Nucleotide Count

Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.

The genetic language of every living thing on the planet is DNA. DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides. 4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.

Here is an analogy:

twigs are to birds nests as
nucleotides are to DNA as
legos are to lego houses as
words are to sentences as... ## Source

The Calculating DNA Nucleotides_problem at Rosalind http://rosalind.info/problems/dna/

Version compatibility

This exercise has been tested on Julia versions >=1.0.

Submitting Incomplete Solutions

It's possible to submit an incomplete solution so you can see how others have completed the exercise.

Your solution



In [ ]:

    
# submit
function count_nucleotides(strand::AbstractString)

end

Test suite



In [ ]:

    
using Test

# include("nucleotide-count.jl")

@testset "empty strand" begin
    @test count_nucleotides("") == Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
end

@testset "strand with repeated nucleotide" begin
    @test count_nucleotides("GGGGGGG") == Dict('A' => 0, 'C' => 0, 'G' => 7, 'T' => 0)
end

@testset "strand with multiple nucleotides" begin
    @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") == Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
end

@testset "strand with invalid nucleotides" begin
    @test_throws DomainError count_nucleotides("AGXXACT")
end

Prepare submission

To submit your exercise, you need to save your solution in a file called nucleotide-count.jl before using the CLI. You can either create it manually or use the following functions, which will automatically write every notebook cell that starts with # submit to the file nucleotide-count.jl.



In [ ]:

    
# using Pkg; Pkg.add("Exercism")
# using Exercism
# Exercism.create_submission("nucleotide-count")