 0
k61_10660 296 14 0
k61_10661 232 15 0
k61_10662 208 12 0
k61_10663 855 56 0
k61_10664 737 58 0
k61_10665 734 69 0
k61_10666 469 31 0
k61_10667 247 16 0
k61_10668 413 34 0
k61_10669 310 15 0
k61_10670 217 8 0
k61_10671 504 48 0
k61_10672 334 25 0
k61_10673 554 28 0
k61_10674 220 10 0
k61_10676 471 35 0
k61_10677 221 12 0
k61_10678 435 41 0
k61_10679 260 16 0
k61_10680 915 78 0
k61_10681 813 74 0
k61_10682 678 47 0
k61_10683 309 16 0
k61_10684 210 14 0
k61_10685 315 11 0
k61_10686 401 31 0
k61_10687 389 28 0
k61_10688 241 13 0
k61_10689 962 77 0
k61_10690 226 16 0
k61_10691 291 25 0
k61_10692 264 25 0
k61_10693 355 23 0
k61_10694 286 14 0
k61_10695 206 9 0
k61_10696 256 22 0
k61_10697 227 10 0
k61_10698 284 25 0
k61_10699 357 37 0
k61_10700 212 7 0
k61_10701 281 23 0
k61_10702 319 16 0
k61_10703 260 21 0
k61_10704 415 43 0
k61_10705 507 47 0
k61_10706 692 84 0
k61_10707 302 14 0
k61_10708 1530 304 0
k61_10709 331 23 0
k61_10710 220 11 0
k61_10711 289 19 0
k61_10712 216 12 0
k61_10713 261 13 0
k61_10714 214 20 0
k61_10715 2055 184 0
k61_10717 227 15 0
k61_10718 277 14 0
k61_10719 271 17 0
k61_10720 350 19 0
k61_10721 568 50 0
k61_10723 427 36 0
k61_10724 736 30 0
k61_10725 423 43 0
k61_10726 303 16 0
k61_10727 569 41 0
k61_10728 324 21 0
k61_10729 434 17 0
k61_10730 490 35 0
k61_10731 242 13 0
k61_10732 356 21 0
k61_10733 346 43 0
k61_10735 245 17 0
k61_10736 510 48 0
k61_10737 422 23 0
k61_10739 400 28 0
k61_10740 525 40 0
k61_10741 1200 110 0
k61_10742 636 52 0
k61_10743 301 26 0
k61_10744 350 21 0
k61_10745 471 26 0
k61_10746 328 26 0
k61_10747 206 12 0
k61_10748 544 62 0
k61_10749 204 9 0
k61_10750 331 29 0
k61_10751 352 25 0
k61_10752 324 15 0
k61_10754 591 53 0
k61_10755 818 94 0
k61_10757 246 13 0
k61_10758 317 14 0
k61_10759 276 16 0
k61_10760 226 10 0
k61_10761 262 16 0
k61_10762 347 22 0
k61_10764 571 25 0
k61_10765 465 25 0
k61_10767 326 13 0
k61_10768 556 36 0
k61_10769 303 21 0
k61_10770 238 20 0
k61_10771 349 25 0
k61_10773 338 30 0
k61_10774 469 30 0
k61_10775 228 11 0
k61_10776 243 20 0
k61_10777 264 17 0
k61_10778 388 30 0
k61_10779 663 57 0
k61_10780 563 56 0
k61_10781 443 28 0
k61_10782 260 14 0
k61_10783 242 14 0
k61_10784 399 37 0
k61_10785 556 39 0
k61_10786 291 19 0
k61_10787 258 10 0
k61_10788 236 9 0
k61_10789 283 14 0
k61_10790 210 9 0
k61_10791 244 8 0
k61_10792 260 17 0
k61_10793 1303 142 0
k61_10794 381 47 0
k61_10795 225 14 0
k61_10796 482 34 0
k61_10797 473 24 0
k61_10798 479 55 0
k61_10799 360 33 0
k61_10800 1426 142 0
k61_10802 481 23 0
k61_10803 369 10 0
k61_10804 321 21 0
k61_10805 477 45 0
k61_10806 442 43 0
k61_10807 1981 183 0
k61_10808 668 56 0
k61_10810 222 15 0
k61_10811 202 10 0
k61_10812 253 15 0
k61_10813 367 20 0
k61_10814 781 64 0
k61_10815 323 20 0
k61_10816 224 24 0
k61_10817 2546 258 0
k61_10818 346 36 0
k61_10819 347 35 0
k61_10820 203 6 0
k61_10821 566 43 0
k61_10822 290 19 0
k61_10823 262 21 0
k61_10824 228 14 0
k61_10825 497 38 0
k61_10826 508 32 0
k61_10827 349 18 0
k61_10828 331 30 0
k61_10829 307 16 0
k61_10830 205 11 0
k61_10831 400 29 0
k61_10832 269 11 0
k61_10833 234 8 0
k61_10834 667 52 0
k61_10835 306 18 0
k61_10838 262 17 0
k61_10840 312 23 0
k61_10841 315 27 0
k61_10842 295 15 0
k61_10844 550 60 0
k61_10845 528 40 0
k61_10847 234 14 0
k61_10849 240 13 0
k61_10851 335 23 0
k61_10852 388 39 0
k61_10853 631 43 0
k61_10854 979 85 0
k61_10855 240 12 0
k61_10857 349 17 0
k61_10859 534 47 0
k61_10860 330 17 0
k61_10861 339 23 0
k61_10862 253 23 0
k61_10863 209 21 0
k61_10864 436 37 0
k61_10865 388 24 0
k61_10866 230 8 0
k61_10867 343 17 0
k61_10868 454 37 0
k61_10869 465 34 0
k61_10870 718 77 0
k61_10872 356 16 0
k61_10873 227 15 0
k61_10874 367 14 0
k61_10875 280 18 0
k61_10876 686 48 0
k61_10877 249 16 0
k61_10878 654 64 0
k61_10879 604 51 0
k61_10880 558 31 0
k61_10881 239 11 0
k61_10883 214 20 0
k61_10884 688 59 0
k61_10885 200 7 0
k61_10886 262 15 0
k61_10887 301 8 0
k61_10888 242 15 0
k61_10889 655 49 0
k61_10890 271 20 0
k61_10891 771 66 0
k61_10892 701 68 0
k61_10893 330 28 0
k61_10894 542 49 0
k61_10895 229 18 0
k61_10897 463 54 0
k61_10898 300 10 0
k61_10899 281 13 0
k61_10900 206 11 0
k61_10901 203 16 0
k61_10902 607 47 0
k61_10903 250 11 0
k61_10905 736 64 0
k61_10906 235 8 0
k61_10907 205 10 0
k61_10908 560 53 0
k61_10909 335 12 0
k61_10910 1002 82 0
k61_10911 258 8 0
k61_10912 267 14 0
k61_10913 287 10 0
k61_10915 210 9 0
k61_10916 269 12 0
k61_10918 217 12 0
k61_10919 230 24 0
k61_10920 341 21 0
k61_10921 515 40 0
k61_10923 236 10 0
k61_10924 850 84 0
k61_10925 210 8 0
k61_10926 836 76 0
k61_10928 1393 144 0
k61_10929 1198 104 0
k61_10930 241 26 0
k61_10931 552 45 0
k61_10932 1284 118 0
k61_10933 511 41 0
k61_10934 891 82 0
k61_10935 210 15 0
k61_10936 291 20 0
k61_10937 279 30 0
k61_10938 354 18 0
k61_10939 235 18 0
k61_10940 347 25 0
k61_10942 374 32 0
k61_10943 296 13 0
k61_10944 377 15 0
k61_10946 269 13 0
k61_10947 358 26 0
k61_10948 303 28 0
k61_10949 1030 85 0
k61_10950 203 5 0
k61_10951 311 26 0
k61_10952 996 90 0
k61_10953 231 11 0
k61_10954 790 63 0
k61_10955 200 11 0
k61_10956 266 19 0
k61_10960 206 8 0
k61_10961 834 84 0
k61_10962 713 49 0
k61_10963 533 45 0
k61_10964 306 15 0
k61_10965 663 52 0
k61_10966 3896 4296 0
k61_10967 299 24 0
k61_10968 746 61 0
k61_10969 491 59 0
k61_10970 215 13 0
k61_10972 308 33 0
k61_10973 602 50 0
k61_10974 397 30 0
k61_10975 320 9 0
k61_10976 675 72 0
k61_10977 271 14 0
k61_10978 337 22 0
k61_10979 304 24 0
k61_10980 534 38 0
k61_10981 824 73 0
k61_10982 257 9 0
k61_10983 836 57 0
k61_10985 628 49 0
k61_10986 219 16 0
k61_10987 216 10 0
k61_10988 278 15 0
k61_10989 226 12 0
k61_10990 536 54 0
k61_10992 355 22 0
k61_10994 220 11 0
k61_10995 354 24 0
k61_10996 327 22 0
k61_10998 247 15 0
k61_10999 420 35 0
k61_11002 628 50 0
k61_11005 237 12 0
k61_11006 229 23 0
k61_11007 265 23 0
k61_11008 525 43 0
k61_11009 321 23 0
k61_11010 287 17 0
k61_11011 1030 91 0
k61_11012 252 16 0
k61_11013 525 31 0
k61_11014 335 22 0
k61_11015 518 55 0
k61_11016 269 19 0
k61_11017 217 16 0
k61_11018 202 14 0
k61_11019 284 21 0
k61_11020 743 45 0
k61_11021 287 21 0
k61_11022 1862 2084 0
k61_11024 545 50 0
k61_11025 210 12 0
k61_11026 1005 69 0
k61_11027 590 32 0
k61_11028 382 27 0
k61_11029 1423 134 0
k61_11030 379 25 0
k61_11031 654 48 0
k61_11032 822 70 0
k61_11033 794 64 0
k61_11034 734 79 0
k61_11035 429 40 0
k61_11036 309 21 0
k61_11037 748 60 0
k61_11038 409 25 0
k61_11039 473 29 0
k61_11040 888 90 0
k61_11041 337 16 0
k61_11042 342 22 0
k61_11043 245 29 0
k61_11046 277 16 0
k61_11047 435 31 0
k61_11048 342 31 0
k61_11049 348 20 0
k61_11050 215 11 0
k61_11051 314 30 0
k61_11052 268 33 0
k61_11053 243 8 0
k61_11054 260 9 0
k61_11055 899 82 0
k61_11056 274 13 0
k61_11057 1043 92 0
k61_11058 440 39 0
k61_11059 678 58 0
k61_11060 242 13 0
k61_11061 586 44 0
k61_11062 697 49 0
k61_11063 900 64 0
k61_11064 757 62 0
k61_11065 958 84 0
k61_11066 685 54 0
k61_11067 442 37 0
k61_11068 420 26 0
k61_11069 424 41 0
k61_11070 1053 113 0
k61_11071 865 75 0
k61_11073 255 18 0
k61_11074 253 10 0
k61_11075 285 14 0
k61_11076 230 29 0
k61_11077 264 13 0
k61_11078 763 77 0
k61_11079 356 30 0
k61_11080 433 45 0
k61_11083 217 14 0
k61_11085 208 8 0
k61_11086 227 18 0
k61_11087 801 74 0
k61_11088 241 21 0
k61_11089 390 21 0
k61_11090 252 10 0
k61_11091 231 10 0
k61_11092 728 70 0
k61_11093 569 50 0
k61_11094 295 21 0
k61_11095 672 61 0
k61_11096 809 63 0
k61_11097 567 47 0
k61_11098 475 62 0
k61_11099 289 12 0
k61_11100 244 13 0
k61_11101 267 23 0
k61_11102 207 18 0
k61_11103 275 10 0
k61_11104 378 42 0
k61_11105 1038 108 0
k61_11106 314 26 0
k61_11108 317 23 0
k61_11109 239 9 0
k61_11110 434 36 0
k61_11111 331 35 0
k61_11112 294 31 0
k61_11113 546 45 0
k61_11114 207 13 0
k61_11115 443 31 0
k61_11116 524 42 0
k61_11117 1223 98 0
k61_11118 324 30 0
k61_11119 613 59 0
k61_11120 1726 135 0
k61_11121 323 20 0
k61_11122 911 102 0
k61_11124 375 30 0
k61_11125 313 20 0
k61_11126 384 22 0
k61_11127 499 23 0
k61_11128 368 25 0
k61_11129 361 32 0
k61_11130 409 30 0
k61_11131 205 8 0
k61_11132 1646 182 0
k61_11133 347 14 0
k61_11134 609 42 0
k61_11135 246 24 0
k61_11136 518 49 0
k61_11138 654 60 0
k61_11139 265 29 0
k61_11140 555 44 0
k61_11141 436 46 0
k61_11142 237 11 0
k61_11143 348 24 0
k61_11144 200 11 0
k61_11146 212 11 0
k61_11147 482 36 0
k61_11148 424 27 0
k61_11149 218 8 0
k61_11150 457 21 0
k61_11151 279 19 0
k61_11152 412 27 0
k61_11153 1197 103 0
k61_11154 1107 92 0
k61_11155 625 53 0
k61_11156 227 8 0
k61_11157 617 38 0
k61_11158 532 56 0
k61_11159 438 33 0
k61_11160 709 69 0
k61_11161 799 63 0
k61_11162 253 23 0
k61_11163 296 18 0
k61_11165 497 54 0
k61_11166 766 68 0
k61_11167 551 53 0
k61_11168 320 23 0
k61_11169 254 29 0
k61_11170 593 64 0
k61_11171 240 10 0
k61_11172 269 21 0
k61_11173 814 84 0
k61_11174 618 53 0
k61_11176 549 39 0
k61_11177 465 72 0
k61_11178 380 23 0
k61_11179 282 14 0
k61_11180 770 64 0
k61_11181 290 14 0
k61_11182 234 26 0
k61_11183 263 20 0
k61_11184 222 15 0
k61_11185 298 25 0
k61_11186 241 29 0
k61_11187 2034 235 0
k61_11188 212 8 0
k61_11189 666 97 0
k61_11190 249 11 0
k61_11192 755 75 0
k61_11194 594 50 0
k61_11195 309 20 0
k61_11196 554 64 0
k61_11197 253 10 0
k61_11198 201 10 0
k61_11199 268 21 0
k61_11201 524 44 0
k61_11202 223 8 0
k61_11203 304 33 0
k61_11204 212 6 0
k61_11205 471 41 0
k61_11206 762 63 0
k61_11207 204 8 0
k61_11208 386 24 0
k61_11209 315 14 0
k61_11210 367 22 0
k61_11211 227 22 0
k61_11212 297 14 0
k61_11213 494 68 0
k61_11214 346 28 0
k61_11215 419 59 0
k61_11216 303 15 0
k61_11217 302 20 0
k61_11218 947 76 0
k61_11219 307 21 0
k61_11220 346 33 0
k61_11221 766 69 0
k61_11222 210 9 0
k61_11224 255 19 0
k61_11225 230 11 0
k61_11226 260 17 0
k61_11227 269 17 0
k61_11228 344 29 0
k61_11229 202 16 0
k61_11230 254 15 0
k61_11231 255 14 0
k61_11232 220 5 0
k61_11233 253 12 0
k61_11234 271 14 0
k61_11235 742 61 0
k61_11236 261 17 0
k61_11237 826 71 0
k61_11239 391 33 0
k61_11240 245 17 0
k61_11241 329 18 0
k61_11242 428 39 0
k61_11243 303 20 0
k61_11244 246 12 0
k61_11245 230 18 0
k61_11246 438 30 0
k61_11247 569 50 0
k61_11248 991 99 0
k61_11249 519 37 0
k61_11250 497 53 0
k61_11251 277 16 0
k61_11252 490 47 0
k61_11253 274 21 0
k61_11254 238 16 0
k61_11255 254 25 0
k61_11256 401 32 0
k61_11257 461 45 0
k61_11258 341 11 0
k61_11259 341 21 0
k61_11260 508 42 0
k61_11261 209 17 0
k61_11262 361 25 0
k61_11263 478 33 0
k61_11264 1128 88 0
k61_11265 312 14 0
k61_11266 1084 104 0
k61_11267 200 13 0
k61_11268 1187 115 0
k61_11269 289 20 0
k61_11270 216 18 0
k61_11271 576 62 0
k61_11273 217 13 0
k61_11274 562 49 0
k61_11275 263 19 0
k61_11276 201 16 0
k61_11277 235 7 0
k61_11278 340 39 0
k61_11279 204 7 0
k61_11280 1783 159 0
k61_11281 235 9 0
k61_11282 444 38 0
k61_11283 558 44 0
k61_11284 467 41 0
k61_11285 571 58 0
k61_11286 235 7 0
k61_11287 972 99 0
k61_11288 1067 186 0
k61_11289 759 54 0
k61_11290 368 26 0
k61_11291 288 14 0
k61_11292 401 27 0
k61_11293 205 13 0
k61_11294 302 14 0
k61_11295 215 9 0
k61_11296 1058 93 0
k61_11297 387 23 0
k61_11298 253 8 0
k61_11300 1809 187 0
k61_11301 253 14 0
k61_11302 491 42 0
k61_11303 249 15 0
k61_11304 301 9 0
k61_11305 398 33 0
k61_11306 295 15 0
k61_11307 237 16 0
k61_11309 226 27 0
k61_11310 225 11 0
k61_11311 242 23 0
k61_11312 341 38 0
k61_11313 443 32 0
k61_11314 220 18 0
k61_11315 215 16 0
k61_11316 564 48 0
k61_11318 272 19 0
k61_11319 320 23 0
k61_11320 478 24 0
k61_11321 255 11 0
k61_11322 322 24 0
k61_11323 832 79 0
k61_11324 276 15 0
k61_11325 619 35 0
k61_11326 206 6 0
k61_11327 209 10 0
k61_11328 201 19 0
k61_11330 341 11 0
k61_11331 255 18 0
k61_11332 211 9 0
k61_11333 234 14 0
k61_11334 752 60 0
k61_11338 301 33 0
k61_11339 334 27 0
k61_11340 428 38 0
k61_11341 1215 148 0
k61_11342 545 47 0
k61_11344 467 36 0
k61_11345 305 28 0
k61_11346 438 30 0
k61_11347 287 20 0
k61_11350 239 15 0
k61_11351 1965 196 0
k61_11352 521 40 0
k61_11354 280 15 0
k61_11355 599 40 0
k61_11356 208 16 0
k61_11357 463 48 0
k61_11358 307 28 0
k61_11359 204 14 0
k61_11360 225 7 0
k61_11361 1338 119 0
k61_11362 660 51 0
k61_11363 324 20 0
k61_11364 257 18 0
k61_11367 668 61 0
k61_11368 357 19 0
k61_11370 595 50 0
k61_11371 588 49 0
k61_11372 304 13 0
k61_11373 202 12 0
k61_11374 687 73 0
k61_11375 222 14 0
k61_11376 974 79 0
k61_11377 729 68 0
k61_11378 649 42 0
k61_11379 551 22 0
k61_11380 262 11 0
k61_11381 323 13 0
k61_11382 274 20 0
k61_11383 441 35 0
k61_11384 219 21 0
k61_11385 349 26 0
k61_11386 304 28 0
k61_11387 533 38 0
k61_11388 279 17 0
k61_11389 523 35 0
k61_11390 319 40 0
k61_11392 669 50 0
k61_11393 454 44 0
k61_11394 394 39 0
k61_11395 708 56 0
k61_11396 246 18 0
k61_11397 786 59 0
k61_11398 328 13 0
k61_11399 1604 184 0
k61_11400 662 61 0
k61_11401 797 68 0
k61_11402 1025 99 0
k61_11403 729 47 0
k61_11404 378 33 0
k61_11405 308 15 0
k61_11406 1030 82 0
k61_11407 1318 95 0
k61_11408 582 47 0
k61_11409 230 8 0
k61_11410 609 77 0
k61_11412 337 33 0
k61_11413 603 43 0
k61_11414 522 41 0
k61_11415 286 17 0
k61_11417 348 34 0
k61_11418 213 10 0
k61_11419 1099 115 0
k61_11420 732 53 0
k61_11421 763 89 0
k61_11422 260 29 0
k61_11423 483 37 0
k61_11424 429 41 0
k61_11425 260 10 0
k61_11426 253 17 0
k61_11427 558 47 0
k61_11428 244 22 0
k61_11429 374 16 0
k61_11430 291 10 0
k61_11431 357 37 0
k61_11432 492 32 0
k61_11433 310 26 0
k61_11436 227 10 0
k61_11437 260 22 0
k61_11438 714 63 0
k61_11439 376 46 0
k61_11440 405 29 0
k61_11441 244 19 0
k61_11442 237 10 0
k61_11443 231 12 0
k61_11444 334 25 0
k61_11445 431 30 0
k61_11446 262 16 0
k61_11447 389 30 0
k61_11448 1307 156 0
k61_11449 559 26 0
k61_11451 270 16 0
k61_11454 396 27 0
k61_11455 596 41 0
k61_11456 548 60 0
k61_11457 364 23 0
k61_11458 317 21 0
k61_11459 1417 135 0
k61_11460 573 63 0
k61_11461 271 11 0
k61_11462 239 10 0
k61_11463 220 19 0
k61_11465 252 25 0
k61_11466 385 9 0
k61_11467 682 38 0
k61_11468 742 41 0
k61_11470 336 28 0
k61_11471 900 104 0
k61_11472 270 18 0
k61_11473 293 19 0
k61_11474 332 19 0
k61_11475 334 24 0
k61_11476 327 18 0
k61_11477 245 17 0
k61_11478 767 72 0
k61_11479 636 54 0
k61_11480 237 20 0
k61_11481 237 21 0
k61_11482 503 50 0
k61_11483 306 33 0
k61_11484 399 38 0
k61_11485 386 32 0
k61_11487 237 10 0
k61_11489 710 49 0
k61_11491 1106 87 0
k61_11492 383 35 0
k61_11493 310 18 0
k61_11495 240 20 0
k61_11496 251 14 0
k61_11497 256 17 0
k61_11498 420 41 0
k61_11499 611 46 0
k61_11500 509 52 0
k61_11501 440 30 0
k61_11502 2322 230 0
k61_11503 594 53 0
k61_11504 607 55 0
k61_11505 227 14 0
k61_11506 474 50 0
k61_11507 218 7 0
k61_11508 231 21 0
k61_11509 282 24 0
k61_11510 405 14 0
k61_11511 418 22 0
k61_11513 320 28 0
k61_11514 603 48 0
k61_11516 340 20 0
k61_11518 444 41 0
k61_11519 327 21 0
k61_11520 464 51 0
k61_11521 2639 259 0
k61_11522 312 10 0
k61_11523 1922 184 0
k61_11524 345 30 0
k61_11525 552 36 0
k61_11526 1368 114 0
k61_11527 251 10 0
k61_11528 949 85 0
k61_11529 212 7 0
k61_11530 250 12 0
k61_11531 644 55 0
k61_11532 266 23 0
k61_11534 210 13 0
k61_11535 255 10 0
k61_11537 265 10 0
k61_11538 384 34 0
k61_11539 322 19 0
k61_11540 564 69 0
k61_11541 1093 158 0
k61_11542 695 44 0
k61_11543 344 22 0
k61_11544 587 67 0
k61_11545 312 13 0
k61_11547 643 67 0
k61_11548 442 31 0
k61_11549 976 73 0
k61_11550 704 74 0
k61_11551 225 15 0
k61_11552 393 25 0
k61_11553 200 8 0
k61_11554 710 64 0
k61_11555 224 9 0
k61_11556 427 28 0
k61_11557 262 21 0
k61_11558 357 28 0
k61_11559 282 14 0
k61_11561 206 6 0
k61_11562 374 38 0
k61_11563 694 62 0
k61_11565 449 39 0
k61_11567 1388 121 0
k61_11568 350 23 0
k61_11569 417 23 0
k61_11570 264 10 0
k61_11571 378 17 0
k61_11572 233 7 0
k61_11573 298 15 0
k61_11574 262 9 0
k61_11575 482 40 0
k61_11576 246 10 0
k61_11577 871 81 0
k61_11578 203 19 0
k61_11579 589 61 0
k61_11581 330 21 0
k61_11583 206 9 0
k61_11584 1236 134 0
k61_11585 345 24 0
k61_11586 944 72 0
k61_11587 377 24 0
k61_11588 1402 177 0
k61_11589 874 81 0
k61_11590 966 72 0
k61_11591 227 18 0
k61_11593 400 36 0
k61_11594 244 15 0
k61_11596 408 19 0
k61_11597 815 62 0
k61_11598 924 66 0
k61_11599 222 9 0
k61_11600 250 15 0
k61_11601 232 24 0
k61_11602 338 21 0
k61_11603 999 96 0
k61_11604 437 53 0
k61_11605 219 13 0
k61_11606 410 25 0
k61_11607 539 26 0
k61_11608 224 10 0
k61_11609 289 10 0
k61_11610 204 7 0
k61_11612 508 43 0
k61_11613 337 12 0
k61_11614 274 32 0
k61_11615 235 13 0
k61_11616 470 20 0
k61_11617 322 24 0
k61_11618 403 44 0
k61_11619 221 8 0
k61_11620 225 15 0
k61_11621 681 56 0
k61_11622 308 23 0
k61_11624 807 59 0
k61_11625 491 57 0
k61_11626 481 29 0
k61_11627 298 20 0
k61_11628 1302 109 0
k61_11629 466 43 0
k61_11630 280 13 0
k61_11632 1221 125 0
k61_11633 245 16 0
k61_11634 428 36 0
k61_11635 994 92 0
k61_11636 202 8 0
k61_11637 332 30 0
k61_11639 481 21 0
k61_11640 303 24 0
k61_11641 306 22 0
k61_11642 219 12 0
k61_11643 738 59 0
k61_11644 359 18 0
k61_11645 208 7 0
k61_11646 445 35 0
k61_11650 446 22 0
k61_11652 272 23 0
k61_11653 711 42 0
k61_11655 304 27 0
k61_11656 837 95 0
k61_11657 201 21 0
k61_11658 200 8 0
k61_11659 579 28 0
k61_11660 720 60 0
k61_11661 1089 90 0
k61_11662 639 49 0
k61_11663 369 14 0
k61_11665 236 26 0
k61_11666 270 13 0
k61_11667 225 10 0
k61_11668 299 19 0
k61_11669 716 52 0
k61_11670 353 34 0
k61_11671 220 6 0
k61_11672 761 72 0
k61_11673 237 8 0
k61_11674 252 21 0
k61_11675 303 27 0
k61_11676 200 11 0
k61_11677 278 24 0
k61_11680 339 19 0
k61_11681 688 77 0
k61_11682 408 33 0
k61_11684 290 15 0
k61_11685 247 10 0
k61_11686 314 20 0
k61_11687 327 31 0
k61_11688 266 26 0
k61_11690 279 15 0
k61_11691 445 36 0
k61_11692 334 25 0
k61_11693 501 31 0
k61_11694 293 24 0
k61_11695 392 33 0
k61_11696 605 32 0
k61_11697 747 83 0
k61_11698 363 31 0
k61_11699 526 31 0
k61_11700 394 27 0
k61_11701 357 20 0
k61_11702 745 67 0
k61_11703 474 50 0
k61_11704 279 12 0
k61_11705 365 27 0
k61_11706 248 10 0
k61_11707 490 28 0
k61_11708 247 13 0
k61_11711 210 9 0
k61_11712 556 49 0
k61_11713 206 5 0
k61_11714 407 27 0
k61_11715 466 20 0
k61_11716 554 37 0
k61_11717 213 8 0
k61_11718 254 22 0
k61_11719 468 41 0
k61_11720 511 30 0
k61_11721 411 24 0
k61_11722 1444 117 0
k61_11723 376 23 0
k61_11724 593 42 0
k61_11725 418 30 0
k61_11726 211 16 0
k61_11727 205 12 0
k61_11728 241 8 0
k61_11729 403 36 0
k61_11730 443 39 0
k61_11731 391 27 0
k61_11732 442 48 0
k61_11733 1571 166 0
k61_11734 293 19 0
k61_11735 473 43 0
k61_11737 277 11 0
k61_11738 578 57 0
k61_11739 401 40 0
k61_11740 214 7 0
k61_11741 856 83 0
k61_11742 262 12 0
k61_11743 210 11 0
k61_11744 421 29 0
k61_11745 226 9 0
k61_11746 257 17 0
k61_11747 233 9 0
k61_11749 448 32 0
k61_11750 551 57 0
k61_11751 1780 166 0
k61_11752 242 9 0
k61_11753 289 23 0
k61_11754 555 44 0
k61_11755 289 15 0
k61_11756 239 15 0
k61_11757 565 47 0
k61_11758 539 50 0
k61_11759 249 12 0
k61_11760 639 66 0
k61_11761 350 19 0
k61_11762 241 10 0
k61_11764 260 24 0
k61_11765 226 10 0
k61_11766 450 35 0
k61_11767 357 17 0
k61_11768 976 72 0
k61_11769 369 29 0
k61_11770 340 22 0
k61_11771 259 14 0
k61_11772 280 19 0
k61_11773 202 5 0
k61_11774 878 80 0
k61_11775 238 26 0
k61_11776 249 20 0
k61_11777 470 37 0
k61_11778 215 13 0
k61_11779 254 9 0
k61_11781 448 33 0
k61_11782 551 53 0
k61_11784 224 10 0
k61_11785 336 24 0
k61_11786 215 10 0
k61_11787 222 15 0
k61_11788 363 30 0
k61_11790 324 20 0
k61_11791 585 49 0
k61_11792 214 12 0
k61_11793 491 23 0
k61_11794 306 21 0
k61_11795 262 11 0
k61_11796 201 12 0
k61_11797 225 14 0
k61_11798 576 46 0
k61_11800 744 63 0
k61_11801 320 26 0
k61_11802 401 35 0
k61_11803 621 59 0
k61_11804 441 26 0
k61_11805 206 19 0
k61_11806 399 40 0
k61_11807 378 23 0
k61_11808 343 17 0
k61_11809 202 5 0
k61_11810 831 86 0
k61_11811 228 15 0
k61_11812 853 66 0
k61_11813 326 23 0
k61_11814 274 18 0
k61_11815 203 10 0
k61_11816 251 8 0
k61_11817 583 25 0
k61_11818 442 39 0
k61_11819 1202 95 0
k61_11820 349 29 0
k61_11821 217 14 0
k61_11823 1259 112 0
k61_11825 451 25 0
k61_11826 518 48 0
k61_11827 1111 85 0
k61_11828 1206 66 0
k61_11829 734 82 0
k61_11830 466 51 0
k61_11831 1723 194 0
k61_11832 236 19 0
k61_11833 244 16 0
k61_11834 223 10 0
k61_11835 244 17 0
k61_11836 201 8 0
k61_11837 1325 111 0
k61_11838 219 5 0
k61_11839 287 11 0
k61_11840 405 25 0
k61_11842 1121 98 0
k61_11844 325 56 0
k61_11845 440 30 0
k61_11846 699 72 0
k61_11847 696 68 0
k61_11849 1051 101 0
k61_11850 433 59 0
k61_11851 452 46 0
k61_11852 211 18 0
k61_11853 397 22 0
k61_11854 333 20 0
k61_11856 1176 110 0
k61_11857 211 8 0
k61_11858 773 53 0
k61_11859 217 14 0
k61_11860 262 24 0
k61_11861 287 21 0
k61_11862 225 14 0
k61_11863 635 51 0
k61_11864 232 9 0
k61_11865 816 76 0
k61_11866 364 28 0
k61_11867 747 65 0
k61_11868 383 20 0
k61_11869 660 60 0
k61_11870 371 35 0
k61_11871 588 49 0
k61_11872 211 20 0
k61_11873 236 16 0
k61_11874 1449 131 0
k61_11875 277 18 0
k61_11876 281 22 0
k61_11877 266 10 0
k61_11878 704 49 0
k61_11879 1060 92 0
k61_11880 282 29 0
k61_11881 247 14 0
k61_11882 441 29 0
k61_11883 349 26 0
k61_11884 808 108 0
k61_11885 323 18 0
k61_11886 447 16 0
k61_11887 315 18 0
k61_11888 201 11 0
k61_11889 458 32 0
k61_11890 207 10 0
k61_11892 3188 324 0
k61_11893 253 27 0
k61_11895 214 5 0
k61_11896 386 21 0
k61_11897 325 16 0
k61_11899 467 42 0
k61_11900 326 15 0
k61_11901 256 27 0
k61_11902 200 13 0
k61_11903 254 21 0
k61_11904 367 26 0
k61_11905 441 36 0
k61_11907 265 10 0
k61_11908 231 14 0
k61_11909 388 28 0
k61_11910 249 12 0
k61_11911 815 71 0
k61_11912 429 27 0
k61_11913 1049 97 0
k61_11914 254 21 0
k61_11915 819 52 0
k61_11916 231 7 0
k61_11917 228 15 0
k61_11918 249 11 0
k61_11919 248 10 0
k61_11920 253 14 0
k61_11921 702 68 0
k61_11922 1258 115 0
k61_11923 305 7 0
k61_11924 266 26 0
k61_11925 357 40 0
k61_11926 1486 146 0
k61_11927 316 26 0
k61_11928 212 9 0
k61_11929 221 10 0
k61_11930 1525 138 0
k61_11931 467 129 0
k61_11932 348 13 0
k61_11933 266 16 0
k61_11934 323 35 0
k61_11937 270 17 0
k61_11938 952 114 0
k61_11940 232 9 0
k61_11941 320 24 0
k61_11943 208 15 0
k61_11944 428 35 0
k61_11945 808 78 0
k61_11946 205 16 0
k61_11947 235 10 0
k61_11948 200 7 0
k61_11949 214 7 0
k61_11950 814 74 0
k61_11951 628 67 0
k61_11953 346 21 0
k61_11954 254 8 0
k61_11955 285 15 0
k61_11956 361 30 0
k61_11957 209 9 0
k61_11958 235 19 0
k61_11959 334 25 0
k61_11960 583 49 0
k61_11962 260 13 0
k61_11963 317 28 0
k61_11964 202 9 0
k61_11965 206 8 0
k61_11969 678 47 0
k61_11970 730 63 0
k61_11971 451 40 0
k61_11972 214 18 0
k61_11973 824 60 0
k61_11974 570 57 0
k61_11975 257 17 0
k61_11976 231 16 0
k61_11977 961 68 0
k61_11978 212 7 0
k61_11979 615 47 0
k61_11980 201 12 0
k61_11981 556 45 0
k61_11982 720 52 0
k61_11983 336 16 0
k61_11984 429 40 0
k61_11985 718 67 0
k61_11986 257 22 0
k61_11988 244 20 0
k61_11989 211 13 0
k61_11990 509 37 0
k61_11991 257 18 0
k61_11992 226 22 0
k61_11993 564 49 0
k61_11994 872 68 0
k61_11995 514 67 0
k61_11996 965 89 0
k61_11997 309 14 0
k61_11998 507 28 0
k61_11999 834 103 0
k61_12000 243 8 0
k61_12001 525 32 0
k61_12002 360 26 0
k61_12003 692 68 0
k61_12004 200 16 0
k61_12005 514 42 0
k61_12006 401 27 0
k61_12007 518 60 0
k61_12008 226 19 0
k61_12009 222 12 0
k61_12010 488 44 0
k61_12011 289 33 0
k61_12012 245 17 0
k61_12013 233 7 0
k61_12014 407 38 0
k61_12015 235 20 0
k61_12016 282 16 0
k61_12017 231 19 0
k61_12018 1355 128 0
k61_12019 307 24 0
k61_12020 282 13 0
k61_12021 254 12 0
k61_12022 1069 99 0
k61_12023 558 40 0
k61_12024 214 9 0
k61_12025 232 13 0
k61_12026 550 40 0
k61_12027 207 34 0
k61_12028 200 8 0
k61_12031 457 39 0
k61_12032 258 13 0
k61_12033 888 86 0
k61_12036 255 14 0
k61_12037 640 44 0
k61_12038 240 10 0
k61_12039 407 31 0
k61_12040 369 31 0
k61_12041 673 72 0
k61_12042 317 16 0
k61_12043 236 10 0
k61_12044 344 10 0
k61_12045 242 12 0
k61_12046 270 13 0
k61_12047 233 11 0
k61_12048 310 20 0
k61_12049 560 22 0
k61_12050 369 24 0
k61_12051 279 10 0
k61_12052 255 12 0
k61_12053 2220 201 0
k61_12054 335 23 0
k61_12055 528 46 0
k61_12056 393 35 0
k61_12057 308 19 0
k61_12058 291 9 0
k61_12059 235 9 0
k61_12060 513 35 0
k61_12061 337 24 0
k61_12062 1952 159 0
k61_12063 369 32 0
k61_12064 1748 231 0
k61_12065 501 30 0
k61_12066 972 63 0
k61_12068 406 18 0
k61_12069 252 15 0
k61_12070 362 22 0
k61_12071 217 12 0
k61_12072 231 9 0
k61_12073 374 31 0
k61_12074 610 61 0
k61_12075 582 53 0
k61_12076 259 11 0
k61_12078 225 15 0
k61_12079 619 46 0
k61_12080 835 56 0
k61_12082 802 61 0
k61_12083 237 15 0
k61_12084 551 48 0
k61_12085 223 10 0
k61_12086 217 15 0
k61_12087 428 38 0
k61_12088 1051 110 0
k61_12089 324 33 0
k61_12090 271 27 0
k61_12091 224 21 0
k61_12093 202 13 0
k61_12094 254 10 0
k61_12095 230 7 0
k61_12096 698 61 0
k61_12097 734 68 0
k61_12098 245 13 0
k61_12099 758 72 0
k61_12100 1097 112 0
k61_12101 288 16 0
k61_12102 253 14 0
k61_12103 294 11 0
k61_12104 407 40 0
k61_12105 1349 129 0
k61_12106 640 43 0
k61_12107 217 14 0
k61_12108 1010 95 0
k61_12109 959 90 0
k61_12110 309 18 0
k61_12111 466 30 0
k61_12112 227 7 0
k61_12113 882 92 0
k61_12114 207 11 0
k61_12115 229 17 0
k61_12116 323 18 0
k61_12117 276 20 0
k61_12118 944 859 0
k61_12119 482 54 0
k61_12120 283 21 0
k61_12121 218 16 0
k61_12122 361 36 0
k61_12124 301 30 0
k61_12126 529 50 0
k61_12127 1185 116 0
k61_12128 256 16 0
k61_12129 202 13 0
k61_12130 907 87 0
k61_12131 224 15 0
k61_12132 738 73 0
k61_12133 231 16 0
k61_12134 897 81 0
k61_12135 444 32 0
k61_12136 433 40 0
k61_12137 200 17 0
k61_12138 290 15 0
k61_12140 483 45 0
k61_12141 568 57 0
k61_12142 283 30 0
k61_12143 280 20 0
k61_12144 405 25 0
k61_12145 622 49 0
k61_12146 297 11 0
k61_12147 320 22 0
k61_12148 269 7 0
k61_12149 411 26 0
k61_12150 659 41 0
k61_12152 1015 97 0
k61_12153 200 10 0
k61_12154 259 11 0
k61_12155 843 56 0
k61_12156 559 53 0
k61_12158 385 43 0
k61_12159 958 76 0
k61_12160 808 71 0
k61_12161 1324 138 0
k61_12162 338 19 0
k61_12163 362 19 0
k61_12164 344 12 0
k61_12165 551 47 0
k61_12166 617 37 0
k61_12167 200 8 0
k61_12168 447 49 0
k61_12169 303 20 0
k61_12170 247 12 0
k61_12171 375 26 0
k61_12172 244 7 0
k61_12173 216 11 0
k61_12174 397 17 0
k61_12175 250 12 0
k61_12176 830 86 0
k61_12177 200 9 0
k61_12178 626 40 0
k61_12179 346 16 0
k61_12180 2840 302 0
k61_12181 232 14 0
k61_12182 235 10 0
k61_12183 260 8 0
k61_12185 939 83 0
k61_12186 217 17 0
k61_12187 228 15 0
k61_12189 1957 177 0
k61_12190 300 23 0
k61_12191 256 20 0
k61_12192 430 27 0
k61_12193 275 21 0
k61_12194 299 30 0
k61_12195 292 21 0
k61_12196 223 12 0
k61_12198 469 34 0
k61_12199 673 71 0
k61_12200 445 27 0
k61_12201 392 23 0
k61_12202 403 30 0
k61_12204 408 32 0
k61_12205 454 38 0
k61_12206 208 24 0
k61_12209 386 25 0
k61_12210 324 23 0
k61_12211 353 28 0
k61_12212 255 14 0
k61_12213 334 11 0
k61_12214 1083 86 0
k61_12215 250 13 0
k61_12216 312 18 0
k61_12217 721 43 0
k61_12219 230 19 0
k61_12220 213 15 0
k61_12221 339 117 0
k61_12222 233 15 0
k61_12223 229 15 0
k61_12224 540 26 0
k61_12225 237 11 0
k61_12226 1501 128 0
k61_12227 269 17 0
k61_12228 718 64 0
k61_12229 453 26 0
k61_12230 1114 122 0
k61_12231 726 53 0
k61_12232 302 15 0
k61_12233 480 38 0
k61_12234 683 51 0
k61_12235 462 29 0
k61_12236 566 48 0
k61_12238 277 18 0
k61_12239 593 33 0
k61_12240 392 41 0
k61_12241 241 10 0
k61_12242 1973 221 0
k61_12244 524 39 0
k61_12245 1273 88 0
k61_12246 704 513 0
k61_12247 277 21 0
k61_12248 355 30 0
k61_12249 891 67 0
k61_12250 531 59 0
k61_12251 200 9 0
k61_12252 285 15 0
k61_12253 258 19 0
k61_12254 287 11 0
k61_12255 631 62 0
k61_12256 223 11 0
k61_12257 803 70 0
k61_12258 226 11 0
k61_12259 333 15 0
k61_12261 793 56 0
k61_12262 313 16 0
k61_12263 228 21 0
k61_12264 283 8 0
k61_12265 417 39 0
k61_12266 1225 169 0
k61_12267 201 7 0
k61_12268 314 8 0
k61_12269 228 9 0
k61_12271 221 11 0
k61_12272 416 38 0
k61_12274 250 14 0
k61_12275 4499 30833 0
k61_12276 283 22 0
k61_12278 1053 75 0
k61_12280 300 10 0
k61_12281 219 20 0
k61_12282 577 44 0
k61_12283 262 12 0
k61_12284 332 25 0
k61_12285 300 9 0
k61_12286 568 48 0
k61_12287 212 25 0
k61_12288 250 12 0
k61_12289 228 13 0
k61_12290 469 31 0
k61_12291 430 46 0
k61_12292 228 18 0
k61_12293 201 14 0
k61_12294 359 14 0
k61_12295 436 33 0
k61_12296 251 20 0
k61_12297 302 13 0
k61_12300 229 12 0
k61_12301 202 11 0
k61_12302 1203 86 0
k61_12305 276 16 0
k61_12306 2536 1932 0
k61_12307 239 11 0
k61_12308 247 11 0
k61_12309 454 33 0
k61_12312 340 17 0
k61_12313 308 29 0
k61_12315 448 46 0
k61_12317 203 16 0
k61_12318 333 27 0
k61_12319 348 152 0
k61_12321 630 61 0
k61_12323 453 39 0
k61_12324 497 37 0
k61_12326 213 10 0
k61_12328 215 22 0
k61_12330 415 38 0
k61_12332 273 14 0
k61_12337 207 16 0
k61_12340 639 53 0
k61_12343 204 11 0
k61_12345 480 37 0
k61_12346 227 10 0
k61_12347 835 67 0
k61_12348 202 10 0
k61_12349 204 10 0
k61_12350 310 15 0
k61_12351 324 21 0
k61_12352 506 42 0
k61_12353 292 15 0
k61_12354 269 18 0
k61_12355 489 36 0
k61_12356 675 54 0
k61_12357 712 47 0
k61_12358 364 24 0
k61_12359 689 62 0
k61_12361 373 26 0
k61_12362 210 14 0
k61_12363 486 36 0
k61_12364 1232 111 0
k61_12365 348 19 0
k61_12366 459 20 0
k61_12367 898 99 0
k61_12368 576 44 0
k61_12369 223 14 0
k61_12372 210 12 0
k61_12373 602 69 0
k61_12374 201 17 0
k61_12376 787 77 0
k61_12377 280 18 0
k61_12378 328 23 0
k61_12379 513 67 0
k61_12380 288 12 0
k61_12381 245 13 0
k61_12382 523 45 0
k61_12383 259 20 0
k61_12386 772 63 0
k61_12387 211 13 0
k61_12388 283 18 0
k61_12389 234 16 0
k61_12391 378 30 0
k61_12392 1149 103 0
k61_12393 208 16 0
k61_12394 478 22 0
k61_12395 457 39 0
k61_12396 505 52 0
k61_12397 228 14 0
k61_12398 625 63 0
k61_12399 218 11 0
k61_12400 338 31 0
k61_12401 225 8 0
k61_12402 355 23 0
k61_12403 260 7 0
k61_12404 541 56 0
k61_12405 314 21 0
k61_12406 1403 183 0
k61_12407 261 15 0
k61_12408 414 41 0
k61_12409 667 60 0
k61_12410 323 14 0
k61_12411 226 15 0
k61_12412 570 52 0
k61_12413 234 14 0
k61_12414 238 19 0
k61_12415 250 9 0
k61_12416 236 11 0
k61_12417 441 36 0
k61_12418 533 45 0
k61_12419 287 17 0
k61_12420 444 39 0
k61_12421 260 10 0
k61_12422 232 8 0
k61_12423 653 65 0
k61_12424 586 37 0
k61_12425 902 81 0
k61_12426 364 27 0
k61_12427 360 21 0
k61_12428 236 9 0
k61_12430 357 15 0
k61_12431 326 27 0
k61_12432 401 24 0
k61_12436 232 8 0
k61_12438 397 33 0
k61_12439 903 94 0
k61_12440 545 52 0
k61_12441 353 30 0
k61_12442 376 34 0
k61_12443 305 17 0
k61_12444 221 26 0
k61_12445 288 22 0
k61_12446 247 10 0
k61_12447 848 98 0
k61_12448 472 53 0
k61_12449 376 30 0
k61_12450 208 19 0
k61_12451 267 22 0
k61_12452 220 14 0
k61_12453 361 33 0
k61_12455 237 8 0
k61_12456 573 41 0
k61_12457 256 13 0
k61_12458 368 30 0
k61_12459 629 35 0
k61_12460 231 11 0
k61_12461 1402 124 0
k61_12462 297 16 0
k61_12463 257 7 0
k61_12464 530 39 0
k61_12465 207 23 0
k61_12466 406 30 0
k61_12467 786 61 0
k61_12468 204 6 0
k61_12469 269 23 0
k61_12470 631 42 0
k61_12471 220 14 0
k61_12472 472 47 0
k61_12473 1016 95 0
k61_12474 359 18 0
k61_12475 673 50 0
k61_12476 1740 150 0
k61_12477 693 59 0
k61_12478 343 31 0
k61_12479 296 21 0
k61_12480 233 92 0
k61_12481 497 48 0
k61_12482 540 26 0
k61_12483 758 62 0
k61_12484 274 21 0
k61_12485 738 68 0
k61_12486 302 32 0
k61_12487 1361 199 0
k61_12488 268 10 0
k61_12489 295 24 0
k61_12490 331 20 0
k61_12491 297 16 0
k61_12492 232 15 0
k61_12493 338 20 0
k61_12494 275 22 0
k61_12495 210 11 0
k61_12496 479 20 0
k61_12497 362 25 0
k61_12498 549 61 0
k61_12499 328 30 0
k61_12500 475 26 0
k61_12501 835 288 0
k61_12504 1083 93 0
k61_12505 355 41 0
k61_12506 764 83 0
k61_12507 529 56 0
k61_12508 296 25 0
k61_12509 555 44 0
k61_12510 300 31 0
k61_12511 462 32 0
k61_12512 546 58 0
k61_12513 460 37 0
k61_12514 751 79 0
k61_12515 263 23 0
k61_12516 386 21 0
k61_12517 362 20 0
k61_12518 238 10 0
k61_12519 280 15 0
k61_12520 568 50 0
k61_12521 600 55 0
k61_12522 1122 121 0
k61_12523 530 38 0
k61_12524 337 23 0
k61_12525 370 25 0
k61_12526 687 61 0
k61_12527 693 50 0
k61_12528 297 19 0
k61_12529 439 33 0
k61_12530 211 8 0
k61_12532 204 10 0
k61_12533 237 13 0
k61_12535 270 29 0
k61_12536 513 51 0
k61_12537 824 77 0
k61_12538 659 45 0
k61_12539 746 67 0
k61_12540 203 5 0
k61_12541 218 13 0
k61_12542 1422 126 0
k61_12543 200 8 0
k61_12544 822 63 0
k61_12545 279 18 0
k61_12546 757 62 0
k61_12547 225 16 0
k61_12548 1031 112 0
k61_12549 234 13 0
k61_12550 537 45 0
k61_12551 260 27 0
k61_12552 565 61 0
k61_12553 219 6 0
k61_12554 563 46 0
k61_12555 216 15 0
k61_12556 774 60 0
k61_12557 210 14 0
k61_12558 325 26 0
k61_12559 377 14 0
k61_12560 1034 82 0
k61_12561 414 45 0
k61_12563 611 69 0
k61_12564 256 20 0
k61_12566 220 8 0
k61_12567 433 30 0
k61_12568 517 55 0
k61_12569 237 12 0
k61_12571 522 40 0
k61_12572 312 18 0
k61_12573 329 20 0
k61_12574 246 7 0
k61_12575 501 45 0
k61_12576 406 22 0
k61_12578 243 12 0
k61_12580 1213 104 0
k61_12581 263 21 0
k61_12582 408 56 0
k61_12584 562 41 0
k61_12586 1277 98 0
k61_12587 222 9 0
k61_12588 521 44 0
k61_12589 223 16 0
k61_12590 851 77 0
k61_12591 280 110 0
k61_12592 223 6 0
k61_12593 202 18 0
k61_12595 280 68 0
k61_12596 430 30 0
k61_12597 680 80 0
k61_12598 338 20 0
k61_12599 1126 117 0
k61_12600 310 15 0
k61_12601 266 14 0
k61_12602 2361 206 0
k61_12603 333 24 0
k61_12604 700 62 0
k61_12605 519 50 0
k61_12606 257 26 0
k61_12607 266 23 0
k61_12608 249 16 0
k61_12610 301 14 0
k61_12611 1380 139 0
k61_12612 402 36 0
k61_12613 315 17 0
k61_12614 284 14 0
k61_12616 214 15 0
k61_12617 297 22 0
k61_12618 346 25 0
k61_12619 222 10 0
k61_12620 637 71 0
k61_12621 954 82 0
k61_12622 1006 81 0
k61_12623 290 11 0
k61_12624 420 21 0
k61_12625 210 11 0
k61_12626 544 67 0
k61_12627 359 18 0
k61_12628 2526 274 0
k61_12629 280 18 0
k61_12630 271 19 0
k61_12631 293 20 0
k61_12632 204 8 0
k61_12633 255 11 0
k61_12635 213 9 0
k61_12637 405 23 0
k61_12638 290 12 0
k61_12639 631 64 0
k61_12640 579 42 0
k61_12641 243 23 0
k61_12642 373 21 0
k61_12643 212 10 0
k61_12644 418 38 0
k61_12645 255 27 0
k61_12646 474 40 0
k61_12647 253 24 0
k61_12648 494 40 0
k61_12649 438 35 0
k61_12650 231 15 0
k61_12651 594 33 0
* 0 0 298465
Sequencing is often used to determine "who" and/or "what" is in your sample. In our case, we know that the HMP mock community should orignate from a set of genomes (which we actually downlaoded above). One of the most popular tools of comparing an unknown sequence to a known reference is The Basic Local Alignment Search Tool (or BLAST). To identify the origin of our contigs, we will align assembled contigs to the genomes used in the HMP mock community.
The first thing we will do is download the BLAST software. Given the increasing volume of sequencing datasets, one may also consider new tools for more efficient annotation are now available such as Diamond (https://github.com/bbuchfink/diamond/, http://dx.doi.org/10.1038/nmeth.3176).
In [40]:
!wget ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-x64-linux.tar.gz
!tar -xvf ncbi-blast-2.2.30+-x64-linux.tar.gz
--2015-06-26 14:20:56-- ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-x64-linux.tar.gz
=> ‘ncbi-blast-2.2.30+-x64-linux.tar.gz’
Resolving ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)... 130.14.250.12, 2607:f220:41e:250::11
Connecting to ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)|130.14.250.12|:21... connected.
Logging in as anonymous ... Logged in!
==> SYST ... done. ==> PWD ... done.
==> TYPE I ... done. ==> CWD (1) /blast/executables/blast+/2.2.30 ... done.
==> SIZE ncbi-blast-2.2.30+-x64-linux.tar.gz ... 172818286
==> PASV ... done. ==> RETR ncbi-blast-2.2.30+-x64-linux.tar.gz ... done.
Length: 172818286 (165M) (unauthoritative)
100%[======================================>] 172,818,286 164MB/s in 1.0s
2015-06-26 14:20:57 (164 MB/s) - ‘ncbi-blast-2.2.30+-x64-linux.tar.gz’ saved [172818286]
ncbi-blast-2.2.30+/
ncbi-blast-2.2.30+/LICENSE
ncbi-blast-2.2.30+/ChangeLog
ncbi-blast-2.2.30+/ncbi_package_info
ncbi-blast-2.2.30+/doc/
ncbi-blast-2.2.30+/doc/README.txt
ncbi-blast-2.2.30+/README
ncbi-blast-2.2.30+/bin/
ncbi-blast-2.2.30+/bin/tblastn
ncbi-blast-2.2.30+/bin/blastdbcheck
ncbi-blast-2.2.30+/bin/blast_formatter
ncbi-blast-2.2.30+/bin/deltablast
ncbi-blast-2.2.30+/bin/tblastx
ncbi-blast-2.2.30+/bin/blastp
ncbi-blast-2.2.30+/bin/makeblastdb
ncbi-blast-2.2.30+/bin/blastn
ncbi-blast-2.2.30+/bin/windowmasker
ncbi-blast-2.2.30+/bin/blastdbcmd
ncbi-blast-2.2.30+/bin/makembindex
ncbi-blast-2.2.30+/bin/makeprofiledb
ncbi-blast-2.2.30+/bin/update_blastdb.pl
ncbi-blast-2.2.30+/bin/blastdb_aliastool
ncbi-blast-2.2.30+/bin/dustmasker
ncbi-blast-2.2.30+/bin/psiblast
ncbi-blast-2.2.30+/bin/rpsblast
ncbi-blast-2.2.30+/bin/rpstblastn
ncbi-blast-2.2.30+/bin/convert2blastmask
ncbi-blast-2.2.30+/bin/blastx
ncbi-blast-2.2.30+/bin/segmasker
ncbi-blast-2.2.30+/bin/legacy_blast.pl
Now, we will make a searchable database for the BLAST software. First, we'll concatenate all the genomes in the genomes directory to one file.
In [41]:
!cat genomes/*fa >> all-genomes.fa
!ncbi-blast-2.2.30+/bin/makeblastdb -in all-genomes.fa -dbtype nucl -out all-genomes
!ncbi-blast-2.2.30+/bin/blastn -db all-genomes -query megahit_assembly/final.contigs.fa -outfmt 6 -out contigs.x.all-genomes.blastnout
Building a new DB, current time: 06/26/2015 14:21:06
New DB name: all-genomes
New DB title: all-genomes.fa
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1000000000B
Adding sequences from FASTA; added 60 sequences in 1.84624 seconds.
The above command aligns each query (each sequence in the assembled final.contings.fa file) with each sequence (e.g., genome in all-genomes.fa). The -outfmt tells the program to save the results in a tab-delimited format in the -out file contigs.x.all-genomes.blastnout.
Let's take a look at the first 10 lines of that file. You'll see the query (contig) and the hit (genome) followed by the percent identity, the length of alignment, mismatch counts, gap open counts, query start position, query end position, subject start position, subject end position, E-value, and bit score.
In [42]:
!head -n 10 contigs.x.all-genomes.blastnout
k61_2 gi|27466918|ref|NC_004461.1| 100.00 218 0 0 1 218 1986675 1986892 5e-112 403
k61_2 gi|27466918|ref|NC_004461.1| 100.00 218 0 0 1 218 1986675 1986892 5e-112 403
k61_3 gi|24378532|ref|NC_004350.1| 100.00 206 0 0 1 206 1898492 1898697 2e-105 381
k61_3 gi|24378532|ref|NC_004350.1| 100.00 206 0 0 1 206 1898492 1898697 2e-105 381
k61_4 gi|32470532|ref|NC_005004.1| 95.31 256 12 0 1 256 10969 10714 4e-113 407
k61_4 gi|32470532|ref|NC_005004.1| 95.31 256 12 0 1 256 10969 10714 4e-113 407
k61_4 gi|32470555|ref|NC_005005.1| 92.58 256 19 0 1 256 10016 10271 2e-101 368
k61_4 gi|32470555|ref|NC_005005.1| 92.58 256 19 0 1 256 10016 10271 2e-101 368
k61_5 gi|24378532|ref|NC_004350.1| 100.00 258 0 0 1 258 928208 928465 3e-134 477
k61_5 gi|24378532|ref|NC_004350.1| 100.00 258 0 0 1 258 928208 928465 3e-134 477
Depending on your scientific question, it may be of more interest to have open reading frames (ORFs) annotated rather than contig sequences. In this case, there exist multiple ORF callers (e.g., FragGeneScan, http://nar.oxfordjournals.org/content/early/2010/08/29/nar.gkq747.abstract and Metagene, http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1636498/) that can be used. We can call ORFs from our contigs using FragGeneScan. We will download, install, and then call ORFs from our contigs as follows:
In [43]:
!wget http://downloads.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz
!tar -xvf FragGeneScan1.19.tar.gz
--2015-06-26 14:21:15-- http://downloads.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz
Resolving downloads.sourceforge.net (downloads.sourceforge.net)... 216.34.181.59
Connecting to downloads.sourceforge.net (downloads.sourceforge.net)|216.34.181.59|:80... connected.
HTTP request sent, awaiting response... 302 Found
Location: http://iweb.dl.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz [following]
--2015-06-26 14:21:15-- http://iweb.dl.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz
Resolving iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)... 70.38.0.134, 2607:f748:10:12::5f:2
Connecting to iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)|70.38.0.134|:80... connected.
HTTP request sent, awaiting response... 200 OK
Length: 11371331 (11M) [application/x-gzip]
Saving to: ‘FragGeneScan1.19.tar.gz’
100%[======================================>] 11,371,331 674KB/s in 15s
2015-06-26 14:21:30 (738 KB/s) - ‘FragGeneScan1.19.tar.gz’ saved [11371331/11371331]
FragGeneScan1.19/
FragGeneScan1.19/post_process.pl
FragGeneScan1.19/run_FragGeneScan.pl
FragGeneScan1.19/hmm.h
FragGeneScan1.19/README
FragGeneScan1.19/hmm_lib.c
FragGeneScan1.19/Makefile
FragGeneScan1.19/run_hmm.c
FragGeneScan1.19/example/
FragGeneScan1.19/example/NC_000913.test.454.5.gff
FragGeneScan1.19/example/NC_000913.test.ffn
FragGeneScan1.19/example/NC_000913.test.out
FragGeneScan1.19/example/NC_000913.test.gff
FragGeneScan1.19/example/NC_000913-454.test.gff
FragGeneScan1.19/example/NC_000913.test.454.5.out
FragGeneScan1.19/example/NC_000913-454.test.out
FragGeneScan1.19/example/NC_000913.test.454.5.faa
FragGeneScan1.19/example/NC_000913-454.fna
FragGeneScan1.19/example/NC_000913.fna
FragGeneScan1.19/example/NC_000913.test.454.5.ffn
FragGeneScan1.19/example/NC_000913-454.test.ffn
FragGeneScan1.19/example/NC_000913.test.faa
FragGeneScan1.19/example/NC_000913-454.test.faa
FragGeneScan1.19/util_lib.h
FragGeneScan1.19/util_lib.c
FragGeneScan1.19/FGS_gff.py
FragGeneScan1.19/train/
FragGeneScan1.19/train/illumina_10
FragGeneScan1.19/train/454_5
FragGeneScan1.19/train/pwm
FragGeneScan1.19/train/454_30
FragGeneScan1.19/train/rgene
FragGeneScan1.19/train/stop1
FragGeneScan1.19/train/noncoding
FragGeneScan1.19/train/complete
FragGeneScan1.19/train/start
FragGeneScan1.19/train/454_10
FragGeneScan1.19/train/start1
FragGeneScan1.19/train/illumina_5
FragGeneScan1.19/train/sanger_10
FragGeneScan1.19/train/gene
FragGeneScan1.19/train/illumina_1
FragGeneScan1.19/train/stop
FragGeneScan1.19/train/sanger_5
In [44]:
!bash fraggenescan-install.sh
rm -rf *.o FragGeneScan* *~
gcc -c -o util_lib.o util_lib.c
gcc -c -o hmm_lib.o hmm_lib.c
gcc -c -o run_hmm.o run_hmm.c
gcc -O3 -o FragGeneScan util_lib.o hmm_lib.o run_hmm.o -lm -lpthread
We will run FragGeneScan on the assembled contigs, assuming that it fits the training profile of a "complete" genome sequence (in their documentaion, this equals complete genomic sequences or short sequence reads without sequencing error).
In [45]:
!FragGeneScan1.19/FragGeneScan -s megahit_assembly/final.contigs.fa -o final.contigs.orfs.fa -w 1 -t complete
no. of seqs: 11345
The ORFs called are contained as FASTA files in final.contigs.orfs.fa.faa (amino acids) and final.contigs.orfs.fa.ffn (nucleotides). You can annotate these against a database of your choice just as described for the contigs above.
Now you have all the information you need to produce the following information:
You'll note that this is similar to 16S rRNA amplicon analysis where you'd have an OTU abundance table and OTU best hit annotations. For metagenomic analysis, this information takes you into further analysis and visualization packages like PhyloSeq in R (http://joey711.github.io/phyloseq/).
Once you run through this tutorial on this workbook, a good exercise would be to try to run the assembly outside the IPython Notebook environment. To do so, you can log into your EC2 instance, navigate to the directory where this data is stored (cd /mnt/frontiers-review-2015), and you could run every command in this notebook on the command line (with the exception of the "!" at the beginning of each command in the notebook. Also, note that you will not have to reinstall the software.
In [ ]:
Content source: germs-lab/frontiers-review-2015
Similar notebooks: