ADN


ADN

Cadena inversa

Primer programa


In [1]:
cadena = 'ACGCGTACTAATCGTACTGACT'
inversa = cadena[::-1]
print inversa


TCAGTCATGCTAATCATGCGCA

1ª mejora: Entrada de datos


In [ ]:
cadena = raw_input()
inversa = cadena[::-1]
print inversa

2ª mejora: Comunicación con el usuario


In [ ]:
cadena = raw_input('Escriba una cadena de ADN: ')
inversa = cadena[::-1]
print 'La inversa es: %s'%inversa

3ª mejora: Evitar errores


In [ ]:
cadena = raw_input('Escriba una cadena de ADN: ')
cadena = cadena.upper()
for i in cadena:
    if i not in ['A','T','C','G']:
        print 'DNAException: Nucleotide not A, T, C or G'
        break
else:
    inversa = cadena[::-1]
    print 'La inversa es: %s'%inversa


Escriba una cadena de ADN: gtcagttagtgcat
TACGTGATTGACTG

Cadena complementaria

Primer programa


In [4]:
cadena = raw_input('Escriba una cadena de ADN: ')
cadena = cadena.upper()
complementaria = ''
for nuc in cadena:
    if nuc == 'A': complementaria += 'T'
    if nuc == 'T': complementaria += 'A'
    if nuc == 'C': complementaria += 'G'
    if nuc == 'G': complementaria += 'C'
print complementaria


Escriba una cadena de ADN: CAGCTACGTA
GTCGATGCAT

1ª mejora:


In [ ]: