Bam slicing in a cloud hosted jupyter notebook.

Welcome to the ‘Query of the Month’. This is part of our collection of new and interesting queries to demonstrate the powerful combination of BigData from the NCI cancer programs like TCGA, and BigQuery from Google.

Please let us know if you have an idea or a suggestion for our next QotM!

Query of the Month is produced by:

David L Gibbs (david.gibbs ( ~ at ~ ) systemsbiology ( ~ dot ~ ) org) Kawther Abdilleh (kawther.abdilleh ( ~ at ~ ) gdit (~ dot ~) com) Sheila M Reynolds (sheila.reynolds ( ~ at ~ ) systemsbiology ( ~ dot ~ ) org)

In this notebook, using the Pysam package, we demonstrate how to slice bam files stored in GCS buckets.

Here, you'll learn how to:

  1. How to invoke bash commands within a Jupyter environment.
  2. How to install packages/programs within a Jupyter environment
  3. How to use available BigQuery tables within ISB-CGC to query and identify Google Cloud Storage bucket locations for BAM files of interest
  4. How to use PySam to slice BAM files
  5. How to save slices in your bucket and retrieve them
  6. Brief example of working with reads

Let's authenticate ourselves


In [0]:
from google.colab import auth
auth.authenticate_user()
print('Authorized')


Authorized

First, let's prep to install Pysam and the HTSlib

Pysam is a python wrapper around samtools, and samtools uses the HTSlib (http://www.htslib.org/). So we need to make sure we have the necessary libraries to compile HTSlib and samtools. The compilation is needed to activate the ability to read from google cloud buckets.


In [0]:
import os
os.environ['HTSLIB_CONFIGURE_OPTIONS'] = "--enable-gcs"

We can invoke bash commands to see what was downloaded into our current working directory. Bash commands can be invoked by putting an exclamation point (!) before the command.


In [0]:
!ls -lha


total 28K
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .
drwxr-xr-x 1 root root 4.0K Jan 29 23:14 ..
-rw-r--r-- 1 root root 2.6K Jan 29 23:16 adc.json
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .config
drwxr-xr-x 1 root root 4.0K Jan 28 17:05 sample_data

In [0]:
!sudo apt-get install autoconf automake make gcc perl zlib1g-dev libbz2-dev liblzma-dev libcurl4-openssl-dev libssl-dev


Reading package lists... Done
Building dependency tree       
Reading state information... Done
liblzma-dev is already the newest version (5.2.2-1.3).
liblzma-dev set to manually installed.
make is already the newest version (4.1-9.1ubuntu1).
make set to manually installed.
zlib1g-dev is already the newest version (1:1.2.11.dfsg-0ubuntu2).
zlib1g-dev set to manually installed.
gcc is already the newest version (4:7.3.0-3ubuntu2.1).
gcc set to manually installed.
perl is already the newest version (5.26.1-6ubuntu0.3).
perl set to manually installed.
The following additional packages will be installed:
  autotools-dev bzip2-doc libsigsegv2 libssl-doc libssl1.1 m4
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc libtool gettext libcurl4-doc
  libidn11-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev m4-doc
The following NEW packages will be installed:
  autoconf automake autotools-dev bzip2-doc libbz2-dev libcurl4-openssl-dev
  libsigsegv2 libssl-dev libssl-doc m4
The following packages will be upgraded:
  libssl1.1
1 upgraded, 10 newly installed, 0 to remove and 12 not upgraded.
Need to get 5,459 kB of archives.
After this operation, 17.4 MB of additional disk space will be used.
Get:1 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl1.1 amd64 1.1.0g-2ubuntu4.3 [1,130 kB]
Get:2 http://archive.ubuntu.com/ubuntu bionic/main amd64 libsigsegv2 amd64 2.12-1 [14.7 kB]
Get:3 http://archive.ubuntu.com/ubuntu bionic/main amd64 m4 amd64 1.4.18-1 [197 kB]
Get:4 http://archive.ubuntu.com/ubuntu bionic/main amd64 autoconf all 2.69-11 [322 kB]
Get:5 http://archive.ubuntu.com/ubuntu bionic/main amd64 autotools-dev all 20180224.1 [39.6 kB]
Get:6 http://archive.ubuntu.com/ubuntu bionic/main amd64 automake all 1:1.15.1-3ubuntu2 [509 kB]
Get:7 http://archive.ubuntu.com/ubuntu bionic/main amd64 bzip2-doc all 1.0.6-8.1 [294 kB]
Get:8 http://archive.ubuntu.com/ubuntu bionic/main amd64 libbz2-dev amd64 1.0.6-8.1 [29.5 kB]
Get:9 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libcurl4-openssl-dev amd64 7.58.0-2ubuntu3.5 [294 kB]
Get:10 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl-dev amd64 1.1.0g-2ubuntu4.3 [1,374 kB]
Get:11 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl-doc all 1.1.0g-2ubuntu4.3 [1,255 kB]
Fetched 5,459 kB in 2s (3,134 kB/s)
debconf: unable to initialize frontend: Dialog
debconf: (No usable dialog-like program is installed, so the dialog based frontend cannot be used. at /usr/share/perl5/Debconf/FrontEnd/Dialog.pm line 76, <> line 11.)
debconf: falling back to frontend: Readline
debconf: unable to initialize frontend: Readline
debconf: (This frontend requires a controlling tty.)
debconf: falling back to frontend: Teletype
dpkg-preconfigure: unable to re-open stdin: 
(Reading database ... 110851 files and directories currently installed.)
Preparing to unpack .../00-libssl1.1_1.1.0g-2ubuntu4.3_amd64.deb ...
Unpacking libssl1.1:amd64 (1.1.0g-2ubuntu4.3) over (1.1.0g-2ubuntu4.1) ...
Selecting previously unselected package libsigsegv2:amd64.
Preparing to unpack .../01-libsigsegv2_2.12-1_amd64.deb ...
Unpacking libsigsegv2:amd64 (2.12-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../02-m4_1.4.18-1_amd64.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../03-autoconf_2.69-11_all.deb ...
Unpacking autoconf (2.69-11) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../04-autotools-dev_20180224.1_all.deb ...
Unpacking autotools-dev (20180224.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../05-automake_1%3a1.15.1-3ubuntu2_all.deb ...
Unpacking automake (1:1.15.1-3ubuntu2) ...
Selecting previously unselected package bzip2-doc.
Preparing to unpack .../06-bzip2-doc_1.0.6-8.1_all.deb ...
Unpacking bzip2-doc (1.0.6-8.1) ...
Selecting previously unselected package libbz2-dev:amd64.
Preparing to unpack .../07-libbz2-dev_1.0.6-8.1_amd64.deb ...
Unpacking libbz2-dev:amd64 (1.0.6-8.1) ...
Selecting previously unselected package libcurl4-openssl-dev:amd64.
Preparing to unpack .../08-libcurl4-openssl-dev_7.58.0-2ubuntu3.5_amd64.deb ...
Unpacking libcurl4-openssl-dev:amd64 (7.58.0-2ubuntu3.5) ...
Selecting previously unselected package libssl-dev:amd64.
Preparing to unpack .../09-libssl-dev_1.1.0g-2ubuntu4.3_amd64.deb ...
Unpacking libssl-dev:amd64 (1.1.0g-2ubuntu4.3) ...
Selecting previously unselected package libssl-doc.
Preparing to unpack .../10-libssl-doc_1.1.0g-2ubuntu4.3_all.deb ...
Unpacking libssl-doc (1.1.0g-2ubuntu4.3) ...
Setting up libbz2-dev:amd64 (1.0.6-8.1) ...
Setting up libsigsegv2:amd64 (2.12-1) ...
Setting up m4 (1.4.18-1) ...
Processing triggers for libc-bin (2.27-3ubuntu1) ...
Setting up autotools-dev (20180224.1) ...
Setting up bzip2-doc (1.0.6-8.1) ...
Setting up libssl1.1:amd64 (1.1.0g-2ubuntu4.3) ...
debconf: unable to initialize frontend: Dialog
debconf: (No usable dialog-like program is installed, so the dialog based frontend cannot be used. at /usr/share/perl5/Debconf/FrontEnd/Dialog.pm line 76.)
debconf: falling back to frontend: Readline
Processing triggers for man-db (2.8.3-2ubuntu0.1) ...
Setting up libssl-doc (1.1.0g-2ubuntu4.3) ...
Setting up libcurl4-openssl-dev:amd64 (7.58.0-2ubuntu3.5) ...
Setting up libssl-dev:amd64 (1.1.0g-2ubuntu4.3) ...
Setting up autoconf (2.69-11) ...
Setting up automake (1:1.15.1-3ubuntu2) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Processing triggers for libc-bin (2.27-3ubuntu1) ...

In [0]:
!pip3 install pysam -v --force-reinstall --no-binary :all:

# Without forcing the compilation, we get error 
# [Errno 93] could not open alignment file '...': Protocol not supported


Created temporary directory: /tmp/pip-ephem-wheel-cache-grc7x9pg
Created temporary directory: /tmp/pip-req-tracker-_0vdrlxw
Created requirements tracker '/tmp/pip-req-tracker-_0vdrlxw'
Created temporary directory: /tmp/pip-install-4mbemz89
Collecting pysam
  1 location(s) to search for versions of pysam:
  * https://pypi.org/simple/pysam/
  Getting page https://pypi.org/simple/pysam/
  Looking up "https://pypi.org/simple/pysam/" in the cache
  Request header has "max_age" as 0, cache bypassed
  Starting new HTTPS connection (1): pypi.org:443
  https://pypi.org:443 "GET /simple/pysam/ HTTP/1.1" 200 9072
  Updating cache with response from "https://pypi.org/simple/pysam/"
  Caching due to etag
  Analyzing links from page https://pypi.org/simple/pysam/
    Found link https://files.pythonhosted.org/packages/7f/ce/e9405fcf72096f78dc7d75e8ce2a1cd907e1b4a9af0dbf1fc4dac5770f81/pysam-0.4.tar.gz#sha256=d8d437fadc283be6fc96f932a1417c43f5fb0a7cf267f8a750e819aa2babe1c5 (from https://pypi.org/simple/pysam/), version: 0.4
    Found link https://files.pythonhosted.org/packages/df/58/508dc40f603551d34b815560d52d9532dd243f1a8c35d9317ebff15d27e7/pysam-0.4.1.tar.gz#sha256=4a358266f93c103e4f003ae9a539fef1d91f572a6cbe7ace9a03ea220712d195 (from https://pypi.org/simple/pysam/), version: 0.4.1
    Found link https://files.pythonhosted.org/packages/64/7b/09ff2b61c7600a5aefd7ee0c37cec60140d31f8194d237e1d63c4d457931/pysam-0.7.6.tar.gz#sha256=d082ee3c8d7f105968719170956456d3660ef3a199bf53f9667f959ca4d11200 (from https://pypi.org/simple/pysam/), version: 0.7.6
    Found link https://files.pythonhosted.org/packages/46/b5/877f40fbb84f588b69b4afcb1409b8bdeed7ef980113d3e8ef69bab26e09/pysam-0.7.7.tar.gz#sha256=c9f3018482eec99ee199dda3fdef2aa7424dde6574672a4c0d209a10985755cc (from https://pypi.org/simple/pysam/), version: 0.7.7
    Found link https://files.pythonhosted.org/packages/b5/0f/436d15f08096dd9869a956e502fd119c15efbd84896aa53df50c7c6c0e13/pysam-0.7.8.tar.gz#sha256=d5deb64156ced1b95799854d8e9d5acdea1b2c9fdb7ffc3348e599a907bb810a (from https://pypi.org/simple/pysam/), version: 0.7.8
    Found link https://files.pythonhosted.org/packages/a4/ea/901d47d5621f15c05079dcf45e746a77bab21dbf0f9ce272993a3ca3a367/pysam-0.8.0.tar.gz#sha256=50cb6a68ce18eec604a6ef10fd6e85d4b836aa570758acbe02c54e0ff51bf282 (from https://pypi.org/simple/pysam/), version: 0.8.0
    Found link https://files.pythonhosted.org/packages/0e/4a/d1625792b2fd3a172d4bad096ab1559bcb7a81fa5fa6f9bc3937de23340d/pysam-0.8.1.tar.gz#sha256=a9105a1aa65f5a93e1e2cfb0e3009190b7a8a82ad7fb29cceaaaffbba08966b9 (from https://pypi.org/simple/pysam/), version: 0.8.1
    Found link https://files.pythonhosted.org/packages/10/42/7f51e1ad0c283e1d6bf826d3a193fa0644e675c9c6d42263b69fefc3b527/pysam-0.8.2.tar.gz#sha256=90cf4c05358b8e545f4f00c0637488d85b78d6170af093cd1e4762128b6427f2 (from https://pypi.org/simple/pysam/), version: 0.8.2
    Found link https://files.pythonhosted.org/packages/07/6b/3f48a2f05fbde46f2c52fc5f9adc15d928951cd54035109d553e14b774c7/pysam-0.8.2.1.tar.gz#sha256=8dc442b5b185bda37be8c3053b7f4fac438e3836dc2b190254d666d67ebb3a03 (from https://pypi.org/simple/pysam/), version: 0.8.2.1
    Found link https://files.pythonhosted.org/packages/f9/b9/8cfad46376335001f0cbbc46bf402fa107b0e8af8fe9e4192702b251f628/pysam-0.8.3.tar.gz#sha256=343e91a1882278455ef9a5f3c9fc4921c37964341785bf22432381d18e6d115e (from https://pypi.org/simple/pysam/), version: 0.8.3
    Found link https://files.pythonhosted.org/packages/27/89/bf8c44d0bfe9d0cadab062893806994c168c9f490f67370fc56d6e8ba224/pysam-0.8.4.tar.gz#sha256=30cf23931edf8a426678811f234bca4a83a53438028b323f2ef55792562d9dea (from https://pypi.org/simple/pysam/), version: 0.8.4
    Found link https://files.pythonhosted.org/packages/0f/37/fa514cb2163997551e95f63ec12f7bec7b640a601456f1d0ab3ab900c05f/pysam-0.9.0.tar.gz#sha256=90edf568835245e03eea176196cfafdfcb3af7e5fb40e48923a63f75c266c03c (from https://pypi.org/simple/pysam/), version: 0.9.0
    Found link https://files.pythonhosted.org/packages/40/15/20b22dc3d017ec123e533d062b982b111b0214168905de3221b5caf5f766/pysam-0.9.1.tar.gz#sha256=2969e080d435c62c4dd497294dfdb36eb92cd31f551c1030c0159481a5ef101e (from https://pypi.org/simple/pysam/), version: 0.9.1
    Found link https://files.pythonhosted.org/packages/f7/ae/59341d9fd2bed1cc32225115fc3f866a0e4e020f31073d698785c956360f/pysam-0.9.1.1.tar.gz#sha256=c3c106fc5e93f226d7830bbb4bb2c7238a993ef7de07c627f90944140a997d3d (from https://pypi.org/simple/pysam/), version: 0.9.1.1
    Found link https://files.pythonhosted.org/packages/76/62/908776209238850eca22e7139cc23ce2ba14b2941ceb438b1572f84e8d82/pysam-0.9.1.2.tar.gz#sha256=da49d15c3adca67c46d0aa418e8d2b27d1667890a444886dd95d6da55e6e5e2b (from https://pypi.org/simple/pysam/), version: 0.9.1.2
    Found link https://files.pythonhosted.org/packages/e7/e9/db49c8bd39673c1f48200f69ccc34784016d664136f36e03a090411a95fc/pysam-0.9.1.3.tar.gz#sha256=137fa5e288284e3708a7287ad9b4d08c0f069af8da5811e575e9aeabdcfa227b (from https://pypi.org/simple/pysam/), version: 0.9.1.3
    Found link https://files.pythonhosted.org/packages/de/03/02934438b204565bc5231f38a11da840a3c3e4b2beac8c8770d675770668/pysam-0.9.1.4.tar.gz#sha256=56ee7f8d07fa9d78b5c00dfbf335c95edbfed1518a2c14f8f108e58599922dc4 (from https://pypi.org/simple/pysam/), version: 0.9.1.4
    Skipping link https://files.pythonhosted.org/packages/29/5a/0b25d6d734e1797c7ce06442ff6714af53cb1c8cd6c6cfd1a32df4587e33/pysam-0.10.0-cp27-cp27m-manylinux1_x86_64.whl#sha256=7fe3ee09e9eb70887f04900ce9444ab52ad16b78b85be6e3b1857a14b2ee36f9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/72/d2/d106b2fc317e838f7eea7140c8d0ad4df4fde6a456a526649a58397f638c/pysam-0.10.0-cp27-cp27mu-manylinux1_x86_64.whl#sha256=01b3c10052c561f9dacf98478ef7195dc68a92706eb6d279c8fdc3c0ef14629a (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0c/55/d775726477bfe55e06c88701c8cf9a4b2596a877b09e562551c00cf4a931/pysam-0.10.0-cp34-cp34m-manylinux1_x86_64.whl#sha256=e2b86a6aac3df4fd5f658604af934c7fce61ba4ade188d1af1c17cce17d38094 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/89/ea/01735cceef15296bad16873979ae6848efebbbc9ab20eba244d532846dbf/pysam-0.10.0-cp35-cp35m-manylinux1_x86_64.whl#sha256=a2838dc68f6ec91957347c8e286bec9d2a8557ae44bc59232aefc6c5a7a25e81 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/8a/09/526378006226fb39eb54d9935c407c9b3c0302792c89e50d6b4f14d6f4b8/pysam-0.10.0-cp36-cp36m-manylinux1_x86_64.whl#sha256=81e3a70c6801b92714123d576f23aab792f5111a49282f7c050fd2620d38e465 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/87/8e/d2d8238558970df37c7aa01ddec63057a98042334e939b4c1c69cb9a2504/pysam-0.10.0.tar.gz#sha256=1e925d2c9bf7b1753392da4fee3c0c184f8b062acd074905caa20569f87354e0 (from https://pypi.org/simple/pysam/), version: 0.10.0
    Skipping link https://files.pythonhosted.org/packages/93/f5/bfca0394bb90cc5993b7595d7c6aeebfc43dce8bf97394df4bfba9141caf/pysam-0.11-cp27-cp27m-manylinux1_x86_64.whl#sha256=0196588bf9a2d499abf1882e3c04431dc81faaa4432feddd6eb03fe7a430a62e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/4b/ff/7e0c6169883a26cee912ce25ef98893c13966cce1064fd6136b53e28d365/pysam-0.11-cp27-cp27mu-manylinux1_x86_64.whl#sha256=9de9d06f2de8949d062cd995bee982940283c309426d7ee287a2de22e3b2e92e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/39/ba/91614d3e18818011decdb5cda8991cea11330d274399492822fb50b7478e/pysam-0.11-cp34-cp34m-manylinux1_x86_64.whl#sha256=f3280509966dbc44e1d5669ce9fe523e67eebe970f304e626f210df999b12731 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/3e/6f/2b166df4d7d55e2f69551b85ec2bba01048e5dc2307163ab8ad7d694bde1/pysam-0.11-cp35-cp35m-manylinux1_x86_64.whl#sha256=1943e27e8584dacbd1098fc17b55c6fc80765c1df6b9fb4844d3925232453afe (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0b/28/cd6fde9c19444f779130e27195b4c1d9d896266e4e0b0bc8d515c031854f/pysam-0.11-cp36-cp36m-manylinux1_x86_64.whl#sha256=4f598c325cefba2b09adc53e4e7fd669f6855ab6db52f27ff4d73da48bc2b2a9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/f4/bb/c5fcaace8857bdf8a430de41b5298c602fdce4917494f7a941c038e5861a/pysam-0.11.tar.gz#sha256=815c8a6150c5fe21df227e730dd57e4212984ae568854fcc5873e243072dcbad (from https://pypi.org/simple/pysam/), version: 0.11
    Skipping link https://files.pythonhosted.org/packages/81/01/2304e5367c566f538cf64bad1bd41ec41e47d8aeefd197a209c8c1cf14fa/pysam-0.11.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=4ade89003f13c6eb6b243c76eb782b2bcf3f8320a7675758b553d7c2e7214743 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/ef/b3/b7ea200fc6e16af0cd2397659a2a2dd383f4ea71d2e0948f7215e73fb6a6/pysam-0.11.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=5a4ac394b644c7cb9782351aff7e782c7f4c670df54c0bb170fa36c10e1a5c86 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/e5/00/0d55946c0b1c781caee096ef9c4e9e54047ecf897874bf791c5ea8351df3/pysam-0.11.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=19f37b28ec1f5125a47080ea2b87cd801a8cf3c67dd4f2a872cfd0ecb6673ecb (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/45/2a/b5e9e88b0d5097fa45f0832a05acfb39879679a087e55145198d47bb6099/pysam-0.11.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=ec38dddadc0c6cbcbfc38f481ffbb33f888a91665a29bca10077a4380eeb4aae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/6e/0e/967ed910f8ce74ed5ea6b7a4775a86d05205963bf927a8452604ad277913/pysam-0.11.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=1663730a69bfe7e84e7dcd9bcc3a35d8d2ad2c023746f1806b678e294fe21b8a (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/be/70/16cdd6c5ef799b2db2af4fd5f9720df0f3206b0a06ed40e03692aa80ae25/pysam-0.11.1.tar.gz#sha256=fbc710f82cb4334b3b88be9b7a9781547456fdcb2135755b68e041e96fc28de1 (from https://pypi.org/simple/pysam/), version: 0.11.1
    Found link https://files.pythonhosted.org/packages/89/d9/52995323a3a15e14f2cd579a49f953c804b36a1a7d7dc09a08b7de3591d2/pysam-0.11.2.tar.gz#sha256=d64e1b5b6b0aeac2effa7f9f6117f5413ccf6a0028935d45491a1553154a17b1 (from https://pypi.org/simple/pysam/), version: 0.11.2
    Skipping link https://files.pythonhosted.org/packages/8f/23/12b4829036ce49ec068c61a28057029dd19a6a1a29855dff0efb785e0d12/pysam-0.11.2.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=da2dc02fc9d92ed72bdcf22e03e06ba06c6119c858b1de5cec992e2e98977ea5 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0a/d8/daa0986a5049b66b4ab2fc8093a17a961cedc75d1a39e1a4821d19f4f13f/pysam-0.11.2.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=713e897ab7e3a82cb92a0a5fda1fd7e968c75a4d990c778e2433cf6f10d12b2f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/34/5f/254cec485fedd72269c061262eb2bc36f8a438a5badb78c8582e46905623/pysam-0.11.2.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=89d1715f90e65ffce7dfca7fa5040b8965b6324f1b343ebd540500eed9c1862b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/c3/cc/47ae71c341bd822dfeec2148f6521c1bba690e4581814114519b3cc611d4/pysam-0.11.2.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=acbfdffa8dae9dd3569af65569639694f128a598691ec471de3c54e3831baee4 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/c7/b0/4acf13c3b125db232e8ed93fec3e5b3a90abe47fd27aaacc15c9e03caf6f/pysam-0.11.2.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=71f2c4ef61ac64954bf1fdfcf6ea1912350145ede753db10e04fb3d87ffec2e2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/4b/d2/152284e08c551471c7a7b9b23b4d0916637705ee4f979314ca1750b37c83/pysam-0.11.2.1.tar.gz#sha256=5de4744e451652db70bfd5494606fde8d4c58d3ae55b9816329dc905c80a7c60 (from https://pypi.org/simple/pysam/), version: 0.11.2.1
    Skipping link https://files.pythonhosted.org/packages/24/dd/2a9226b90d8c98482209617c2376434e1c19da4981de49c78af0e763988f/pysam-0.11.2.2-cp27-cp27m-manylinux1_x86_64.whl#sha256=e7826460c3178ff35e91b511a8fb3e978fc916c3e1d9b388eb9f62bb51410b58 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0d/9d/d30859cf5a7555719e9b28d34f61bbd4ef0e811fb8a857a986ee9913b79a/pysam-0.11.2.2-cp27-cp27mu-manylinux1_x86_64.whl#sha256=7af66c50f7766419ad458f55b0349597361a38eb45b7d98e3730863f60d7d4ae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/d8/34/b0a7ece94bf7af7d482282ccd8430fe291147960d900b514b7aa606c9170/pysam-0.11.2.2-cp34-cp34m-manylinux1_x86_64.whl#sha256=6a86f8ed81ceae1122edfcff65329b260a359ed601a657f47f33f7009d8c2516 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/9d/a0/2bc18552108cf9605e0ffa7c31673bc56653c0cd7521730a2d5eeb06939f/pysam-0.11.2.2-cp35-cp35m-manylinux1_x86_64.whl#sha256=8362ef266063047d156770ae2bff875aa7ec0d906b8b298479705e6117370f6f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/23/c0/18436ad1db0ed38c997b7fda42db8b6489c50abcb321320015de12bdd164/pysam-0.11.2.2-cp36-cp36m-manylinux1_x86_64.whl#sha256=ee5126b00628fd959cb99d4ff196493c0bc952f51dcb558f4154407c3d31a10b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/a4/1b/b6dfd92aea876647d20d9a8bd8618e4f2af6300539426be83c8bb0912d6f/pysam-0.11.2.2.tar.gz#sha256=9cd66406eaff40986302e9e1edc5872538f0fed9623aa8ceb15f9b80bbabfe03 (from https://pypi.org/simple/pysam/), version: 0.11.2.2
    Skipping link https://files.pythonhosted.org/packages/be/3c/9c0d31f4baa506057e781641325f52f709ca4fe777065e39be08e690752b/pysam-0.12-cp27-cp27m-manylinux1_x86_64.whl#sha256=dcd17f2dbe7b9e0742856cd23fd4ae7d6ecc9c48e3baa91bf019b63d935fa1e9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/5e/f1/28f7e3df4941ac01c2c1794b1009000fad81cf026da6c04e223e5e86e6ad/pysam-0.12-cp27-cp27mu-manylinux1_x86_64.whl#sha256=e8205678d96c33f122caa1e12dcb41a2db20d9147ef02c4f4f9c76b98a6362d8 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/e7/a7/9225250a464b91caba6c88e82b59755e07a30aa803085febbb923655d2d5/pysam-0.12-cp34-cp34m-manylinux1_x86_64.whl#sha256=b50500a772b9e3b13daea2ca43bfc0c7251369bf361b6579ad579d4f8887b9d2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/c6/ce/08728c6f395b46cdb75b79d4c554184b624fbe344a6a99b62b1a7f58a5df/pysam-0.12-cp35-cp35m-manylinux1_x86_64.whl#sha256=454e083cb80cf14fd73b5230c9f58836215b0bc961ec3d88a25897d05d24cd5f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/ef/bd/a741af36309bfbd8d40e5c5c9fc9f2ca3c7a86c2d1ff7c2563a81d851a44/pysam-0.12-cp36-cp36m-manylinux1_x86_64.whl#sha256=692afc5ae93ca6dbd6aaf12d79e9c376d7df42e600ceb73dcf1c1d3c238d6a67 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/0f/e0/19046ae89307ddeadfa8dabc305a9cfce67865de06b762057edd84bc0fd6/pysam-0.12.tar.gz#sha256=33922cb3277ed9a63457c1b6a9dcad2774a217ababcc97a854435be87ba80488 (from https://pypi.org/simple/pysam/), version: 0.12
    Skipping link https://files.pythonhosted.org/packages/15/bc/9d27138acddecbeca3a010691e71e89ad02e5c6dc3a38ca9d8cc94c92295/pysam-0.12.0.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=ecde3b5e8051c04ab455a5822e4b5dd58b48344ca2f256d6f0f899426e823b05 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/29/d9/7a508464feb23b750ba0d56e10e014f0d1a8cd6a4e8fe3887c75affa5fa9/pysam-0.12.0.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=035238322ad06d853173ad4203f393e1c2fff9e6bb560b90a37890a77e4d9f1d (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/eb/d5/4b67f2767fc352d8246c3eed4ce0f5d61fdbf6cef6e5b57d433ed63f7ed8/pysam-0.12.0.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=02d818752e93a4263a6d41a4fc6e46ad6180e1bdc6906da0f88d7ef0a986ff14 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0e/d9/91db21a596a3a896365a90c5b44c6722b4e0acfd5e90c52071175e77aad4/pysam-0.12.0.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=a99cd626ff0fdc09b68a1cc9cc9551f4dc3c4cd49872583de1a2f39e69520923 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/50/28/f3a3989a9a34fa6c84fdba3d80b4b1624b2c253d7906a13638152b20555b/pysam-0.12.0.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=f1cd051d474a72079dbeaa3d6cb1b26dac005af8e4cf71b4dddad7c66b08ce26 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/b9/98/d98b250f98a6b91df71a03083219bec786cdda5408f77997f8ad81d06058/pysam-0.12.0.1.tar.gz#sha256=04837bf0b1313e57d50076f228463262b9982c410b973eb184c033528f83d523 (from https://pypi.org/simple/pysam/), version: 0.12.0.1
    Skipping link https://files.pythonhosted.org/packages/14/cd/676a08a4bd77fd21716add76f946235780a5673c75c7408b2449db2dde5a/pysam-0.13-cp27-cp27m-manylinux1_x86_64.whl#sha256=a87d86c69c4007b898e1c0256da1eef6f9c67d8bfaa2208591e7e43b02c8ee92 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/59/7e/55048651e80ca7ebbed41489ec53da863a500d536fbff5884175e81b40c1/pysam-0.13-cp27-cp27mu-manylinux1_x86_64.whl#sha256=d977b0cfed87ae9fc0fcac1b03a676f95ce9b6f574105311d7f1e106826d8256 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/fc/63/4a758298dafa37a719540fd55c4e76de15e3ad6be0201c9e0e6ed59b3d8c/pysam-0.13-cp34-cp34m-manylinux1_x86_64.whl#sha256=539203173afb0f8672284969077f32e487690dd1a3e7458d3cd1e2f69dfe7637 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/8b/08/8f6ea307458945f9e5db70e460b7902f210f08646af35800372907095f06/pysam-0.13-cp35-cp35m-manylinux1_x86_64.whl#sha256=c0b11efe9ffc66e4ccbbadb992a0ca39ba736ca985cb02423ec1a7ed95b3f6d8 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/f1/dd/5f41722f95749537e2f5a84414a4b08fc4e14d39552df8171e375129edf5/pysam-0.13-cp36-cp36m-manylinux1_x86_64.whl#sha256=cd86023f429ef7eeb8dd19f85553c2f4544e2927e0d23d99cbc907f4c74dce8d (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/31/17/31d317006a74941d2caddac97c5106601fe4da467653d0f061702e9ead95/pysam-0.13.tar.gz#sha256=1829035f58bddf26b0cb6867968178701c2a243518ea697dcedeebff487979af (from https://pypi.org/simple/pysam/), version: 0.13
    Skipping link https://files.pythonhosted.org/packages/c9/0b/ca7620a778a1ac5a6669b750ab82cd8e2ca29f671cf2ab929cf907338bf5/pysam-0.14-cp27-cp27m-manylinux1_x86_64.whl#sha256=f08e3ee089a1691be837473a40eea097be7de3c066ce3ebc1e2d486d0ebda29c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/2b/ff/a7cdcde7f79ca59cd6a6921f55f0cce8fb3d4ff273257e313efc3e52853a/pysam-0.14-cp27-cp27mu-manylinux1_x86_64.whl#sha256=f0973c10a3377d5d8291aeebd03ce9a79192581903407b475223428b0843e063 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/51/c1/474c632acbbd7c06921a4ad31b237c3f41fe662101ec775be6a9c3c8cf20/pysam-0.14-cp34-cp34m-manylinux1_x86_64.whl#sha256=6da96be7861ca95a7c4378ac15c2e9372b45d99a3f5360d88e21a9d45fe6718c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/f7/53/6e677a66b02755d9d631a7ffa37b23b8eca7b2463faf14dcf3bcbbcbec24/pysam-0.14-cp35-cp35m-manylinux1_x86_64.whl#sha256=02cb2d210be93782179e94565ee7531a7e4ff2ddff05967ed9c502445a7544ed (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/96/7b/845e49997825cf2aaef3719853e8d2d07b43d3a5e096cb9863208b7d0af8/pysam-0.14-cp36-cp36m-manylinux1_x86_64.whl#sha256=2aec5aebb90c1c1fe0f596984663773af7cc98ef1de0db047d93c99aac52177f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/d8/78/8b3fad13d3bd8787c0d922056061727c2a0cf91c45a836c98342594dd293/pysam-0.14.tar.gz#sha256=c9c8ea82b4deee7607d5885fc7cc92311f06e765ff30e0b2b2d3d85b28cf5687 (from https://pypi.org/simple/pysam/), version: 0.14
    Skipping link https://files.pythonhosted.org/packages/cd/9b/2627df910452b49bef57dd5ce720832d49faadea3e3d86f940f168b807b4/pysam-0.14.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=d571e8536b3bc9807577e0e2744247d1887b90a6ad005c0dedea7639bb04d5fd (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/b3/96/a9b21863c30c00bde76ab9bd3b538ed9f4d872f6767217c930cd0246fd21/pysam-0.14.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=dadf1c6c7c3be79d526c38fcf6ff577062efed814b17341a4b8fbde7226a9555 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/a0/ba/95ee9ea7921ae153c51880ffe047269a7ccf396442214f4fc965cc66ea68/pysam-0.14.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=3d064977832536287d95e657d9ed184a0cc6e331b877637b203d50d4762bec5e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/09/a9/d74aa164efb28ce328cd4890b0182ccdf2e781c192910072717c965765c6/pysam-0.14.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=4279edd397a32e665e20d53d878a5604b98cc57067a0fc3d58f6933a5b6f82fb (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/97/bb/65b3a258ffca71251ae1d07c1d3eb54448da31ee74106e49e2f251f066d4/pysam-0.14.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=37fba70c6273329eb60383154189c6a72a960186d5e9d8cf0f757f2ba9f08b32 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/fc/9b/4bb8d016406dcff47e2866e14d3dcb10741ec3920649e8c521996830944f/pysam-0.14.1.tar.gz#sha256=2e86f5228429d08975c8adb9030296699012a8deba8ba26cbfc09b374f792c97 (from https://pypi.org/simple/pysam/), version: 0.14.1
    Skipping link https://files.pythonhosted.org/packages/2f/d8/57e6c36c4069e3b240115b3cb98bf1d5a2989d76815aff14fb0149d27781/pysam-0.15.0-cp27-cp27m-manylinux1_x86_64.whl#sha256=3cb1cda2a501751231fc7358d4b8d981ca13d9fe5e9a5a04ccd728a56a28bb96 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/dc/af/c14708a4d43effb82bd14302e41e9fa818b724ada9b9d89283319a22a585/pysam-0.15.0-cp27-cp27mu-manylinux1_x86_64.whl#sha256=43165efe8f1d8b7e2dd254dae93e88b5ed3de4fb6e9c54f32274c1e2c6124a68 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/15/77/2e258a5ff090226516c4338d682c6f8ed13e5be2ac7a67e6b452b04b0237/pysam-0.15.0-cp34-cp34m-manylinux1_x86_64.whl#sha256=c66d08f45dd2b3404d65429f792c9b79fac8ab29b09941aff0cb47cd29a7d16f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0d/5d/d96d3662647a3cf33b1e3fe6d21eaecd00f47d39edbe4cd85486639cb603/pysam-0.15.0-cp35-cp35m-manylinux1_x86_64.whl#sha256=044541e8310c64993ba201cd9c32659acd2f1400a5094c52353030e082f2a831 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/47/da/6a0cc06c65acaea0b8830e632712d53fa8bc88ea19096038b3bef22b25da/pysam-0.15.0-cp36-cp36m-manylinux1_x86_64.whl#sha256=dbb2de0144fb16adaa49bfd67ca919e27404996bdd060a06bbcd82eb60ff09de (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/f9/c4/f1b6963a05f415aa69c8efd64ebe460d56d03ecc75db70b0e8606b589ade/pysam-0.15.0.tar.gz#sha256=51e7030bebff68502a69fabc601727f827cd6e7c08c5899b11ad8c6084ba4ba5 (from https://pypi.org/simple/pysam/), version: 0.15.0
    Skipping link https://files.pythonhosted.org/packages/b4/d8/9afa92bd4b48ebd6896d22bb7cdaeb5aa4577983333df5e99160c62fb6ff/pysam-0.15.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=cc6b5bcc464bebe5c932cb1ba0ff9d3a6193d9b72d05aba9f16e8d115c06149c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/66/6b/f1a4f142d884b6e1cda6542bf4b89ce88ad8465197511d83994f2cf6484d/pysam-0.15.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=e1271bfb05a87cff378c88c956c96f6ae040a2d996104a31effa817929578e8f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/69/5f/030c774b44932d2e23d773558679d553fb31dd5ecdb094b8e26b316de784/pysam-0.15.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=d164917496b6569d727505fef0b6623dc3485d6f45ebd8394b124b155a3c0419 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/37/27/7d7ce83c0acac59b95849f2fb678484147f1e1393162ee0975cb7f84e53c/pysam-0.15.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=c54403c26490afdfc5db68a0ca1e846b94daa8ee0f571e278efda428257016af (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/6f/f4/e12faf1618e977a868fe66d40288fc3dd989a10cc4c77603da33a7634a18/pysam-0.15.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=8616649ad4e3538236636d068361bc9716ad45700f65bd46b7508cbc69ca49d7 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/1e/04/3e22a04ade5291e968b3f3e9195929574221d86fd8982a4976a40b045060/pysam-0.15.1-cp37-cp37m-manylinux1_x86_64.whl#sha256=1173a05c88752f2b871cc902fa33769a85c052f28bf0a94946f4a1576e300bce (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/73/59/c319f1bde3019bbce4583cecb12b9e3e52ffcfbe2c96d8b1fb131c0d4fb7/pysam-0.15.1.tar.gz#sha256=658421124c2f3de1b7445e03ca8413df0077f67ea9980abdaab0d1b5f7a8936f (from https://pypi.org/simple/pysam/), version: 0.15.1
    Skipping link https://files.pythonhosted.org/packages/1b/7d/68b6555c7bb414b655495305d2add784c251fc83d4e698878e6d1d35fc9a/pysam-0.15.2-cp27-cp27m-manylinux1_x86_64.whl#sha256=34dd4cf08cbdea1329a140f5446c319992460d400b9851c0cb5607f3c58ad256 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/0f/bd/f5ab828a9ff45a6ca14d5ea2a3580f720134052db258cd7ef929a4ed1d7a/pysam-0.15.2-cp27-cp27mu-manylinux1_x86_64.whl#sha256=236ae950c0194037ac3e8a11fa7bda6b46db17ee3f86e1111775ed4b9cdaf95b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/4b/04/d5a6386b6d124bcdf27d81ab952e5d24e37ff98b97f992aa5b83c647e9c9/pysam-0.15.2-cp34-cp34m-manylinux1_x86_64.whl#sha256=975fbd395b5c4d360be5fde2e34d418c64718ba732ae5b2bfb712e6cefa750d5 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/aa/e6/0b18d30c30e3690c5774446c1d7246c5e37c4710e38d93a20bb56cad4bc0/pysam-0.15.2-cp35-cp35m-manylinux1_x86_64.whl#sha256=1e0a6abf4fe0d3934fee8d662f6fda28e466b60209b5b1fd41070e1ccfbe87f2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/f1/fc/d2be1a093bd8494ab63e3168aca36c2494753bbff190f3201ce2e7da9cda/pysam-0.15.2-cp36-cp36m-manylinux1_x86_64.whl#sha256=0f063380ebd727f58483b256fe21d90358527fbdf48b925ae2680cc1f2c553ae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Skipping link https://files.pythonhosted.org/packages/20/1a/4fd27da2d19f7d914f757097605709a6509776b4cb63f42bca63f3531058/pysam-0.15.2-cp37-cp37m-manylinux1_x86_64.whl#sha256=e8166058e01d5b7fd2d82c5fee29f9c22e6016091b8c397cc029f7cc2f2f61ff (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
    Found link https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 (from https://pypi.org/simple/pysam/), version: 0.15.2
  Using version 0.15.2 (newest of versions: 0.4, 0.4.1, 0.7.6, 0.7.7, 0.7.8, 0.8.0, 0.8.1, 0.8.2, 0.8.2.1, 0.8.3, 0.8.4, 0.9.0, 0.9.1, 0.9.1.1, 0.9.1.2, 0.9.1.3, 0.9.1.4, 0.10.0, 0.11, 0.11.1, 0.11.2, 0.11.2.1, 0.11.2.2, 0.12, 0.12.0.1, 0.13, 0.14, 0.14.1, 0.15.0, 0.15.1, 0.15.2)
  Created temporary directory: /tmp/pip-unpack-kl3k8fgj
  Looking up "https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz" in the cache
  No cache entry available
  Starting new HTTPS connection (1): files.pythonhosted.org:443
  https://files.pythonhosted.org:443 "GET /packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz HTTP/1.1" 200 3225916
  Downloading https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz (3.2MB)
  Downloading from URL https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 (from https://pypi.org/simple/pysam/)
    99% |████████████████████████████████| 3.2MB 61.5MB/s eta 0:00:01  Ignoring unknown cache-control directive: immutable
  Updating cache with response from "https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz"
  Caching due to etag
    100% |████████████████████████████████| 3.2MB 10.5MB/s 
  Added pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 to build tracker '/tmp/pip-req-tracker-_0vdrlxw'
    Running setup.py (path:/tmp/pip-install-4mbemz89/pysam/setup.py) egg_info for package pysam
    Running command python setup.py egg_info
    checking for gcc... gcc
    checking whether the C compiler works... yes
    checking for C compiler default output file name... a.out
    checking for suffix of executables...
    checking whether we are cross compiling... no
    checking for suffix of object files... o
    checking whether we are using the GNU C compiler... yes
    checking whether gcc accepts -g... yes
    checking for gcc option to accept ISO C89... none needed
    checking for ranlib... ranlib
    checking for grep that handles long lines and -e... /bin/grep
    checking for C compiler warning flags... -Wall
    checking for special C compiler options needed for large files... no
    checking for _FILE_OFFSET_BITS value needed for large files... no
    checking for _LARGEFILE_SOURCE value needed for large files... no
    checking shared library type for unknown-Linux... plain .so
    checking how to run the C preprocessor... gcc -E
    checking for egrep... /bin/grep -E
    checking for ANSI C header files... yes
    checking for sys/types.h... yes
    checking for sys/stat.h... yes
    checking for stdlib.h... yes
    checking for string.h... yes
    checking for memory.h... yes
    checking for strings.h... yes
    checking for inttypes.h... yes
    checking for stdint.h... yes
    checking for unistd.h... yes
    checking for stdlib.h... (cached) yes
    checking for unistd.h... (cached) yes
    checking for sys/param.h... yes
    checking for getpagesize... yes
    checking for working mmap... yes
    checking for gmtime_r... yes
    checking for fsync... yes
    checking for drand48... yes
    checking whether fdatasync is declared... yes
    checking for fdatasync... yes
    checking for library containing log... -lm
    checking for zlib.h... yes
    checking for inflate in -lz... yes
    checking for library containing recv... none required
    checking for bzlib.h... yes
    checking for BZ2_bzBuffToBuffCompress in -lbz2... yes
    checking for lzma.h... yes
    checking for lzma_easy_buffer_encode in -llzma... yes
    checking for libdeflate.h... no
    checking for libdeflate_deflate_compress in -ldeflate... no
    checking for curl_easy_pause in -lcurl... yes
    checking for CCHmac... no
    checking for library containing HMAC... -lcrypto
    checking whether PTHREAD_MUTEX_RECURSIVE is declared... yes
    configure: creating ./config.status
    config.status: creating config.mk
    config.status: creating htslib.pc.tmp
    config.status: creating config.h
    make: ./version.sh: Command not found
    make: ./version.sh: Command not found
    # pysam: cython is available - using cythonize if necessary
    # pysam: htslib mode is shared
    # pysam: HTSLIB_CONFIGURE_OPTIONS=--enable-gcs
    # pysam: htslib configure options: --enable-gcs
    # pysam: htslib_config LDFLAGS=
    # pysam: htslib_config LIBHTS_OBJS=kfunc.o knetfile.o kstring.o bcf_sr_sort.o bgzf.o errmod.o faidx.o hfile.o hfile_net.o hts.o hts_os.o md5.o multipart.o probaln.o realn.o regidx.o sam.o synced_bcf_reader.o vcf_sweep.o tbx.o textutils.o thread_pool.o vcf.o vcfutils.o cram/cram_codecs.o cram/cram_decode.o cram/cram_encode.o cram/cram_external.o cram/cram_index.o cram/cram_io.o cram/cram_samtools.o cram/cram_stats.o cram/files.o cram/mFILE.o cram/open_trace_file.o cram/pooled_alloc.o cram/rANS_static.o cram/sam_header.o cram/string_alloc.o hfile_libcurl.o hfile_gcs.o hfile_s3.o
    # pysam: htslib_config LIBS=-llzma -lbz2 -lz -lm -lcurl -lcrypto
    # pysam: htslib_config PLATFORM=default
    # pysam: config_option: ENABLE_PLUGINS=0
    # pysam: config_option: HAVE_COMMONCRYPTO=0
    # pysam: config_option: HAVE_GMTIME_R=1
    # pysam: config_option: HAVE_HMAC=1
    # pysam: config_option: HAVE_IRODS=0
    # pysam: config_option: HAVE_LIBCURL=1
    # pysam: config_option: HAVE_MMAP=1
    running egg_info
    creating pip-egg-info/pysam.egg-info
    writing pip-egg-info/pysam.egg-info/PKG-INFO
    writing dependency_links to pip-egg-info/pysam.egg-info/dependency_links.txt
    writing top-level names to pip-egg-info/pysam.egg-info/top_level.txt
    writing manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
    package init file 'samtools/__init__.py' not found (or not a regular file)
    package init file 'bcftools/__init__.py' not found (or not a regular file)
    package init file 'samtools/win32/__init__.py' not found (or not a regular file)
    package init file 'htslib/__init__.py' not found (or not a regular file)
    package init file 'htslib/htslib/__init__.py' not found (or not a regular file)
    reading manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
    reading manifest template 'MANIFEST.in'
    warning: no files found matching 'KNOWN_BUGS'
    warning: no files found matching 'THANKS'
    no previously-included directories found matching 'tests/'
    warning: no files found matching 'samtools/configure'
    warning: no files found matching 'samtools/config.mk.in'
    warning: no files found matching 'samtools/config.h.in'
    writing manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
  Source in /tmp/pip-install-4mbemz89/pysam has version 0.15.2, which satisfies requirement pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9
  Removed pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 from build tracker '/tmp/pip-req-tracker-_0vdrlxw'
Skipping bdist_wheel for pysam, due to binaries being disabled for it.
Installing collected packages: pysam
  Created temporary directory: /tmp/pip-record-s9nep6mv
  Running setup.py install for pysam ...     Running command /usr/bin/python3 -u -c "import setuptools, tokenize;__file__='/tmp/pip-install-4mbemz89/pysam/setup.py';f=getattr(tokenize, 'open', open)(__file__);code=f.read().replace('\r\n', '\n');f.close();exec(compile(code, __file__, 'exec'))" install --record /tmp/pip-record-s9nep6mv/install-record.txt --single-version-externally-managed --compile
    # pysam: cython is available - using cythonize if necessary
    # pysam: htslib mode is shared
    # pysam: HTSLIB_CONFIGURE_OPTIONS=--enable-gcs
    checking for gcc... gcc
    checking whether the C compiler works... yes
    checking for C compiler default output file name... a.out
    checking for suffix of executables...
    checking whether we are cross compiling... no
    checking for suffix of object files... o
    checking whether we are using the GNU C compiler... yes
    checking whether gcc accepts -g... yes
    checking for gcc option to accept ISO C89... none needed
    checking for ranlib... ranlib
    checking for grep that handles long lines and -e... /bin/grep
    checking for C compiler warning flags... -Wall
    checking for special C compiler options needed for large files... no
    checking for _FILE_OFFSET_BITS value needed for large files... no
    checking for _LARGEFILE_SOURCE value needed for large files... no
    checking shared library type for unknown-Linux... plain .so
    checking how to run the C preprocessor... gcc -E
    checking for egrep... /bin/grep -E
    checking for ANSI C header files... yes
    checking for sys/types.h... yes
    checking for sys/stat.h... yes
    checking for stdlib.h... yes
    checking for string.h... yes
    checking for memory.h... yes
    checking for strings.h... yes
    checking for inttypes.h... yes
    checking for stdint.h... yes
    checking for unistd.h... yes
    checking for stdlib.h... (cached) yes
    checking for unistd.h... (cached) yes
    checking for sys/param.h... yes
    checking for getpagesize... yes
    checking for working mmap... yes
    checking for gmtime_r... yes
    checking for fsync... yes
    checking for drand48... yes
    checking whether fdatasync is declared... yes
    checking for fdatasync... yes
    checking for library containing log... -lm
    checking for zlib.h... yes
    checking for inflate in -lz... yes
    checking for library containing recv... none required
    checking for bzlib.h... yes
    checking for BZ2_bzBuffToBuffCompress in -lbz2... yes
    checking for lzma.h... yes
    checking for lzma_easy_buffer_encode in -llzma... yes
    checking for libdeflate.h... no
    checking for libdeflate_deflate_compress in -ldeflate... no
    checking for curl_easy_pause in -lcurl... yes
    checking for CCHmac... no
    checking for library containing HMAC... -lcrypto
    checking whether PTHREAD_MUTEX_RECURSIVE is declared... yes
    configure: creating ./config.status
    config.status: creating config.mk
    config.status: creating htslib.pc.tmp
    config.status: creating config.h
    config.status: config.h is unchanged
    # pysam: htslib configure options: --enable-gcs
    make: ./version.sh: Command not found
    make: ./version.sh: Command not found
    # pysam: htslib_config LDFLAGS=
    # pysam: htslib_config LIBHTS_OBJS=kfunc.o knetfile.o kstring.o bcf_sr_sort.o bgzf.o errmod.o faidx.o hfile.o hfile_net.o hts.o hts_os.o md5.o multipart.o probaln.o realn.o regidx.o sam.o synced_bcf_reader.o vcf_sweep.o tbx.o textutils.o thread_pool.o vcf.o vcfutils.o cram/cram_codecs.o cram/cram_decode.o cram/cram_encode.o cram/cram_external.o cram/cram_index.o cram/cram_io.o cram/cram_samtools.o cram/cram_stats.o cram/files.o cram/mFILE.o cram/open_trace_file.o cram/pooled_alloc.o cram/rANS_static.o cram/sam_header.o cram/string_alloc.o hfile_libcurl.o hfile_gcs.o hfile_s3.o
    # pysam: htslib_config LIBS=-llzma -lbz2 -lz -lm -lcurl -lcrypto
    # pysam: htslib_config PLATFORM=default
    # pysam: config_option: ENABLE_PLUGINS=0
    # pysam: config_option: HAVE_COMMONCRYPTO=0
    # pysam: config_option: HAVE_GMTIME_R=1
    # pysam: config_option: HAVE_HMAC=1
    # pysam: config_option: HAVE_IRODS=0
    # pysam: config_option: HAVE_LIBCURL=1
    # pysam: config_option: HAVE_MMAP=1
    running install
    running build
    running build_py
    creating build
    creating build/lib.linux-x86_64-3.6
    creating build/lib.linux-x86_64-3.6/pysam
    copying pysam/bcftools.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/samtools.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/__init__.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/version.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/utils.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/config.py -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/Pileup.py -> build/lib.linux-x86_64-3.6/pysam
    creating build/lib.linux-x86_64-3.6/pysam/include
    copying pysam/include/__init__.py -> build/lib.linux-x86_64-3.6/pysam/include
    package init file 'samtools/__init__.py' not found (or not a regular file)
    package init file 'bcftools/__init__.py' not found (or not a regular file)
    package init file 'samtools/win32/__init__.py' not found (or not a regular file)
    package init file 'htslib/__init__.py' not found (or not a regular file)
    package init file 'htslib/htslib/__init__.py' not found (or not a regular file)
    copying pysam/libchtslib.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcutils.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcalignedsegment.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcsamfile.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libctabix.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcbcf.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcvcf.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libctabixproxies.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcfaidx.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcsamtools.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcalignmentfile.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/libcbcftools.pxd -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/csamtools_util.h -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/pysam_util.h -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/htslib_util.h -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/pysam_stream.h -> build/lib.linux-x86_64-3.6/pysam
    copying pysam/cbcftools_util.h -> build/lib.linux-x86_64-3.6/pysam
    creating build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/tmp_file.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bedidx.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bam_plbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bam2bcf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bam_endian.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/sam_header.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/sam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/sam_opts.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/stats_isize.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/samtools.pysam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/bam_lpileup.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/samtools.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/sample.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/version.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    copying samtools/config.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
    creating build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/call.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/gvcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/bcftools.pysam.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/regidx.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/hclust.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/bam2bcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/vcfbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/kmin.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/bin.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/mw.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/vcmp.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/rbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/bcftools.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/ploidy.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/tsv2vcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/kheap.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/HMM.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/version.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/khash_str2str.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/bam_sample.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/config.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/prob1.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/filter.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/smpl_ilist.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    copying bcftools/convert.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
    creating build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
    copying samtools/win32/xcurses.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
    copying samtools/win32/zconf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
    copying samtools/win32/zlib.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
    creating build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/thread_pool_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/hfile_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/version.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/hts_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/config.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/textutils_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    copying htslib/bcf_sr_sort.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
    creating build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/kstring.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/regidx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/vcf.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hts_os.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/synced_bcf_reader.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/knetfile.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hts.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/sam.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/cram.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/ksort.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/vcfutils.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hts_endian.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/thread_pool.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/kseq.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/faidx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hts_defs.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hfile.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/bgzf.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/kbitset.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/khash.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/kfunc.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/khash_str2int.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/klist.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/vcf_sweep.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/hts_log.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    copying htslib/htslib/tbx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
    Fixing build/lib.linux-x86_64-3.6/pysam/bcftools.py build/lib.linux-x86_64-3.6/pysam/samtools.py build/lib.linux-x86_64-3.6/pysam/__init__.py build/lib.linux-x86_64-3.6/pysam/version.py build/lib.linux-x86_64-3.6/pysam/utils.py build/lib.linux-x86_64-3.6/pysam/config.py build/lib.linux-x86_64-3.6/pysam/Pileup.py build/lib.linux-x86_64-3.6/pysam/include/__init__.py
    Skipping optional fixer: buffer
    Skipping optional fixer: idioms
    Skipping optional fixer: set_literal
    Skipping optional fixer: ws_comma
    Fixing build/lib.linux-x86_64-3.6/pysam/bcftools.py build/lib.linux-x86_64-3.6/pysam/samtools.py build/lib.linux-x86_64-3.6/pysam/__init__.py build/lib.linux-x86_64-3.6/pysam/version.py build/lib.linux-x86_64-3.6/pysam/utils.py build/lib.linux-x86_64-3.6/pysam/config.py build/lib.linux-x86_64-3.6/pysam/Pileup.py build/lib.linux-x86_64-3.6/pysam/include/__init__.py
    Skipping optional fixer: buffer
    Skipping optional fixer: idioms
    Skipping optional fixer: set_literal
    Skipping optional fixer: ws_comma
    running build_ext
    skipping 'pysam/libchtslib.c' Cython extension (up-to-date)
    building 'pysam.libchtslib' extension
    creating build/temp.linux-x86_64-3.6
    creating build/temp.linux-x86_64-3.6/pysam
    creating build/temp.linux-x86_64-3.6/htslib
    creating build/temp.linux-x86_64-3.6/htslib/cram
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libchtslib.c -o build/temp.linux-x86_64-3.6/pysam/libchtslib.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/htslib_util.c -o build/temp.linux-x86_64-3.6/pysam/htslib_util.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/kfunc.c -o build/temp.linux-x86_64-3.6/htslib/kfunc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/knetfile.c -o build/temp.linux-x86_64-3.6/htslib/knetfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/kstring.c -o build/temp.linux-x86_64-3.6/htslib/kstring.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/bcf_sr_sort.c -o build/temp.linux-x86_64-3.6/htslib/bcf_sr_sort.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/bgzf.c -o build/temp.linux-x86_64-3.6/htslib/bgzf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/errmod.c -o build/temp.linux-x86_64-3.6/htslib/errmod.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/faidx.c -o build/temp.linux-x86_64-3.6/htslib/faidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile.c -o build/temp.linux-x86_64-3.6/htslib/hfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_net.c -o build/temp.linux-x86_64-3.6/htslib/hfile_net.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hts.c -o build/temp.linux-x86_64-3.6/htslib/hts.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hts_os.c -o build/temp.linux-x86_64-3.6/htslib/hts_os.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/md5.c -o build/temp.linux-x86_64-3.6/htslib/md5.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/multipart.c -o build/temp.linux-x86_64-3.6/htslib/multipart.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/probaln.c -o build/temp.linux-x86_64-3.6/htslib/probaln.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/realn.c -o build/temp.linux-x86_64-3.6/htslib/realn.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/regidx.c -o build/temp.linux-x86_64-3.6/htslib/regidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/sam.c -o build/temp.linux-x86_64-3.6/htslib/sam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/synced_bcf_reader.c -o build/temp.linux-x86_64-3.6/htslib/synced_bcf_reader.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcf_sweep.c -o build/temp.linux-x86_64-3.6/htslib/vcf_sweep.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/tbx.c -o build/temp.linux-x86_64-3.6/htslib/tbx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/textutils.c -o build/temp.linux-x86_64-3.6/htslib/textutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/thread_pool.c -o build/temp.linux-x86_64-3.6/htslib/thread_pool.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcf.c -o build/temp.linux-x86_64-3.6/htslib/vcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcfutils.c -o build/temp.linux-x86_64-3.6/htslib/vcfutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_codecs.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_codecs.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_decode.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_decode.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_encode.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_encode.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_external.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_external.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_index.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_index.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_io.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_io.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_samtools.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_samtools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_stats.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_stats.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/files.c -o build/temp.linux-x86_64-3.6/htslib/cram/files.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/mFILE.c -o build/temp.linux-x86_64-3.6/htslib/cram/mFILE.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/open_trace_file.c -o build/temp.linux-x86_64-3.6/htslib/cram/open_trace_file.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/pooled_alloc.c -o build/temp.linux-x86_64-3.6/htslib/cram/pooled_alloc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/rANS_static.c -o build/temp.linux-x86_64-3.6/htslib/cram/rANS_static.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/sam_header.c -o build/temp.linux-x86_64-3.6/htslib/cram/sam_header.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/string_alloc.c -o build/temp.linux-x86_64-3.6/htslib/cram/string_alloc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_libcurl.c -o build/temp.linux-x86_64-3.6/htslib/hfile_libcurl.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_gcs.c -o build/temp.linux-x86_64-3.6/htslib/hfile_gcs.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_s3.c -o build/temp.linux-x86_64-3.6/htslib/hfile_s3.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libchtslib.o build/temp.linux-x86_64-3.6/pysam/htslib_util.o build/temp.linux-x86_64-3.6/htslib/kfunc.o build/temp.linux-x86_64-3.6/htslib/knetfile.o build/temp.linux-x86_64-3.6/htslib/kstring.o build/temp.linux-x86_64-3.6/htslib/bcf_sr_sort.o build/temp.linux-x86_64-3.6/htslib/bgzf.o build/temp.linux-x86_64-3.6/htslib/errmod.o build/temp.linux-x86_64-3.6/htslib/faidx.o build/temp.linux-x86_64-3.6/htslib/hfile.o build/temp.linux-x86_64-3.6/htslib/hfile_net.o build/temp.linux-x86_64-3.6/htslib/hts.o build/temp.linux-x86_64-3.6/htslib/hts_os.o build/temp.linux-x86_64-3.6/htslib/md5.o build/temp.linux-x86_64-3.6/htslib/multipart.o build/temp.linux-x86_64-3.6/htslib/probaln.o build/temp.linux-x86_64-3.6/htslib/realn.o build/temp.linux-x86_64-3.6/htslib/regidx.o build/temp.linux-x86_64-3.6/htslib/sam.o build/temp.linux-x86_64-3.6/htslib/synced_bcf_reader.o build/temp.linux-x86_64-3.6/htslib/vcf_sweep.o build/temp.linux-x86_64-3.6/htslib/tbx.o build/temp.linux-x86_64-3.6/htslib/textutils.o build/temp.linux-x86_64-3.6/htslib/thread_pool.o build/temp.linux-x86_64-3.6/htslib/vcf.o build/temp.linux-x86_64-3.6/htslib/vcfutils.o build/temp.linux-x86_64-3.6/htslib/cram/cram_codecs.o build/temp.linux-x86_64-3.6/htslib/cram/cram_decode.o build/temp.linux-x86_64-3.6/htslib/cram/cram_encode.o build/temp.linux-x86_64-3.6/htslib/cram/cram_external.o build/temp.linux-x86_64-3.6/htslib/cram/cram_index.o build/temp.linux-x86_64-3.6/htslib/cram/cram_io.o build/temp.linux-x86_64-3.6/htslib/cram/cram_samtools.o build/temp.linux-x86_64-3.6/htslib/cram/cram_stats.o build/temp.linux-x86_64-3.6/htslib/cram/files.o build/temp.linux-x86_64-3.6/htslib/cram/mFILE.o build/temp.linux-x86_64-3.6/htslib/cram/open_trace_file.o build/temp.linux-x86_64-3.6/htslib/cram/pooled_alloc.o build/temp.linux-x86_64-3.6/htslib/cram/rANS_static.o build/temp.linux-x86_64-3.6/htslib/cram/sam_header.o build/temp.linux-x86_64-3.6/htslib/cram/string_alloc.o build/temp.linux-x86_64-3.6/htslib/hfile_libcurl.o build/temp.linux-x86_64-3.6/htslib/hfile_gcs.o build/temp.linux-x86_64-3.6/htslib/hfile_s3.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -o build/lib.linux-x86_64-3.6/pysam/libchtslib.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcsamtools.c' Cython extension (up-to-date)
    building 'pysam.libcsamtools' extension
    creating build/temp.linux-x86_64-3.6/samtools
    creating build/temp.linux-x86_64-3.6/samtools/lz4
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcsamtools.c -o build/temp.linux-x86_64-3.6/pysam/libcsamtools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_plcmd.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_plcmd.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_split.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_split.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_view.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_view.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_markdup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_markdup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_opts.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_opts.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_rmdupse.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_rmdupse.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_quickcheck.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_quickcheck.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/faidx.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/faidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_sort.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_sort.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_color.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_color.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_stat.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_stat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_lpileup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_lpileup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2bcf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2bcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_index.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_index.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_rmdup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_rmdup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/samtools.pysam.c -o build/temp.linux-x86_64-3.6/samtools/samtools.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_flags.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_flags.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bedcov.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bedcov.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2bcf_indel.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2bcf_indel.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/tmp_file.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/tmp_file.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sample.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sample.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bamshuf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bamshuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_header.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_header.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_md.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_md.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bedidx.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bedidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/phase.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/phase.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/cut_target.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/cut_target.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bamtk.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bamtk.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2depth.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2depth.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_plbuf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_plbuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/padding.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/padding.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_import.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_import.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_mate.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_mate.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_utils.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_utils.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/dict.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/dict.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_cat.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_cat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/stats_isize.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/stats_isize.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_addrprg.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_addrprg.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_reheader.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_reheader.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_aux.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_aux.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/stats.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/stats.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/lz4/lz4.c -o build/temp.linux-x86_64-3.6/samtools/lz4/lz4.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcsamtools.o build/temp.linux-x86_64-3.6/samtools/bam_plcmd.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_split.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_view.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_markdup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_opts.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_rmdupse.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_quickcheck.c.pysam.o build/temp.linux-x86_64-3.6/samtools/faidx.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_sort.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_color.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_stat.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_lpileup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2bcf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_index.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_rmdup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/samtools.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_flags.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bedcov.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2bcf_indel.c.pysam.o build/temp.linux-x86_64-3.6/samtools/tmp_file.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sample.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bamshuf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_header.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_md.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bedidx.c.pysam.o build/temp.linux-x86_64-3.6/samtools/phase.c.pysam.o build/temp.linux-x86_64-3.6/samtools/cut_target.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bamtk.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2depth.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_plbuf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/padding.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_import.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_mate.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_utils.c.pysam.o build/temp.linux-x86_64-3.6/samtools/dict.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_cat.c.pysam.o build/temp.linux-x86_64-3.6/samtools/stats_isize.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_addrprg.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_reheader.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_aux.c.pysam.o build/temp.linux-x86_64-3.6/samtools/stats.c.pysam.o build/temp.linux-x86_64-3.6/samtools/lz4/lz4.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcsamtools.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcbcftools.c' Cython extension (up-to-date)
    building 'pysam.libcbcftools' extension
    creating build/temp.linux-x86_64-3.6/bcftools
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbcftools.c -o build/temp.linux-x86_64-3.6/pysam/libcbcftools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/tsv2vcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/tsv2vcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/gvcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/gvcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/prob1.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/prob1.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/mcall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/mcall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfview.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfview.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/reheader.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/reheader.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfsort.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfsort.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/regidx.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/regidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcffilter.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcffilter.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfgtcheck.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfgtcheck.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfisec.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfisec.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfindex.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfindex.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/em.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/em.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/main.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/main.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfannotate.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfannotate.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam2bcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam2bcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfroh.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfroh.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfconvert.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfconvert.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfcall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfcall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/version.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/version.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/kmin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/kmin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam_sample.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam_sample.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfmerge.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfmerge.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bcftools.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bcftools.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam2bcf_indel.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam2bcf_indel.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/ploidy.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/ploidy.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfstats.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfstats.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/hclust.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/hclust.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfcnv.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfcnv.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/consensus.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/consensus.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/mpileup.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/mpileup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfplugin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfplugin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcmp.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcmp.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/ccall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/ccall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfquery.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfquery.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfbuf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfbuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/convert.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/convert.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfnorm.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfnorm.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/filter.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/filter.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/HMM.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/HMM.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/csq.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/csq.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/smpl_ilist.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/smpl_ilist.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/tabix.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/tabix.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfconcat.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfconcat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfsom.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfsom.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbcftools.o build/temp.linux-x86_64-3.6/bcftools/tsv2vcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/gvcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/prob1.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/mcall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfview.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/reheader.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfsort.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/regidx.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcffilter.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfgtcheck.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfisec.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfindex.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/em.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/main.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfannotate.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam2bcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfroh.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfconvert.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfcall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/version.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/kmin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam_sample.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfmerge.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bcftools.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam2bcf_indel.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/ploidy.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfstats.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/hclust.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfcnv.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/consensus.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/mpileup.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfplugin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcmp.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/ccall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfquery.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfbuf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/convert.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfnorm.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/filter.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/HMM.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/csq.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/smpl_ilist.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/tabix.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfconcat.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfsom.c.pysam.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbcftools.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcutils.c' Cython extension (up-to-date)
    building 'pysam.libcutils' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcutils.c -o build/temp.linux-x86_64-3.6/pysam/libcutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libcutils.c: In function ‘__pyx_pf_5pysam_9libcutils_8_pysam_dispatch’:
    pysam/libcutils.c:6272:3: warning: implicit declaration of function ‘bcftools_set_stderr’; did you mean ‘samtools_set_stderr’? [-Wimplicit-function-declaration]
       bcftools_set_stderr(__pyx_t_10);
       ^~~~~~~~~~~~~~~~~~~
       samtools_set_stderr
    pysam/libcutils.c:6444:5: warning: implicit declaration of function ‘bcftools_set_stdout_fn’; did you mean ‘samtools_set_stdout_fn’? [-Wimplicit-function-declaration]
         bcftools_set_stdout_fn(__pyx_t_13);
         ^~~~~~~~~~~~~~~~~~~~~~
         samtools_set_stdout_fn
    pysam/libcutils.c:6455:5: warning: implicit declaration of function ‘bcftools_set_stdout’; did you mean ‘samtools_set_stdout’? [-Wimplicit-function-declaration]
         bcftools_set_stdout(__pyx_t_10);
         ^~~~~~~~~~~~~~~~~~~
         samtools_set_stdout
    pysam/libcutils.c:7287:5: warning: implicit declaration of function ‘bcftools_set_optind’; did you mean ‘samtools_set_optind’? [-Wimplicit-function-declaration]
         bcftools_set_optind(1);
         ^~~~~~~~~~~~~~~~~~~
         samtools_set_optind
    pysam/libcutils.c:7366:22: warning: implicit declaration of function ‘bcftools_main’; did you mean ‘samtools_main’? [-Wimplicit-function-declaration]
         __pyx_v_retval = bcftools_main((__pyx_v_n + 2), __pyx_v_cargs);
                          ^~~~~~~~~~~~~
                          samtools_main
    pysam/libcutils.c:7435:3: warning: implicit declaration of function ‘bcftools_unset_stderr’; did you mean ‘samtools_unset_stderr’? [-Wimplicit-function-declaration]
       bcftools_unset_stderr();
       ^~~~~~~~~~~~~~~~~~~~~
       samtools_unset_stderr
    pysam/libcutils.c:7471:5: warning: implicit declaration of function ‘bcftools_unset_stdout’; did you mean ‘samtools_unset_stdout’? [-Wimplicit-function-declaration]
         bcftools_unset_stdout();
         ^~~~~~~~~~~~~~~~~~~~~
         samtools_unset_stdout
    pysam/libcutils.c: In function ‘__pyx_pw_5pysam_9libcutils_9_pysam_dispatch’:
    pysam/libcutils.c:480:40: warning: ‘__pyx_v_retval’ may be used uninitialized in this function [-Wmaybe-uninitialized]
       #define PyInt_FromLong               PyLong_FromLong
                                            ^~~~~~~~~~~~~~~
    pysam/libcutils.c:5971:7: note: ‘__pyx_v_retval’ was declared here
       int __pyx_v_retval;
           ^~~~~~~~~~~~~~
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/pysam_util.c -o build/temp.linux-x86_64-3.6/pysam/pysam_util.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcutils.o build/temp.linux-x86_64-3.6/pysam/pysam_util.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcsamtools.cpython-36m-x86_64-linux-gnu -lcbcftools.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcutils.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcalignmentfile.c' Cython extension (up-to-date)
    building 'pysam.libcalignmentfile' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcalignmentfile.c -o build/temp.linux-x86_64-3.6/pysam/libcalignmentfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libcalignmentfile.c: In function ‘__pyx_f_5pysam_17libcalignmentfile_14IteratorColumn_cnext’:
    pysam/libcalignmentfile.c:30112:126: warning: passing argument 5 of ‘bam_mplp_auto’ from incompatible pointer type [-Wincompatible-pointer-types]
       __pyx_v_ret = bam_mplp_auto(__pyx_v_self->pileup_iter, (&__pyx_v_self->tid), (&__pyx_v_self->pos), (&__pyx_v_self->n_plp), (&__pyx_v_self->plp));
                                                                                                                                  ^
    In file included from pysam/htslib_util.h:4:0,
                     from pysam/libcalignmentfile.c:573:
    /tmp/pip-install-4mbemz89/pysam/htslib/htslib/sam.h:686:9: note: expected ‘const bam_pileup1_t ** {aka const struct <anonymous> **}’ but argument is of type ‘bam_pileup1_t ** {aka struct <anonymous> **}’
         int bam_mplp_auto(bam_mplp_t iter, int *_tid, int *_pos, int *n_plp, const bam_pileup1_t **plp);
             ^~~~~~~~~~~~~
    pysam/libcalignmentfile.c: In function ‘__pyx_f_5pysam_17libcalignmentfile_20IteratorRowSelection_cnext’:
    pysam/libcalignmentfile.c:28365:9: warning: ignoring return value of ‘bgzf_seek’, declared with attribute warn_unused_result [-Wunused-result]
             (void)(bgzf_seek(hts_get_bgzfp(__pyx_v_self->__pyx_base.htsfile), __pyx_v_pos, 0));
             ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    pysam/libcalignmentfile.c: In function ‘__pyx_pf_5pysam_17libcalignmentfile_13AlignmentFile_6_open’:
    pysam/libcalignmentfile.c:13973:13: warning: ignoring return value of ‘sam_hdr_write’, declared with attribute warn_unused_result [-Wunused-result]
                 (void)(sam_hdr_write(__pyx_v_self->__pyx_base.htsfile, __pyx_v_hdr));
                 ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcalignmentfile.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcsamfile.c' Cython extension (up-to-date)
    building 'pysam.libcsamfile' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcsamfile.c -o build/temp.linux-x86_64-3.6/pysam/libcsamfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcsamfile.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcsamfile.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcalignedsegment.c' Cython extension (up-to-date)
    building 'pysam.libcalignedsegment' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcalignedsegment.c -o build/temp.linux-x86_64-3.6/pysam/libcalignedsegment.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libcalignedsegment.c: In function ‘__pyx_pf_5pysam_18libcalignedsegment_14AlignedSegment_18fromstring’:
    pysam/libcalignedsegment.c:14379:3: warning: ignoring return value of ‘sam_parse1’, declared with attribute warn_unused_result [-Wunused-result]
       (void)(sam_parse1((&__pyx_v_line), __pyx_v_dest->header->ptr, __pyx_v_dest->_delegate));
       ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcalignedsegment.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libctabix.c' Cython extension (up-to-date)
    building 'pysam.libctabix' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libctabix.c -o build/temp.linux-x86_64-3.6/pysam/libctabix.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libctabix.c: In function ‘__pyx_pf_5pysam_9libctabix_9TabixFile_7contigs___get__’:
    pysam/libctabix.c:8706:27: warning: assignment from incompatible pointer type [-Wincompatible-pointer-types]
             __pyx_v_sequences = tbx_seqnames(__pyx_v_self->index, (&__pyx_v_nsequences));
                               ^
    In file included from pysam/libctabix.c:580:0:
    pysam/libctabix.c: In function ‘__pyx_pf_5pysam_9libctabix_4tabix_index’:
    /tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
     #define TBX_UCSC    0x10000
                         ^
    pysam/libctabix.c:13977:39: note: in expansion of macro ‘TBX_UCSC’
       __pyx_t_2 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 975, __pyx_L1_error)
                                           ^~~~~~~~
    /tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
     #define TBX_UCSC    0x10000
                         ^
    pysam/libctabix.c:14009:39: note: in expansion of macro ‘TBX_UCSC’
       __pyx_t_3 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 976, __pyx_L1_error)
                                           ^~~~~~~~
    /tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
     #define TBX_UCSC    0x10000
                         ^
    pysam/libctabix.c:14379:43: note: in expansion of macro ‘TBX_UCSC’
           __pyx_t_3 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 1005, __pyx_L1_error)
                                               ^~~~~~~~
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libctabix.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libctabix.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcfaidx.c' Cython extension (up-to-date)
    building 'pysam.libcfaidx' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcfaidx.c -o build/temp.linux-x86_64-3.6/pysam/libcfaidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcfaidx.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcfaidx.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcbcf.c' Cython extension (up-to-date)
    building 'pysam.libcbcf' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbcf.c -o build/temp.linux-x86_64-3.6/pysam/libcbcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libcbcf.c: In function ‘__pyx_pf_5pysam_7libcbcf_13VariantHeader_12__str__’:
    pysam/libcbcf.c:33142:3: warning: ‘bcf_hdr_fmt_text’ is deprecated: use bcf_hdr_format() instead [-Wdeprecated-declarations]
       __pyx_v_hstr = bcf_hdr_fmt_text(__pyx_v_self->ptr, 0, (&__pyx_v_hlen));
       ^~~~~~~~~~~~
    In file included from pysam/htslib_util.h:5:0,
                     from pysam/libcbcf.c:572:
    /tmp/pip-install-4mbemz89/pysam/htslib/htslib/vcf.h:439:11: note: declared here
         char *bcf_hdr_fmt_text(const bcf_hdr_t *hdr, int is_bcf, int *len)
               ^~~~~~~~~~~~~~~~
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbcf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbcf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcbgzf.c' Cython extension (up-to-date)
    building 'pysam.libcbgzf' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbgzf.c -o build/temp.linux-x86_64-3.6/pysam/libcbgzf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbgzf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbgzf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libctabixproxies.c' Cython extension (up-to-date)
    building 'pysam.libctabixproxies' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libctabixproxies.c -o build/temp.linux-x86_64-3.6/pysam/libctabixproxies.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libctabixproxies.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libctabixproxies.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    skipping 'pysam/libcvcf.c' Cython extension (up-to-date)
    building 'pysam.libcvcf' extension
    x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcvcf.c -o build/temp.linux-x86_64-3.6/pysam/libcvcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
    pysam/libcvcf.c: In function ‘__pyx_pf_5pysam_7libcvcf_3VCF_32parse_data.isra.77’:
    pysam/libcvcf.c:24714:15: warning: ‘__pyx_v_qual’ may be used uninitialized in this function [-Wmaybe-uninitialized]
       __pyx_t_9 = PyFloat_FromDouble(__pyx_v_qual); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 873, __pyx_L1_error)
                   ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcvcf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcvcf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
    running install_lib
    creating /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libchtslib.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcvcf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcsamtools.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcutils.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcbcf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/bcftools.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libctabix.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    creating /usr/local/lib/python3.6/dist-packages/pysam/include
    copying build/lib.linux-x86_64-3.6/pysam/include/__init__.py -> /usr/local/lib/python3.6/dist-packages/pysam/include
    creating /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/tmp_file.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bedidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    creating /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/xcurses.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/zconf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/zlib.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_plbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam2bcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_endian.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam_header.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam_opts.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/stats_isize.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/samtools.pysam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_lpileup.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/samtools.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sample.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    copying build/lib.linux-x86_64-3.6/pysam/include/samtools/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
    creating /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/thread_pool_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/hfile_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/hts_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/textutils_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/bcf_sr_sort.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
    creating /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kstring.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/regidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_os.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/synced_bcf_reader.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/knetfile.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/sam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/cram.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/ksort.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcfutils.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_endian.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/thread_pool.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kseq.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/faidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_defs.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hfile.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/bgzf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kbitset.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/khash.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kfunc.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/khash_str2int.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/klist.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcf_sweep.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_log.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/tbx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
    creating /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/call.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/gvcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bcftools.pysam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/regidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/hclust.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bam2bcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/vcfbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/kmin.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bin.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/mw.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/vcmp.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/rbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bcftools.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/ploidy.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/tsv2vcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/kheap.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/HMM.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/khash_str2str.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bam_sample.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/prob1.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/filter.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/smpl_ilist.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/convert.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
    copying build/lib.linux-x86_64-3.6/pysam/samtools.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcbgzf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/__init__.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/csamtools_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcsamfile.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libctabix.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcbcf.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcvcf.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libchtslib.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libctabixproxies.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcutils.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/version.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcbcftools.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcfaidx.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/utils.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/pysam_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/config.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/htslib_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcfaidx.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/pysam_stream.h -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcsamtools.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcsamfile.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libctabixproxies.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/cbcftools_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/Pileup.py -> /usr/local/lib/python3.6/dist-packages/pysam
    copying build/lib.linux-x86_64-3.6/pysam/libcbcftools.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/bcftools.py to bcftools.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/include/__init__.py to __init__.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/samtools.py to samtools.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/__init__.py to __init__.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/version.py to version.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/utils.py to utils.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/config.py to config.cpython-36.pyc
    byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/Pileup.py to Pileup.cpython-36.pyc
    running install_egg_info
    running egg_info
    writing pysam.egg-info/PKG-INFO
    writing dependency_links to pysam.egg-info/dependency_links.txt
    writing top-level names to pysam.egg-info/top_level.txt
    reading manifest file 'pysam.egg-info/SOURCES.txt'
    reading manifest template 'MANIFEST.in'
    warning: no files found matching 'KNOWN_BUGS'
    warning: no files found matching 'THANKS'
    no previously-included directories found matching 'tests/'
    warning: no files found matching 'samtools/configure'
    warning: no files found matching 'samtools/config.mk.in'
    warning: no files found matching 'samtools/config.h.in'
    writing manifest file 'pysam.egg-info/SOURCES.txt'
    Copying pysam.egg-info to /usr/local/lib/python3.6/dist-packages/pysam-0.15.2-py3.6.egg-info
    running install_scripts
    writing list of installed files to '/tmp/pip-record-s9nep6mv/install-record.txt'
done
  Removing source in /tmp/pip-install-4mbemz89/pysam
Successfully installed pysam-0.15.2
Cleaning up...
Removed build tracker '/tmp/pip-req-tracker-_0vdrlxw'

In [0]:
import pysam

First, we need to set our project. Replace the assignment below with your project ID.


In [0]:
# First, we need to set our project. Replace the assignment below
# with your project ID.
# project_id = 'isb-cgc-02-0001'
#!gcloud config set project {project_id}

#import os
#os.environ['GCS_OAUTH_TOKEN'] = "gcloud auth application-default print-access-token"

Now that we have Pysam installed, let's write an SQL query to locate BAM files in Google Cloud Storage Buckets.

In the query below, we are looking to identify the Google Cloud Storage bucket locations for TCGA Ovarian Cancer BAMs obtained via whole genome sequencing (WGS) generated using the SOLiD sequencing system


In [0]:
%%bigquery --project isb-cgc-02-0001 df
SELECT * FROM `isb-cgc.TCGA_hg19_data_v0.tcga_metadata_data_hg19_18jul`
where 
data_format = 'BAM' 
AND disease_code = 'OV' 
AND experimental_strategy = "WGS" 
AND platform = 'ABI SOLiD'
LIMIT 5


Out[0]:
file_gdc_id case_gdc_id case_barcode sample_gdc_id sample_barcode project_short_name disease_code program_name data_type data_category ... type file_size data_format platform file_name_key index_file_id index_file_name_key index_file_size access acl
0 cfb89251-618c-405e-ab84-9d432170a04a 92960f76-0242-4a1c-bf7d-014c2f720219 TCGA-29-1692 a2bc957e-2263-4b0a-b889-70553f59e0e8 TCGA-29-1692-10A TCGA-OV OV TCGA Aligned reads Raw sequencing data ... file 14924511066 BAM ABI SOLiD gs://7008814a-277f-4fd4-aa61-flattened/cfb8925... e3ff985e-47a3-4553-892b-bc7ffb02c776 gs://7008814a-277f-4fd4-aa61-flattened/e3ff985... 7707512 controlled phs000178
1 18ab4527-5346-437e-829f-27121f372bef 7fd6ab8a-201e-431d-a886-6ab553b6ca36 TCGA-29-1707 0fdb716d-d203-4ac2-9250-d273715055d3 TCGA-29-1707-10A TCGA-OV OV TCGA Aligned reads Raw sequencing data ... file 303193177515 BAM ABI SOLiD gs://7008814a-277f-4fd4-aa61-flattened/18ab452... e0135f4d-9bbb-4395-9e58-75b146c24627 gs://7008814a-277f-4fd4-aa61-flattened/e0135f4... 9044192 controlled phs000178
2 8006ca66-a708-4296-986b-4c8a91df4cee a2319490-b85d-4219-a1b0-fa1ec432d5c8 TCGA-29-2414 3a79f24c-a6c3-4b31-9551-37d97c6027ad TCGA-29-2414-10A TCGA-OV OV TCGA Aligned reads Raw sequencing data ... file 358029548606 BAM ABI SOLiD gs://7008814a-277f-4fd4-aa61-flattened/8006ca6... b26a334f-e553-48e1-9a94-55e556384410 gs://7008814a-277f-4fd4-aa61-flattened/b26a334... 9089040 controlled phs000178
3 5d04200b-f2c8-4ffc-8540-46ceb1382a9d 7248cd60-be22-44bc-bc58-f644db0940a2 TCGA-13-1489 0276787c-0e07-4452-9eae-54e2778617d7 TCGA-13-1489-10A TCGA-OV OV TCGA Aligned reads Raw sequencing data ... file 13437326688 BAM ABI SOLiD gs://7008814a-277f-4fd4-aa61-flattened/5d04200... c35343b1-74c4-4713-b774-94ae1e60146f gs://7008814a-277f-4fd4-aa61-flattened/c35343b... 7541408 controlled phs000178
4 c70ba617-9462-42cd-b043-f66715910a19 7248cd60-be22-44bc-bc58-f644db0940a2 TCGA-13-1489 4b2b6e5e-248c-46f6-938a-95571577e02d TCGA-13-1489-01A TCGA-OV OV TCGA Aligned reads Raw sequencing data ... file 12072487137 BAM ABI SOLiD gs://7008814a-277f-4fd4-aa61-flattened/c70ba61... 10740816-f723-4fe3-b750-a1c0613b9341 gs://7008814a-277f-4fd4-aa61-flattened/1074081... 7508824 controlled phs000178

5 rows × 21 columns

Now using the following Pysam command, let's read a bam file from GCS and slice out a section of the bam using the fetch function. For the purposes of the BAM slicing exercise, we will use an open-access CCLE BAM File open-access BAM file. CCLE open access BAM files are stored here


In [0]:
samfile = pysam.AlignmentFile('gs://isb-ccle-open/gdc/0a109993-2d5b-4251-bcab-9da4a611f2b1/C836.Calu-3.2.bam', "rb")
for read in samfile.fetch('7', 140453130, 140453135):
  print(read)

samfile.close()


D0MUKACXX120302:5:1103:20853:162833	83	6	140453055	60	76M	6	140453011	76	AAATAGCCTCAATTCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGA	array('B', [33, 32, 31, 30, 34, 17, 41, 39, 34, 30, 32, 29, 36, 32, 39, 35, 28, 5, 41, 41, 31, 33, 40, 41, 32, 41, 33, 34, 34, 32, 34, 38, 39, 32, 33, 41, 40, 36, 40, 31, 40, 32, 32, 41, 33, 38, 36, 33, 40, 33, 31, 32, 41, 33, 39, 32, 33, 38, 38, 38, 30, 39, 38, 39, 30, 40, 33, 39, 38, 31, 34, 31, 37, 35, 37, 32])	[('MD', '17A58'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?DEE?1HD@:D;C8C@8(JJHHIIHJJJJJJJJJJJJJIHIGIJIIIHIJHHJIJJJJIHFIHFDHHHFFFFFCCC'), ('UQ', 5)]
C0FJ4ACXX120306:7:2106:7109:75175	99	6	140453056	60	76M	6	140453125	76	AATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGAT	array('B', [29, 34, 30, 29, 35, 37, 36, 35, 36, 30, 25, 28, 33, 24, 35, 32, 30, 23, 38, 32, 32, 31, 37, 29, 37, 33, 35, 35, 33, 31, 39, 35, 32, 31, 39, 37, 33, 40, 26, 38, 33, 25, 35, 35, 34, 30, 32, 38, 32, 35, 36, 36, 34, 39, 23, 31, 31, 36, 32, 34, 38, 38, 39, 34, 36, 35, 34, 38, 33, 32, 39, 27, 33, 34, 32, 28])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';@@DADDAF>2<C4CGB4CDE;F9F@CG?BEBFGGGIC3CD3?D>DFE>FCFE@3?:B=FFEFF?@>CEEC;?=;5'), ('UQ', 0)]
C0FJ4ACXX120306:4:2308:5502:24253	595	6	140453056	60	76M	6	140452982	76	AATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGAT	array('B', [33, 31, 23, 17, 31, 33, 24, 30, 26, 33, 28, 33, 13, 32, 34, 13, 32, 38, 38, 32, 34, 32, 24, 27, 38, 30, 34, 33, 31, 33, 37, 37, 23, 34, 27, 39, 35, 37, 32, 37, 29, 31, 37, 32, 37, 36, 33, 36, 31, 32, 30, 38, 25, 37, 31, 27, 36, 32, 37, 32, 25, 35, 28, 16, 37, 32, 37, 38, 31, 32, 29, 37, 28, 34, 30, 30])	[('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=C=(5@.;=@78)@=)8DBBC?3DDAIEDEDDDD<EEDFD>FDEEEBB@EFC3FA3EEEE:E<+DADDADBB:?<?'), ('UQ', 0)]
D0MUKACXX120302:4:1302:19156:47363	163	6	140453057	60	76M	6	140453141	76	ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATT	array('B', [23, 29, 30, 38, 36, 36, 33, 36, 31, 33, 30, 30, 38, 34, 32, 30, 37, 37, 33, 31, 39, 38, 33, 39, 33, 35, 35, 36, 31, 40, 38, 33, 32, 40, 38, 33, 41, 33, 38, 33, 35, 39, 36, 40, 32, 33, 40, 33, 36, 36, 38, 36, 40, 34, 32, 40, 40, 39, 34, 39, 39, 40, 33, 40, 35, 41, 38, 33, 31, 40, 32, 33, 41, 34, 32, 31])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJIJIJJJJJJIJJJIIGIJJIJJJJIJJJJJJJJJJIHGIJIIIJJJJJJJJIJEIHHHHFF'), ('UQ', 0)]
D0N3RACXX120302:6:1207:3520:49064	147	6	140453057	60	76M	6	140452964	76	ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATT	array('B', [32, 29, 35, 38, 39, 37, 33, 40, 33, 31, 36, 34, 39, 36, 32, 32, 40, 39, 31, 33, 40, 40, 33, 41, 33, 33, 34, 32, 34, 39, 40, 32, 34, 40, 40, 37, 40, 32, 40, 31, 32, 41, 34, 38, 35, 34, 39, 32, 32, 31, 40, 33, 40, 31, 33, 38, 37, 39, 32, 39, 39, 37, 32, 39, 32, 38, 38, 30, 31, 30, 35, 33, 36, 30, 35, 23])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEFEHEACIGG@GF@8IGGFIHFIGBJJHJHHFJIJHHIHIJJJJIIIIIJJJJJJIHHJHGCHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:2201:1749:176613	163	6	140453058	60	76M	6	140453084	76	TAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTT	array('B', [23, 31, 38, 37, 36, 33, 35, 31, 33, 30, 30, 38, 34, 32, 29, 38, 37, 32, 31, 39, 38, 33, 38, 33, 35, 35, 35, 32, 40, 39, 34, 32, 40, 38, 33, 41, 34, 38, 34, 36, 38, 36, 40, 32, 34, 40, 33, 35, 36, 39, 36, 41, 33, 32, 40, 40, 40, 33, 39, 39, 39, 33, 39, 36, 40, 39, 33, 32, 41, 34, 35, 41, 33, 33, 32, 32])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJHHIJJJJJJJIJJIIJIJJJJJHGIJJIJJJJJJJJJJJJJJJHHGFFF'), ('UQ', 0)]
D0MUKACXX120302:4:2204:18554:31278	147	6	140453059	60	76M	6	140453031	76	AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC	array('B', [32, 31, 33, 14, 31, 24, 33, 30, 35, 32, 40, 33, 32, 32, 42, 41, 32, 33, 41, 41, 32, 41, 34, 34, 33, 32, 34, 39, 40, 32, 33, 41, 40, 36, 40, 32, 41, 33, 32, 41, 33, 39, 35, 33, 39, 33, 33, 31, 40, 33, 40, 31, 33, 38, 37, 39, 31, 39, 40, 39, 29, 39, 32, 39, 38, 30, 31, 30, 36, 33, 36, 30, 34, 35, 33, 23])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=;?)=3E@D;FA@=JJJHJIIJJJHIJIJIIJJJJIJIHIJJIHHJIGJIJJJJIHHIHGCJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2303:2594:176944	83	6	140453059	60	76M	6	140452955	76	AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC	array('B', [29, 25, 39, 37, 31, 31, 33, 32, 35, 31, 39, 33, 27, 31, 40, 41, 31, 34, 41, 40, 33, 41, 34, 34, 32, 31, 34, 38, 39, 33, 34, 41, 40, 36, 40, 31, 41, 34, 32, 41, 33, 39, 36, 34, 40, 33, 33, 32, 40, 34, 40, 32, 34, 39, 39, 40, 32, 39, 39, 38, 31, 40, 33, 39, 40, 32, 33, 31, 38, 35, 38, 31, 35, 36, 34, 31])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=5C@:<HGD;C=8=IIHCIGHJJJHHIIHJGJIJJIIIIIIJJJIJIJJJIJJJJJIIIHFJIHHHGHFFFFF@@B'), ('UQ', 0)]
D0N3RACXX120302:3:2305:14759:1759	83	6	140453060	60	76M	6	140453040	76	GCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCA	array('B', [36, 38, 37, 33, 34, 32, 32, 35, 34, 36, 36, 28, 30, 41, 40, 32, 34, 38, 38, 32, 38, 34, 34, 34, 32, 34, 38, 40, 32, 34, 38, 39, 36, 40, 33, 41, 34, 32, 40, 34, 39, 36, 33, 40, 34, 33, 33, 37, 32, 40, 32, 34, 38, 38, 39, 32, 38, 36, 33, 28, 37, 31, 40, 37, 31, 33, 29, 38, 35, 37, 32, 35, 35, 35, 34, 31])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHFGGHHEEGF@;JJJIIHFIJJJIHIJIGIIIIJJJIJJJJJJIIGIGJJIJJIIIHFCIGJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:7:1108:3410:52880	147	6	140453060	60	3S73M	6	140452949	73	ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACCGTTCAAACTGATGGGACCCACTCCATCGAGATT	array('B', [2, 2, 2, 2, 37, 39, 32, 36, 32, 30, 26, 12, 33, 21, 33, 31, 37, 38, 34, 32, 38, 38, 32, 35, 32, 32, 29, 32, 32, 36, 15, 30, 34, 15, 39, 35, 37, 30, 26, 19, 16, 19, 4, 34, 22, 30, 34, 31, 30, 28, 39, 34, 15, 12, 30, 27, 20, 22, 28, 32, 29, 37, 30, 34, 21, 2, 34, 27, 20, 26, 34, 33, 36, 30, 34, 23])	[('MD', '39T33'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '####EC====7)=.@=EEHGGE===8>GD?*?@3DBB@60)8)?4<?F?<EC++A:338@?BCA2)A=3AABD@@?'), ('UQ', 4)]
D0N3RACXX120302:1:1107:19002:45996	99	6	140453061	60	76M	6	140453088	76	CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC	array('B', [29, 36, 35, 37, 33, 36, 32, 32, 38, 34, 33, 31, 38, 37, 33, 31, 39, 38, 33, 38, 33, 36, 35, 34, 32, 40, 39, 33, 28, 39, 39, 32, 40, 34, 37, 32, 35, 39, 36, 41, 32, 33, 38, 31, 35, 35, 37, 35, 40, 34, 32, 40, 40, 40, 34, 38, 38, 40, 33, 39, 36, 40, 39, 33, 33, 40, 31, 35, 39, 34, 32, 32, 33, 38, 32, 36])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@C@FFFFFHFGHHJIGIHIIJJFGHIFFDGHEHEEGGIIJCBGDHGGGICHIIJIJGIGIIIJGHHGCD?EEEED?'), ('UQ', 0)]
D0N3RACXX120302:6:1108:3852:64373	99	6	140453061	60	76M	6	140453193	76	CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC	array('B', [31, 33, 34, 37, 32, 35, 31, 31, 40, 35, 31, 32, 38, 38, 33, 32, 40, 37, 33, 39, 33, 35, 36, 36, 32, 41, 39, 34, 33, 39, 39, 33, 40, 34, 39, 33, 35, 38, 36, 41, 32, 31, 40, 34, 35, 36, 39, 37, 41, 34, 32, 41, 39, 40, 34, 39, 38, 39, 33, 40, 36, 40, 39, 33, 32, 40, 32, 33, 41, 34, 32, 32, 32, 40, 33, 37])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFFFHHFGHJJJJGIIIJJJJJJIJIIIJJJIJIJIHHIJJJJJJJJJIIIJIJHIGIJJJIJJJHHHHHF?'), ('UQ', 0)]
C0FJ4ACXX120306:2:2205:7019:198160	595	6	140453061	60	6S70M	6	140452965	70	AAAGAACCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTAAAACTGATGGGACCCACTCCATCGAGA	array('B', [2, 2, 2, 2, 2, 2, 2, 36, 32, 37, 33, 31, 34, 33, 31, 14, 28, 29, 29, 36, 29, 13, 34, 33, 32, 34, 31, 30, 30, 29, 32, 11, 33, 32, 32, 30, 35, 34, 35, 32, 32, 31, 31, 36, 35, 33, 32, 30, 10, 32, 32, 31, 25, 30, 35, 33, 31, 24, 13, 29, 15, 30, 28, 31, 31, 30, 12, 27, 35, 31, 32, 27, 12, 33, 32, 29])	[('MD', '42C27'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#######A=AAAA>8)88<=9*A;==A?A<=)>A<>????=A:@@A??+B@<3<AB?3+2)A;<A<+=AA;?+==='), ('UQ', 10)]
D0N3RACXX120302:1:1304:15674:165318	83	6	140453061	60	76M	6	140452995	76	CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC	array('B', [33, 41, 34, 32, 31, 32, 36, 34, 41, 36, 32, 32, 41, 42, 32, 34, 40, 40, 32, 42, 33, 34, 34, 32, 34, 39, 40, 32, 33, 40, 41, 36, 40, 32, 42, 33, 32, 41, 34, 38, 35, 34, 40, 33, 34, 32, 41, 33, 40, 32, 33, 38, 38, 39, 31, 40, 39, 39, 30, 40, 33, 40, 40, 32, 33, 31, 38, 35, 38, 32, 36, 36, 33, 39, 29, 31])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHC>HIHEIHC@JJJIJIHJJJJJJJJJJJJJJJJIIIJJJJJJIIJJJJJJJIHJIHFJJJJHHHHHFFFFFCBC'), ('UQ', 0)]
C0FJ4ACXX120306:8:2108:18240:24066	99	6	140453062	60	76M	6	140453195	76	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [32, 34, 38, 33, 35, 31, 31, 37, 35, 32, 31, 39, 38, 33, 31, 39, 38, 33, 39, 34, 35, 36, 36, 32, 41, 40, 33, 32, 40, 38, 34, 41, 33, 38, 33, 36, 39, 36, 41, 32, 33, 40, 34, 36, 36, 39, 36, 41, 33, 32, 42, 40, 41, 34, 39, 38, 38, 34, 39, 36, 38, 39, 34, 33, 41, 33, 35, 42, 31, 32, 32, 32, 39, 33, 39, 33])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHGJJJJJJJJJIIJJGIJJJJJIJJJIJIJJJIJJJJIJJJJIJJGIJJGJJIIIIJGHHHHGHD'), ('UQ', 0)]
C0FJ4ACXX120306:3:1302:17665:147035	147	6	140453062	60	76M	6	140452980	76	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [26, 24, 34, 31, 23, 33, 27, 37, 36, 28, 16, 36, 41, 32, 33, 40, 41, 33, 41, 33, 34, 33, 32, 32, 38, 40, 32, 33, 40, 40, 35, 40, 30, 40, 29, 30, 38, 33, 38, 35, 33, 41, 33, 32, 31, 40, 34, 39, 31, 33, 38, 37, 35, 31, 39, 39, 39, 30, 39, 32, 40, 39, 31, 33, 30, 37, 34, 37, 28, 34, 34, 32, 39, 29, 38, 23])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '73;C7=4@@8)EGHEJIIIIJIIGIHJIIIIIGF@BGIIJIIJIIIJJIIJIHGIIGGGHJJJHHHHHEFFFFBC@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2304:2394:192642	83	6	140453062	60	76M	6	140452950	76	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [37, 34, 39, 34, 32, 36, 34, 41, 35, 32, 31, 40, 41, 32, 33, 41, 41, 32, 41, 34, 34, 34, 33, 34, 38, 40, 32, 34, 40, 41, 36, 40, 31, 41, 33, 32, 42, 34, 38, 36, 33, 42, 34, 33, 32, 41, 33, 40, 32, 33, 38, 38, 40, 31, 40, 40, 40, 31, 40, 34, 40, 40, 31, 34, 32, 39, 36, 39, 31, 36, 36, 33, 41, 28, 37, 32])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EEGGEEHE@8JJJIJIIJJJJJIJJJJJJJIHIIHJJIJJJJJJJIJJJJJIHIIGEJJJJJHHHHHFFFFFBCC'), ('UQ', 0)]
C0FJ4ACXX120306:7:1306:5189:150683	83	6	140453062	60	76M	6	140452961	76	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [35, 31, 31, 33, 34, 35, 29, 40, 36, 27, 34, 40, 41, 32, 33, 40, 41, 31, 41, 34, 34, 33, 31, 34, 39, 39, 33, 33, 39, 41, 36, 40, 31, 41, 33, 32, 41, 34, 36, 36, 34, 40, 34, 33, 31, 40, 34, 39, 31, 34, 37, 38, 38, 32, 39, 39, 40, 31, 39, 33, 40, 41, 31, 33, 32, 39, 35, 39, 32, 35, 35, 32, 38, 32, 37, 31])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '==:HG@7HC78FIGFHF;JJIIHGHGIHFIJIHJIHIIEJIIJIGIIIIJIIG@HFCAGIJJIHHHHHFFFDD@@@'), ('UQ', 0)]
D0MUKACXX120302:8:1104:17662:43353	83	6	140453062	60	76M	6	140453007	76	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [39, 31, 41, 35, 30, 33, 35, 40, 36, 29, 29, 41, 41, 32, 33, 41, 41, 32, 41, 34, 34, 34, 32, 34, 38, 40, 32, 33, 40, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 36, 34, 41, 34, 34, 33, 41, 34, 40, 32, 34, 39, 39, 39, 31, 40, 40, 39, 32, 41, 33, 40, 40, 31, 33, 31, 39, 35, 40, 31, 36, 36, 33, 40, 31, 38, 32])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C>CGCA@DC=7JIIHIIGJJJJJJJJJJJJJJJJJIJJJJJJJJJJIJJJJJHFJIGFJIJJJHHHHHFFFFF@CC'), ('UQ', 0)]
C0FJ4ACXX120306:8:1102:20976:38233	163	6	140453063	60	68M8S	6	140453181	68	TCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTT	array('B', [23, 36, 31, 32, 29, 29, 35, 32, 30, 28, 31, 11, 29, 30, 27, 25, 20, 36, 31, 37, 29, 35, 30, 27, 28, 23, 23, 35, 26, 27, 40, 32, 27, 33, 35, 37, 34, 35, 30, 26, 34, 27, 34, 29, 22, 35, 36, 32, 31, 39, 18, 34, 34, 37, 39, 9, 34, 28, 36, 34, 27, 32, 33, 33, 26, 33, 38, 2, 2, 2, 2, 2, 2, 2, 2, 2])	[('MD', '68'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDBDAH??+<C::2CEC;FD:<34A99CA7EHG??:D?9B:0B?DEB3BFFF(B7==7==;;E@#########'), ('UQ', 0)]
D0MUKACXX120302:7:2107:9365:181919	99	6	140453063	60	76M	6	140453119	76	TCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTG	array('B', [31, 36, 34, 32, 30, 31, 30, 35, 30, 30, 36, 38, 33, 27, 36, 36, 31, 37, 32, 35, 35, 35, 29, 33, 37, 33, 32, 39, 35, 33, 40, 33, 38, 33, 35, 37, 36, 40, 32, 34, 39, 34, 34, 34, 35, 33, 39, 33, 32, 40, 32, 34, 33, 37, 30, 38, 35, 37, 36, 39, 38, 28, 29, 38, 25, 31, 39, 33, 30, 34, 33, 39, 34, 39, 35, 34])	[('MD', '76'), ('PG', 'bwa.7'), ('RG', 'D0MUK.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@DDD;BFFDDD>FE>BGGGG??FGIHEIGIIGGGIIIIGIBBBDDFGG>BFF;DCFGGF7;C;>DEAEHHHHF>'), ('UQ', 0)]
D0N3RACXX120302:5:2305:12454:137469	83	6	140453063	60	5S71M	6	140452998	71	CAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCCCTCCATCGAGATTT	array('B', [2, 2, 2, 2, 2, 2, 35, 31, 30, 32, 30, 28, 12, 21, 20, 32, 30, 14, 12, 33, 38, 32, 38, 31, 30, 29, 26, 21, 30, 31, 29, 34, 33, 39, 36, 36, 30, 38, 27, 28, 11, 31, 13, 10, 27, 13, 8, 17, 18, 35, 27, 38, 30, 32, 35, 34, 28, 17, 23, 20, 2, 23, 34, 19, 22, 34, 28, 28, 25, 31, 33, 37, 30, 32, 31, 28])	[('MD', '56A14'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '######AA@>;7).)?7))ADC@@;=7.87@EAEEBBB=9)B**9**00??DBED?0):8);A28AA=;>DDD???'), ('UQ', 23)]
D0MUKACXX120302:8:2101:2243:31893	163	6	140453064	60	76M	6	140453103	76	CAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGT	array('B', [23, 34, 35, 30, 29, 31, 32, 29, 28, 35, 34, 30, 28, 33, 37, 32, 37, 32, 35, 34, 35, 31, 40, 40, 33, 30, 38, 37, 33, 40, 33, 37, 32, 34, 37, 36, 40, 29, 30, 38, 34, 31, 35, 37, 36, 40, 32, 31, 41, 38, 37, 34, 31, 37, 37, 32, 37, 35, 40, 37, 33, 31, 37, 31, 34, 39, 34, 30, 33, 33, 35, 33, 38, 36, 39, 32])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFAEDBFB>DDGIEEFCGGIJGIGGIIIIB@GHIBFCH>GEHGDFHCBH;DDECFHGGE@@@DCAEHAEEEEE'), ('UQ', 0)]
D0N3RACXX120302:3:2302:5103:52147	163	6	140453064	60	76M	6	140453178	76	CAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGT	array('B', [23, 34, 35, 30, 30, 35, 33, 30, 29, 33, 34, 31, 31, 37, 36, 32, 38, 32, 34, 35, 35, 29, 37, 33, 33, 31, 38, 36, 32, 34, 31, 37, 33, 36, 34, 35, 34, 32, 34, 37, 34, 35, 36, 39, 36, 38, 31, 31, 37, 37, 38, 33, 37, 37, 37, 33, 37, 35, 40, 38, 34, 32, 40, 31, 34, 40, 33, 31, 32, 32, 38, 32, 38, 36, 36, 31])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@FFFFFHFBFHGIJJIGGIGIGJGIGGGIGIIEGGJJGGIGJJIEHIIHIGGFGGIJJJJJJJJGIHHFFEFC@'), ('UQ', 0)]
D0N3RACXX120302:3:2203:16959:165674	1107	6	140453064	60	2S74M	6	140452961	74	CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT	array('B', [2, 2, 2, 31, 21, 29, 25, 27, 36, 26, 21, 25, 36, 31, 16, 29, 33, 30, 33, 34, 33, 32, 32, 32, 37, 40, 31, 28, 31, 33, 35, 36, 30, 32, 31, 34, 38, 34, 37, 32, 33, 38, 31, 33, 32, 34, 34, 36, 24, 32, 36, 35, 36, 28, 36, 31, 35, 29, 37, 34, 36, 35, 32, 33, 29, 37, 35, 38, 32, 36, 31, 29, 33, 32, 32, 31])	[('MD', '74'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###@7=;;C=/?F@.ADCCJIHGCHHG?ECHEHEGBIIG@IIGHEGGG?GGEG@HEFFIIHHJHHGHHEFDDD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2205:17332:54473	163	6	140453066	60	76M	6	140453123	76	ATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAG	array('B', [23, 30, 26, 36, 32, 29, 29, 35, 35, 31, 29, 38, 37, 32, 37, 33, 35, 35, 35, 31, 40, 39, 32, 31, 38, 38, 33, 39, 33, 37, 35, 34, 36, 35, 41, 27, 30, 34, 32, 33, 35, 30, 36, 39, 32, 30, 39, 37, 36, 33, 37, 36, 37, 34, 38, 35, 40, 38, 34, 32, 40, 32, 34, 42, 32, 31, 32, 33, 40, 33, 37, 36, 41, 32, 31, 36])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDFFFGFFHHGIJJJIGHIGIGIHGHGCGGIIECFGGH>GHFFHGCCDEHIGGIJFGIJJI=EHIGHFHFCH?'), ('UQ', 0)]
D0N3RACXX120302:7:2304:12571:141374	147	6	140453066	60	76M	6	140453001	76	ATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAG	array('B', [32, 35, 34, 39, 35, 31, 29, 41, 42, 32, 34, 41, 41, 33, 41, 34, 35, 34, 32, 33, 39, 40, 33, 35, 40, 40, 36, 40, 31, 41, 32, 31, 41, 34, 39, 36, 34, 40, 33, 33, 32, 41, 34, 40, 32, 33, 38, 38, 40, 31, 40, 39, 38, 30, 40, 33, 39, 40, 31, 32, 31, 39, 35, 39, 31, 34, 33, 31, 38, 29, 39, 31, 35, 31, 34, 23])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHCGE=7JJJIJJIJJJJJIJJJIHGJJIIHGJJIJIIJJJJJJJJJJHHJIGBJJJJJJJJJHHHHHFEFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2302:10215:139491	163	6	140453067	60	76M	6	140453153	76	TTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGC	array('B', [23, 31, 36, 33, 30, 29, 35, 36, 31, 29, 38, 36, 32, 37, 32, 35, 35, 34, 31, 39, 40, 33, 31, 38, 38, 33, 40, 33, 38, 32, 36, 39, 36, 39, 31, 33, 40, 34, 35, 35, 38, 36, 41, 33, 32, 40, 40, 38, 33, 38, 38, 38, 34, 39, 36, 40, 38, 34, 32, 40, 32, 35, 41, 31, 32, 33, 34, 41, 34, 37, 36, 40, 32, 31, 41, 37])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CC@FFFFFHGHGHJGIGGIIJIGGJIIJIGIJJFHJIIIGIJJJJJHFHIGIIJIJJJJJGJJ=GIIIHGGFHHHB'), ('UQ', 0)]
C0FJ4ACXX120306:4:2106:13055:193225	1171	6	140453068	60	76M	6	140452998	76	TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT	array('B', [32, 38, 33, 24, 18, 40, 40, 33, 34, 41, 43, 33, 41, 33, 34, 34, 32, 33, 38, 40, 33, 34, 39, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 35, 33, 39, 33, 34, 32, 41, 34, 40, 32, 33, 39, 39, 39, 31, 40, 38, 39, 28, 40, 33, 40, 40, 32, 33, 32, 39, 35, 39, 31, 34, 34, 32, 39, 29, 37, 31, 34, 29, 33, 36, 36, 23])	[('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EC?7)FGGDJIHJJJJJIIIJIIIGHIJJIJJJIHGJIIJJJJIJJIIJHGDJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:7:1203:10375:150536	147	6	140453068	60	76M	6	140452998	76	TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT	array('B', [30, 36, 34, 24, 18, 37, 41, 32, 34, 40, 39, 32, 41, 34, 34, 33, 32, 34, 39, 41, 32, 34, 40, 41, 36, 37, 32, 40, 33, 31, 40, 33, 39, 36, 34, 39, 34, 34, 32, 41, 34, 40, 32, 33, 38, 39, 41, 31, 40, 39, 39, 30, 41, 33, 39, 41, 31, 33, 32, 39, 35, 39, 30, 34, 34, 32, 39, 29, 38, 31, 34, 29, 33, 37, 38, 23])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=A?7.GGGFGGIIJJJJJJJJHJIHFIIIHIIJIGGJJJJJJIGJJJIJIGCJIJJJIJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:8:2307:5211:74086	1107	6	140453068	60	76M	6	140453045	76	TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT	array('B', [33, 37, 36, 23, 19, 40, 41, 29, 35, 40, 41, 32, 40, 34, 32, 33, 32, 33, 36, 40, 32, 34, 38, 38, 37, 39, 31, 40, 31, 29, 41, 34, 39, 36, 34, 41, 32, 33, 31, 41, 33, 39, 31, 29, 38, 37, 36, 31, 39, 38, 39, 31, 40, 33, 38, 40, 30, 33, 31, 39, 35, 39, 32, 35, 35, 34, 41, 31, 41, 33, 36, 31, 34, 37, 38, 32])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AA?4)JHECGHHGGHEGDEIGGGBIHFCF<JGIIGHDIHHIHF>HG@?HGC<GCGHCIJIGJJHFHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:3:2104:15433:30528	147	6	140453068	60	76M	6	140453011	76	TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT	array('B', [30, 36, 35, 24, 30, 40, 41, 34, 34, 40, 41, 32, 40, 34, 34, 34, 31, 33, 37, 39, 33, 34, 41, 41, 36, 37, 31, 41, 30, 32, 39, 32, 38, 36, 33, 40, 33, 33, 32, 41, 34, 39, 32, 33, 38, 36, 38, 32, 40, 40, 39, 30, 34, 32, 40, 40, 31, 32, 31, 38, 35, 38, 31, 34, 34, 32, 38, 30, 37, 31, 34, 29, 33, 36, 37, 23])	[('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';??4=JJGHIIIIJIJIGIJIIJIHGGHDGGGJJIIJJJJIIJIJIHEIHF?JGJJIFJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:5:1201:8666:39990	83	6	140453068	60	76M	6	140453045	76	TCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT	array('B', [33, 36, 34, 15, 6, 39, 41, 31, 34, 41, 39, 32, 40, 33, 33, 34, 32, 33, 39, 40, 32, 33, 40, 41, 36, 40, 32, 41, 32, 31, 41, 33, 38, 36, 33, 40, 33, 33, 33, 41, 33, 40, 32, 34, 38, 39, 40, 31, 40, 38, 37, 31, 41, 34, 40, 40, 32, 33, 32, 39, 36, 40, 32, 35, 35, 33, 40, 31, 38, 33, 37, 31, 35, 38, 38, 32])	[('MD', '4A71'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'E?=)(IHCDIGHGJJJIGJIIIJJJIGIGGIGIIJIJJIJJJIJJJIGIHFEJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 6)]
C0FJ4ACXX120306:3:2301:8334:182439	99	6	140453069	60	76M	6	140453134	76	CTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTA	array('B', [31, 34, 26, 30, 36, 38, 33, 31, 37, 38, 33, 38, 34, 34, 34, 35, 30, 40, 30, 33, 31, 38, 37, 33, 40, 32, 38, 33, 36, 38, 35, 40, 31, 30, 39, 33, 36, 35, 38, 36, 40, 34, 29, 40, 40, 40, 33, 38, 38, 39, 34, 39, 35, 38, 39, 34, 33, 40, 32, 34, 40, 33, 32, 32, 34, 39, 33, 39, 36, 40, 32, 31, 40, 37, 35, 30])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDFFFDHGHGEHIEF>FBGGHGHIGIGEHCFIGGIIIGCDHIIIGGIGIDHIIIIIGIIEHGIIIHEEEHFDD'), ('UQ', 0)]
C0FH2ACXX120312:7:2208:18211:44140	1619	6	140453069	60	8S68M	6	140452995	68	CCTCAATTCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGCCCCACTCCATCGAGATTTCAC	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 36, 35, 6, 31, 37, 30, 36, 12, 35, 32, 30, 32, 30, 33, 30, 30, 37, 36, 32, 34, 37, 36, 33, 32, 15, 39, 32, 31, 37, 31, 36, 35, 32, 36, 31, 32, 32, 38, 25, 32, 31, 32, 36, 37, 20, 4, 37, 30, 39, 31, 26, 23, 21, 28, 32, 33, 31, 36, 33, 35, 30, 34, 34, 32, 31, 30, 29])	[('MD', '3A42A21'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '#########C=(A@A@1AA:CAC=9DDD@DBD9*DDBB9?ADBDCDC3;DAEC1)F=FE:38:DDBDDABDDD<?<'), ('UQ', 10)]
D0N3RACXX120302:6:1203:10699:130634	147	6	140453069	60	76M	6	140452954	76	CTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTA	array('B', [39, 31, 19, 21, 39, 41, 31, 34, 40, 41, 31, 41, 34, 34, 34, 33, 33, 39, 38, 32, 34, 40, 40, 35, 39, 31, 41, 33, 30, 39, 33, 39, 36, 33, 41, 33, 33, 32, 41, 33, 39, 32, 33, 38, 38, 41, 31, 39, 38, 38, 28, 40, 34, 39, 40, 30, 32, 31, 37, 34, 37, 31, 34, 34, 32, 37, 30, 38, 31, 35, 29, 33, 36, 38, 30, 23])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EA7)GHD@IHDIJJJJIIGJHIIHFEIGDGGJJIHIIIJIIJIJJHGHFG<HDJIGHIGIGJIHGGHHFFFFFCCC'), ('UQ', 0)]
C0FH2ACXX120312:7:2203:15923:122451	1187	6	140453071	60	76M	6	140453224	76	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA	array('B', [23, 29, 36, 36, 31, 29, 35, 36, 31, 36, 31, 34, 35, 35, 30, 40, 39, 32, 31, 39, 38, 33, 41, 34, 37, 34, 36, 38, 36, 40, 30, 32, 40, 34, 36, 35, 38, 36, 41, 34, 31, 41, 40, 40, 33, 39, 39, 38, 33, 38, 35, 39, 38, 34, 32, 40, 32, 34, 40, 34, 32, 34, 34, 40, 34, 38, 37, 41, 33, 32, 42, 40, 35, 31, 40, 33])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHHIJJJJJJJIJIJJJIIGGIIIIIJIJJJJJGJJIIJIIJJJJJJJGJJJJJJJJHHHHHHHF'), ('UQ', 0)]
D0MUKACXX120302:5:2205:18195:186196	99	6	140453071	60	76M	6	140453166	76	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA	array('B', [32, 30, 36, 38, 33, 32, 37, 37, 33, 38, 33, 35, 35, 35, 32, 41, 40, 33, 32, 39, 38, 33, 41, 34, 38, 33, 36, 38, 36, 40, 32, 33, 40, 33, 36, 36, 39, 36, 40, 33, 32, 40, 41, 40, 34, 39, 38, 38, 34, 38, 37, 40, 39, 33, 32, 40, 33, 34, 41, 33, 33, 33, 33, 40, 34, 39, 37, 41, 32, 32, 41, 39, 36, 31, 41, 33])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJIJJJJJIJJJJHHHHHHH>'), ('UQ', 0)]
D0N3RACXX120302:2:2302:4867:46185	99	6	140453071	60	76M	6	140453110	76	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA	array('B', [32, 31, 37, 38, 32, 31, 37, 38, 32, 38, 33, 35, 36, 35, 30, 40, 40, 33, 32, 40, 37, 34, 41, 34, 38, 33, 35, 39, 37, 42, 32, 34, 40, 34, 36, 35, 39, 36, 38, 33, 32, 41, 40, 40, 33, 38, 39, 39, 33, 39, 37, 40, 39, 33, 31, 40, 32, 34, 41, 34, 33, 34, 33, 41, 34, 40, 38, 42, 32, 32, 41, 39, 37, 31, 41, 34])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIHIJJJJIJJIIJJJJJIJJJJJJIGHIJJJIJJJJJJJJJIIJJJJJJJJJJJJHFHHHHHC'), ('UQ', 0)]
D0N3RACXX120302:2:2303:12308:118148	163	6	140453071	60	76M	6	140453224	76	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA	array('B', [23, 31, 36, 36, 31, 29, 36, 36, 31, 36, 31, 34, 34, 34, 31, 40, 39, 33, 31, 39, 37, 33, 40, 33, 38, 33, 35, 38, 36, 41, 32, 33, 40, 33, 35, 36, 39, 36, 41, 34, 31, 40, 40, 40, 34, 39, 39, 38, 34, 39, 36, 40, 39, 33, 32, 39, 32, 34, 40, 35, 32, 34, 34, 40, 34, 39, 37, 41, 32, 31, 40, 39, 35, 31, 40, 33])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJIJIJEHIJJJJJJGIJJJJJJJHHHHHHHF'), ('UQ', 0)]
D0N3RACXX120302:4:1206:18391:166630	1699	6	140453071	60	70M6S	6	140453224	70	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGGTGGGACCCCCTCCATCGAGATTTCACTGTAGCTAGA	array('B', [23, 31, 33, 12, 25, 18, 31, 12, 20, 32, 31, 34, 27, 27, 23, 36, 22, 30, 20, 33, 36, 30, 32, 19, 11, 10, 9, 24, 35, 33, 19, 9, 14, 23, 33, 33, 36, 23, 30, 7, 22, 29, 28, 29, 25, 34, 33, 33, 10, 19, 34, 26, 29, 32, 12, 31, 13, 27, 33, 10, 26, 29, 26, 31, 24, 34, 35, 35, 33, 2, 2, 2, 2, 2, 2, 2])	[('MD', '39A8A21'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '=@?+:2A+2AFF;<<C9<3AF@E3+++<E?1**1CBD3?*0??A?@?;(-7-;@)8-7@(57.77=?@?#######'), ('UQ', 17)]
C0FJ4ACXX120306:3:2308:11562:195428	83	6	140453071	60	76M	6	140453038	76	TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA	array('B', [30, 31, 35, 40, 32, 35, 40, 41, 32, 41, 33, 34, 33, 32, 33, 37, 40, 32, 33, 40, 41, 37, 40, 32, 41, 34, 32, 41, 37, 38, 36, 34, 40, 34, 34, 32, 42, 34, 39, 32, 33, 39, 39, 39, 31, 41, 39, 40, 33, 40, 33, 40, 41, 31, 33, 31, 40, 36, 40, 32, 35, 35, 33, 40, 31, 41, 33, 38, 31, 35, 38, 40, 32, 35, 37, 32])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EAEIIGIHFJJJJIGGJIGJJJIIJIHHCJGHIIJJJJIIIJIHHIHF@IGJJJJJJJIJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1203:17036:61731	99	6	140453072	60	76M	6	140453207	76	ACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGAC	array('B', [32, 36, 37, 33, 31, 37, 38, 32, 38, 33, 35, 35, 35, 31, 40, 40, 33, 32, 40, 38, 33, 41, 33, 39, 33, 36, 40, 36, 41, 32, 33, 41, 34, 36, 35, 39, 35, 41, 34, 33, 41, 40, 40, 34, 39, 39, 39, 33, 39, 37, 41, 38, 34, 32, 40, 32, 34, 41, 34, 32, 34, 34, 41, 34, 40, 36, 41, 33, 30, 40, 38, 36, 32, 39, 33, 36])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJIJJJJJJJJJJJIJJJJIJJJJJJJIIJJJJJIJJJJJIJJJIIGFEHFEFB'), ('UQ', 0)]
C0FJ4ACXX120306:4:2102:11733:148978	147	6	140453072	60	2S74M	6	140453000	74	TTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAG	array('B', [2, 2, 2, 33, 39, 31, 28, 29, 37, 31, 31, 34, 33, 32, 33, 24, 38, 37, 32, 33, 28, 32, 34, 30, 30, 35, 30, 18, 34, 13, 35, 25, 28, 39, 34, 31, 31, 33, 27, 35, 31, 32, 31, 34, 39, 32, 39, 39, 39, 30, 38, 33, 29, 36, 29, 28, 23, 35, 35, 39, 29, 35, 28, 32, 34, 30, 32, 30, 17, 28, 33, 36, 32, 27, 33, 23])	[('MD', '74'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###@G@7;@8;GGBB3FDF?;>B<???0B*B9:GGBD?9@FF?@GGIHGEGF?DCA?EIHEG>FBH==3EDD?<B@'), ('UQ', 0)]
C0FJ4ACXX120306:6:1108:9868:95295	99	6	140453073	60	76M	6	140453134	76	CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTGACTGTAGCTAGACC	array('B', [31, 35, 34, 31, 37, 37, 33, 36, 33, 35, 35, 35, 32, 39, 37, 34, 32, 39, 37, 35, 39, 34, 37, 34, 36, 36, 35, 39, 31, 33, 37, 34, 36, 36, 38, 35, 39, 32, 31, 41, 30, 37, 34, 37, 38, 38, 35, 37, 36, 35, 38, 34, 33, 39, 32, 35, 39, 34, 33, 33, 34, 35, 33, 38, 35, 39, 32, 31, 41, 38, 36, 32, 38, 32, 34, 34])	[('MD', '61C14'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFFHGHHHGGIIJJJJDHIJIGIHGGIIJIEG>DC>DHIJIIJGAGIIIGIJEGGI;DHEGDHGGGHHFED'), ('UQ', 35)]
C0FJ4ACXX120306:7:1306:11314:126944	147	6	140453073	60	76M	6	140453002	76	CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC	array('B', [40, 41, 32, 33, 38, 41, 33, 40, 33, 34, 34, 32, 34, 39, 41, 32, 33, 40, 41, 36, 38, 32, 41, 33, 32, 40, 33, 38, 36, 34, 40, 33, 33, 32, 39, 33, 39, 32, 33, 39, 38, 39, 30, 38, 38, 39, 33, 40, 33, 39, 40, 31, 33, 32, 37, 35, 38, 32, 35, 35, 32, 40, 31, 39, 31, 37, 29, 33, 36, 37, 28, 33, 35, 31, 36, 23])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HFIGGHGIGJJIIJJIGJJIGHHHGFIIIIJIIIIIIHGHHHAGGFBIGIIGIIEGHHGIIHFHHHHHFEDDD@C@'), ('UQ', 0)]
D0MUKACXX120302:8:1106:3148:189526	83	6	140453074	60	9S67M	6	140452966	67	AATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTA	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 33, 36, 41, 39, 33, 41, 31, 33, 33, 32, 34, 39, 37, 30, 34, 37, 40, 35, 37, 31, 40, 34, 31, 39, 30, 38, 34, 34, 39, 32, 30, 30, 31, 24, 38, 30, 33, 36, 38, 36, 30, 38, 33, 38, 28, 37, 33, 39, 39, 28, 32, 30, 29, 34, 36, 31, 35, 35, 31, 37, 31, 40, 33, 34, 30, 31])	[('MD', '67'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '##########E@FBBCAGHBGHFDGEGD??GGHG>GEIEEFD:3EFECF@?G@EAEIHGC@E9FDHHHDBBFF@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2105:20561:16760	83	6	140453075	60	76M	6	140453005	76	ATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAA	array('B', [29, 34, 40, 40, 32, 42, 33, 34, 33, 32, 33, 38, 40, 32, 34, 41, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 36, 34, 40, 33, 33, 32, 40, 34, 40, 32, 33, 38, 38, 40, 31, 41, 40, 40, 31, 41, 33, 40, 41, 32, 34, 32, 40, 36, 40, 31, 36, 35, 33, 40, 31, 40, 33, 38, 31, 36, 39, 41, 31, 35, 37, 31, 39, 40, 29, 32])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EJHHJIJGJIJJIJJJJIHJJJJIJJIGIIIJJJJIJIHHJIHHIGJJIIJJJJJJJJHGJIHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:8:1202:14511:169975	147	6	140453075	60	2S74M	6	140452942	74	CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC	array('B', [2, 2, 2, 34, 35, 28, 32, 40, 31, 33, 33, 31, 32, 35, 25, 32, 29, 39, 40, 36, 37, 32, 39, 33, 30, 39, 33, 36, 34, 24, 35, 30, 33, 32, 41, 32, 36, 33, 32, 37, 37, 36, 27, 39, 39, 40, 32, 41, 23, 37, 40, 32, 33, 30, 37, 36, 38, 31, 35, 34, 33, 38, 31, 39, 32, 36, 20, 32, 36, 38, 21, 33, 35, 31, 34, 23])	[('MD', '74'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###E@7=IHGGCF=3=<GCHFHCGDBEFB4?FCIFBGF@GGE8IHFCH3GHHFGGJIGHGFGFFFC8ADD<DD?BB'), ('UQ', 0)]
D0N3RACXX120302:2:1202:12151:149316	147	6	140453075	60	76M	6	140452988	76	ATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAA	array('B', [31, 32, 39, 40, 32, 40, 34, 35, 34, 33, 34, 39, 40, 33, 34, 39, 41, 36, 40, 32, 40, 32, 32, 41, 33, 39, 35, 33, 40, 34, 34, 32, 41, 33, 39, 33, 33, 38, 38, 39, 31, 39, 39, 39, 30, 40, 33, 40, 40, 32, 33, 31, 40, 35, 40, 31, 35, 35, 33, 39, 31, 39, 32, 37, 29, 34, 37, 38, 29, 33, 36, 30, 37, 37, 31, 23])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'FEIHGIJJJJJJJJJJJJJJIHFHHDHHIJJJJJJJIJJIHJIGFJJJJJJJJIIJJJJIIJIHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:1:2107:21310:100685	1171	6	140453076	60	3S73M	6	140452942	73	CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC	array('B', [2, 2, 2, 2, 33, 36, 32, 39, 33, 32, 33, 33, 34, 39, 38, 31, 29, 23, 39, 36, 38, 31, 35, 32, 32, 39, 33, 34, 34, 34, 38, 31, 32, 31, 38, 33, 35, 30, 33, 36, 36, 37, 32, 31, 29, 39, 30, 35, 30, 24, 40, 31, 27, 31, 37, 34, 38, 26, 35, 34, 31, 39, 30, 39, 32, 36, 29, 31, 36, 38, 29, 33, 35, 30, 33, 23])	[('MD', '73'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '####AACFGDGHHHFB<<GHBBAHHEGFB@DDBGFHCCIGFC?B@FABA<IF>GEGHAJIGJIHHHHDFFFFDBBB'), ('UQ', 0)]
D0MUKACXX120302:6:2208:11072:169724	163	6	140453077	60	76M	6	140453153	76	CCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAA	array('B', [23, 34, 34, 34, 30, 33, 34, 32, 27, 38, 38, 32, 31, 38, 35, 31, 37, 32, 36, 33, 36, 37, 34, 38, 32, 31, 38, 33, 35, 34, 37, 35, 39, 33, 32, 40, 34, 38, 32, 37, 37, 36, 33, 34, 36, 40, 38, 32, 29, 37, 31, 33, 38, 32, 31, 33, 32, 38, 31, 34, 35, 37, 30, 31, 37, 36, 35, 31, 33, 33, 38, 39, 33, 36, 36, 35])	[('MD', '76'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<@@DDFFDDHHHHIGDGGIICHGGCEHIGDHHH@GHBGEIIGIJIJJG<GDDDAGGECA@F@8CEEDE>EHHEEHD'), ('UQ', 0)]
D0N3RACXX120302:8:1207:6714:98330	1187	6	140453077	60	76M	6	140453155	76	CCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCAACTCCATCGAGATTTCACTGTAGCTAGACCAAAA	array('B', [23, 32, 31, 35, 30, 32, 32, 30, 28, 35, 37, 34, 30, 37, 36, 32, 37, 32, 37, 32, 35, 36, 34, 11, 29, 21, 38, 33, 35, 35, 37, 36, 39, 33, 31, 38, 39, 23, 30, 34, 34, 11, 32, 29, 29, 37, 39, 33, 32, 39, 21, 32, 13, 10, 25, 11, 28, 33, 21, 35, 35, 33, 30, 32, 39, 39, 35, 30, 38, 35, 35, 34, 33, 35, 34, 35])	[('MD', '41C34'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?=?DDDDBDBCCFGGIEGIGEBC+A4FFHIEGGGGEG9?@@)?89BFHGG6;((-)8<4=@==CCHHCE@AA?EEE'), ('UQ', 11)]
C0FJ4ACXX120306:1:2303:10726:22006	163	6	140453078	60	76M	6	140453144	76	CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT	array('B', [23, 34, 36, 32, 33, 33, 34, 30, 38, 38, 31, 31, 38, 37, 32, 40, 32, 38, 33, 35, 38, 35, 40, 31, 33, 40, 33, 36, 35, 39, 37, 40, 33, 31, 40, 40, 40, 34, 39, 38, 38, 34, 39, 36, 40, 38, 34, 32, 40, 32, 34, 40, 33, 32, 32, 33, 40, 34, 39, 37, 42, 32, 31, 42, 40, 36, 31, 42, 35, 40, 38, 34, 36, 36, 36, 32])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@CFFFFFHHGHHJJJJIJJJJJIJHIJJJJIJIIJJJJJJJJJJJJJJJHIJJIIJJJJJIJJJJJJJIHHHFHE'), ('UQ', 0)]
C0FJ4ACXX120306:4:2105:6959:13520	1187	6	140453078	60	76M	6	140453144	76	CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT	array('B', [23, 30, 33, 30, 33, 32, 32, 20, 36, 35, 29, 28, 35, 36, 32, 35, 31, 35, 26, 33, 35, 34, 39, 26, 23, 34, 29, 35, 32, 36, 35, 40, 27, 20, 31, 39, 39, 28, 33, 37, 8, 25, 33, 31, 34, 37, 34, 29, 37, 30, 34, 39, 34, 31, 32, 33, 38, 32, 38, 35, 38, 30, 32, 39, 36, 36, 32, 41, 34, 38, 36, 34, 36, 35, 30, 25])	[('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=;=DBDD=CD?<ACEEDBADEBG:<AAFACFH94?HH;?F)8?;?FFDDBFFHI@CFGHGD=CG@EDHIG??EE;7'), ('UQ', 0)]
C0FJ4ACXX120306:4:1204:20238:3059	595	6	140453078	60	13S63M	6	140452941	63	AATTCTTACCATCCACAAAATGGATCCAGACAACCGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTA	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 32, 40, 33, 33, 33, 32, 25, 37, 37, 25, 34, 36, 38, 35, 38, 32, 30, 10, 19, 16, 6, 34, 28, 32, 39, 27, 21, 31, 34, 31, 39, 28, 32, 37, 29, 38, 32, 9, 36, 30, 25, 24, 11, 32, 37, 32, 32, 30, 37, 35, 36, 29, 34, 34, 35, 33, 28, 37, 31, 33, 29, 15])	[('MD', '21T41'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '##############AECC@=3DBACDCED@8)80):9@D:1<A>E9?C=CC+C<33+DEEEBEDDDDD===DB??1'), ('UQ', 6)]
C0FJ4ACXX120306:8:1308:3301:106883	147	6	140453078	60	76M	6	140452997	76	CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT	array('B', [39, 32, 39, 33, 32, 31, 32, 27, 31, 39, 33, 34, 39, 39, 35, 39, 32, 40, 33, 29, 38, 34, 35, 28, 26, 37, 31, 31, 31, 39, 33, 36, 28, 32, 38, 37, 26, 20, 39, 32, 35, 18, 40, 22, 37, 40, 26, 33, 30, 39, 34, 39, 31, 36, 33, 32, 34, 20, 39, 28, 36, 29, 34, 36, 38, 27, 33, 34, 29, 37, 37, 29, 30, 27, 30, 23])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHEEAD@7;GF@GGGEIF=8GFB8<??D?GGD>GHD?1C??1C3EC9@GHFHGHBFA3C<GGIFDAHADDDD?;<B'), ('UQ', 0)]
C0FJ4ACXX120306:2:1106:14202:137461	163	6	140453079	60	76M	6	140453110	76	ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC	array('B', [23, 34, 33, 34, 33, 33, 29, 39, 38, 32, 30, 37, 36, 32, 39, 33, 37, 32, 29, 37, 36, 40, 31, 32, 36, 33, 35, 35, 38, 37, 40, 34, 31, 40, 40, 41, 34, 38, 38, 38, 34, 38, 36, 39, 37, 33, 32, 39, 32, 33, 41, 34, 32, 33, 33, 40, 34, 38, 37, 41, 32, 30, 41, 39, 35, 31, 41, 33, 39, 38, 34, 36, 36, 35, 32, 38])	[('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFFFFHHHHHJJJJGIJJJHHGIJJJIIIIIJJJJJJJJJJJJIIJJHHIJJJJJJJHIJIIJIIJJIHHHHF'), ('UQ', 0)]
D0MUKACXX120302:5:1301:19119:190492	1187	6	140453079	60	76M	6	140453172	76	ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC	array('B', [23, 35, 34, 34, 35, 32, 29, 38, 27, 32, 30, 37, 32, 32, 38, 32, 27, 32, 34, 38, 32, 36, 31, 31, 35, 33, 34, 35, 34, 33, 38, 29, 30, 34, 31, 32, 32, 33, 36, 29, 33, 36, 34, 39, 38, 34, 33, 37, 31, 34, 41, 33, 32, 32, 30, 35, 33, 38, 35, 32, 34, 26, 31, 36, 35, 27, 35, 32, 38, 39, 33, 35, 36, 32, 28, 38])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@FFDDF?HHG>CGB=BEH@BHHBHGG@BC<???@F?D;BFDGGGHDFHFEHBDAHGE=@78@F;==DHGEH?>C'), ('UQ', 0)]
D0MUKACXX120302:8:2103:19332:163957	1187	6	140453079	60	76M	6	140453110	76	ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC	array('B', [23, 35, 33, 34, 34, 33, 29, 38, 38, 31, 30, 38, 37, 32, 39, 32, 38, 33, 34, 39, 36, 40, 31, 34, 40, 32, 35, 35, 39, 36, 39, 32, 31, 41, 40, 40, 33, 39, 37, 38, 32, 39, 35, 41, 38, 33, 32, 38, 33, 33, 41, 33, 30, 32, 33, 40, 33, 40, 37, 41, 32, 26, 39, 38, 36, 31, 39, 33, 38, 38, 33, 37, 36, 37, 32, 36])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFDEHGHHHJJIJJJJJJJJJIJJJJEGIJJJJJGIIJJJJJJGJJHIEHIJJJJJJ;CFGIGGIIIHHHHB'), ('UQ', 0)]
D0N3RACXX120302:1:2207:6561:39985	163	6	140453079	60	76M	6	140453172	76	ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC	array('B', [23, 33, 31, 34, 34, 34, 29, 37, 38, 31, 30, 38, 37, 32, 39, 32, 38, 32, 34, 38, 35, 40, 32, 32, 40, 33, 35, 35, 39, 36, 40, 33, 32, 40, 39, 39, 34, 39, 39, 39, 28, 37, 36, 39, 38, 33, 33, 40, 31, 33, 37, 34, 32, 33, 34, 40, 34, 39, 36, 41, 32, 31, 41, 40, 36, 31, 42, 34, 40, 39, 33, 36, 35, 36, 31, 37])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@BFFFFFHFHHHJFHIIIJJJGIJJJJJJJGGIJIHJJJ;GHGIJJIIJECGIIJJJJJHIJJJJJFIJJHHEHF'), ('UQ', 0)]
C0FH2ACXX120312:7:1206:4181:158777	99	6	140453081	60	76M	6	140453143	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [32, 34, 35, 36, 31, 40, 38, 33, 31, 38, 37, 33, 41, 33, 38, 33, 36, 38, 36, 41, 32, 33, 40, 34, 36, 36, 39, 35, 41, 32, 32, 40, 41, 40, 33, 38, 38, 37, 33, 38, 36, 40, 36, 34, 31, 39, 32, 34, 40, 34, 32, 34, 34, 40, 34, 39, 36, 41, 33, 31, 41, 39, 36, 31, 41, 34, 38, 39, 34, 37, 37, 35, 32, 39, 33, 36])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'BCCFFFFFHHHHHJJJJJJJJJJJJJJIJFIEIJGGCGHIIIEIIIJJIJJJIIIJJJJJJIJJJJGIIIFHHHFD'), ('UQ', 0)]
C0FJ4ACXX120306:1:1206:11701:42451	163	6	140453081	60	76M	6	140453118	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [23, 35, 35, 34, 29, 38, 37, 30, 28, 38, 36, 32, 38, 32, 37, 33, 34, 38, 35, 41, 31, 33, 40, 33, 35, 35, 39, 36, 41, 33, 31, 42, 36, 39, 33, 39, 39, 38, 34, 39, 36, 40, 38, 34, 32, 39, 32, 33, 41, 34, 32, 33, 33, 40, 32, 39, 36, 41, 30, 31, 40, 39, 36, 31, 41, 34, 39, 38, 35, 37, 36, 36, 33, 39, 34, 37])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFDDHHHGJJJIHIIJJJJJJIJIEEHGIJJJJJJJJJJJIJJJIHIJJIIJIHIGIJJJJJIJJHGHEHF'), ('UQ', 0)]
D0N3RACXX120302:5:2107:2516:43946	1187	6	140453081	60	76M	6	140453124	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [22, 29, 25, 24, 28, 37, 24, 29, 28, 34, 37, 32, 38, 32, 38, 33, 34, 37, 35, 40, 31, 33, 31, 32, 33, 33, 37, 30, 38, 30, 32, 42, 39, 38, 33, 38, 37, 36, 32, 33, 34, 39, 37, 26, 28, 30, 30, 32, 38, 33, 32, 31, 32, 37, 34, 36, 36, 40, 22, 24, 38, 38, 32, 33, 34, 33, 38, 34, 27, 37, 33, 33, 29, 38, 32, 34])	[('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<<8:DD;;DFHHFHHIGIJJJJ>ECBB<AABFHGGIGEB@@DF999DAEGFDHGI@GI47@F>@ADD=7C=?=E>@'), ('UQ', 0)]
D0MUKACXX120302:4:1208:5178:187313	1171	6	140453081	60	76M	6	140452960	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [33, 32, 35, 33, 32, 39, 41, 33, 33, 33, 40, 36, 40, 32, 40, 32, 32, 38, 33, 39, 35, 34, 41, 34, 34, 31, 40, 32, 40, 30, 33, 38, 37, 39, 31, 40, 39, 41, 31, 39, 35, 41, 41, 32, 33, 31, 36, 36, 40, 32, 35, 35, 33, 40, 31, 40, 32, 37, 29, 35, 38, 39, 29, 34, 38, 30, 37, 38, 29, 29, 29, 29, 31, 37, 31, 23])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHJIGHHHA@IGIGHFCGDIJIJIIJIHHCHIGIIJIHGGCJJIHGDJJJIIFIIIJIGGJJIGHHFHFFFDD@@B'), ('UQ', 0)]
D0MUKACXX120302:5:2301:10869:3400	147	6	140453081	60	76M	6	140452960	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [32, 32, 34, 32, 33, 39, 39, 33, 34, 40, 39, 36, 41, 32, 41, 33, 31, 41, 34, 38, 36, 34, 39, 32, 33, 31, 39, 35, 38, 32, 33, 38, 38, 38, 30, 41, 40, 40, 31, 41, 34, 41, 40, 32, 34, 32, 40, 36, 40, 32, 36, 35, 32, 37, 32, 40, 32, 37, 30, 35, 38, 39, 30, 34, 38, 29, 37, 38, 30, 29, 29, 30, 32, 37, 30, 23])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'FHIHEIIGHHEIIHHGGJHJHHGHGIG@GJJIGG@JIIFJIJJJJJJIJJJJIGHJJIJJJJJHHFHHFFFFFBBB'), ('UQ', 0)]
D0N3RACXX120302:7:1307:10834:147529	659	6	140453081	60	76M	6	140453048	76	AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC	array('B', [33, 32, 31, 31, 27, 29, 38, 32, 30, 29, 40, 35, 38, 32, 39, 34, 33, 39, 34, 36, 33, 34, 37, 32, 32, 30, 40, 34, 33, 32, 32, 38, 38, 36, 26, 32, 40, 40, 31, 36, 33, 39, 40, 31, 27, 29, 34, 33, 40, 30, 35, 35, 33, 36, 30, 39, 32, 37, 28, 33, 37, 34, 29, 33, 36, 30, 38, 37, 29, 28, 29, 30, 31, 36, 31, 23])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHD@77@@;<GFEFEGCGFF?GBAFDF?;H@HF?6=FDDB?EFC9A@EHIGGHBEGEGEFE@ADFFHGFDFFDB?@'), ('UQ', 0)]
C0FJ4ACXX120306:3:1207:3887:10798	1187	6	140453082	60	76M	6	140453141	76	AAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACC	array('B', [23, 35, 31, 29, 39, 37, 32, 30, 37, 36, 31, 39, 33, 37, 32, 34, 38, 32, 39, 28, 31, 38, 32, 32, 35, 34, 32, 38, 32, 31, 41, 33, 29, 30, 37, 31, 38, 32, 36, 30, 37, 32, 31, 18, 33, 29, 32, 39, 31, 32, 27, 21, 36, 32, 36, 34, 41, 32, 30, 39, 38, 35, 33, 41, 34, 37, 36, 34, 36, 36, 34, 29, 39, 33, 36, 30])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@;DFFFFHHHDFHIGDCCAEHIHJEEHGICE@>EBCHA@B???B@GGDHA?DGFAHCEC@@FHGG@D@@A?CE@;'), ('UQ', 0)]
D0MUKACXX120302:4:1308:7450:196775	99	6	140453082	60	76M	6	140453141	76	AAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACC	array('B', [30, 31, 36, 30, 40, 39, 33, 32, 39, 38, 33, 40, 33, 39, 33, 35, 38, 35, 40, 31, 34, 39, 34, 36, 36, 39, 36, 40, 34, 31, 40, 39, 39, 33, 39, 38, 38, 34, 39, 36, 39, 38, 34, 32, 40, 32, 34, 41, 34, 32, 34, 33, 41, 34, 39, 36, 41, 31, 31, 38, 40, 36, 30, 41, 34, 38, 37, 33, 36, 37, 37, 32, 38, 32, 38, 34])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@BCDFFFFHHHHHJJJJHJHJIJJJJGGIIIIIIJJIIJIIGIIIIJJIGIJIJJJJGIGIJGIGGEHIGHHGHHE'), ('UQ', 0)]
C0FJ4ACXX120306:5:1307:8654:23840	163	6	140453083	60	76M	6	140453191	76	AATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCT	array('B', [23, 35, 30, 30, 14, 9, 30, 31, 36, 30, 37, 32, 35, 32, 34, 34, 34, 37, 27, 31, 34, 32, 33, 26, 37, 34, 40, 21, 29, 31, 27, 20, 26, 37, 37, 37, 32, 37, 34, 38, 35, 33, 25, 37, 31, 32, 40, 30, 29, 31, 31, 35, 32, 37, 35, 41, 32, 31, 40, 38, 35, 29, 40, 35, 35, 38, 34, 35, 35, 35, 30, 37, 33, 36, 37, 35])	[('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@71+B=FBFBDHHBGE?E@DE:CFF3?<<89EBFGE>GDA<DCDGBDF@?DFDF=FFGG=@FAFHGDC>EECEB'), ('UQ', 0)]
D0N3RACXX120302:2:1205:4517:131741	83	6	140453084	60	76M	6	140452993	76	ATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTA	array('B', [31, 34, 38, 39, 32, 33, 40, 42, 38, 40, 32, 39, 34, 33, 41, 34, 39, 36, 34, 41, 34, 35, 32, 41, 34, 40, 32, 33, 39, 39, 38, 31, 40, 40, 40, 31, 40, 33, 39, 41, 32, 33, 31, 40, 37, 41, 32, 36, 36, 33, 40, 31, 41, 34, 38, 30, 36, 39, 40, 31, 36, 37, 31, 40, 40, 32, 32, 32, 31, 32, 38, 30, 39, 33, 28, 20])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHHIIIIJJIIGGGJJJJJJJJJJJJJIJJHHJIHFHGIJJIIJJJGJJJIHJJIIJJJIJHGHHHHHFEDAFBB;'), ('UQ', 0)]
D0N3RACXX120302:8:2201:1749:176613	83	6	140453084	60	76M	6	140453058	76	ATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTA	array('B', [33, 33, 38, 40, 32, 35, 39, 41, 37, 40, 32, 41, 33, 32, 41, 34, 39, 36, 35, 40, 33, 34, 33, 42, 34, 41, 32, 34, 39, 38, 39, 32, 39, 39, 41, 32, 41, 33, 40, 42, 32, 34, 32, 40, 36, 40, 32, 35, 36, 34, 40, 31, 41, 33, 39, 31, 36, 40, 41, 31, 36, 39, 31, 40, 40, 32, 31, 32, 31, 33, 39, 30, 39, 39, 31, 32])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?HHJJJIJJIIIGFIIJJIIIJIJJJJJJJIGIIHGIIIJJJJIJJJJJJIHJJJJJJJJJJIHHHHHFFDBFC@B'), ('UQ', 0)]
D0MUKACXX120302:8:2304:7366:69876	659	6	140453087	60	76M	6	140453055	76	GATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTT	array('B', [35, 23, 32, 40, 42, 36, 38, 33, 38, 28, 32, 37, 33, 33, 22, 31, 31, 33, 33, 31, 32, 28, 31, 32, 30, 30, 21, 38, 30, 38, 38, 37, 31, 37, 32, 34, 40, 29, 30, 30, 37, 36, 38, 32, 35, 30, 27, 36, 15, 40, 35, 36, 27, 35, 38, 40, 29, 35, 27, 31, 37, 40, 29, 31, 31, 28, 31, 38, 27, 29, 32, 28, 27, 28, 27, 23])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=3>GHC@=@;=@F=4=:GC==89?<92GDDDB:EDACD<CFIGHF<9A+FCF>HCIAI:GGHFC?A<CA??DB:8?'), ('UQ', 0)]
C0FJ4ACXX120306:6:1307:2148:51912	659	6	140453088	60	28S48M	6	140452993	48	GCCTCAATTCTTCCCATCCTCAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCA	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 30, 35, 28, 31, 22, 27, 18, 12, 19, 28, 30, 30, 23, 10, 10, 24, 28, 28, 16, 24, 24, 20, 22, 28, 18, 28, 30, 37, 37, 35, 16, 37, 33, 3, 34, 27, 31, 27, 11, 10, 22, 19, 11, 30, 31, 24, 20])	[('MD', '48'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 23), ('NM', 0), ('SM', 23), ('MQ', 60), ('OQ', '#############################GD<B0B001;D?1**?DC19222<2:FIGA2GC)?<D=,,22+A:11'), ('UQ', 0)]
D0N3RACXX120302:1:1107:19002:45996	147	6	140453088	60	76M	6	140453061	76	ATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTT	array('B', [30, 34, 41, 41, 36, 41, 33, 41, 32, 33, 41, 33, 39, 36, 33, 39, 33, 31, 32, 41, 33, 40, 31, 34, 38, 38, 38, 32, 40, 40, 37, 32, 41, 34, 40, 40, 31, 35, 31, 40, 35, 40, 31, 36, 35, 33, 39, 27, 40, 31, 39, 31, 34, 38, 40, 30, 34, 36, 30, 36, 38, 32, 31, 30, 28, 32, 32, 27, 36, 37, 29, 29, 34, 35, 32, 23])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '>EJJJIIHF@IGIJIGIHFIIIGHGDGHIHD?JIJJIIIIGIIGGHF9IIIIGIIJIGIGIIHFDFA:DFFDFC@@'), ('UQ', 0)]
D0MUKACXX120302:5:2103:12861:42694	1123	6	140453089	60	76M	6	140453190	76	TCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTT	array('B', [32, 37, 38, 33, 39, 34, 36, 32, 35, 38, 35, 40, 32, 33, 40, 34, 35, 35, 38, 36, 40, 33, 32, 40, 40, 40, 33, 38, 38, 38, 34, 38, 36, 40, 38, 33, 32, 40, 32, 33, 41, 33, 32, 33, 34, 40, 33, 39, 37, 40, 33, 31, 41, 40, 36, 31, 41, 34, 39, 38, 34, 36, 36, 36, 33, 40, 34, 39, 39, 37, 32, 33, 33, 33, 31, 33])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJIIIJIJJIJJJJJIJJJJJJJJJIJJJJIJJIJIJJJJJJJJIJJJJIJJJHFHGF?'), ('UQ', 0)]
D0N3RACXX120302:5:1105:17281:19920	99	6	140453089	60	76M	6	140453190	76	TCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTT	array('B', [31, 37, 38, 33, 39, 34, 36, 33, 35, 38, 35, 40, 32, 34, 40, 33, 35, 36, 39, 36, 40, 33, 32, 41, 40, 40, 33, 39, 39, 39, 33, 39, 36, 40, 39, 34, 33, 40, 33, 34, 41, 33, 33, 33, 34, 40, 34, 40, 37, 41, 31, 31, 42, 40, 36, 31, 42, 34, 39, 39, 34, 36, 36, 36, 32, 41, 33, 39, 39, 36, 32, 33, 33, 31, 33, 32])	[('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJIJJJJJJJJJIJJJJJJJJJJJJJJJJJJJIJJJIJJJJJJJGJJJJJJJHHHHHA'), ('UQ', 0)]
C0FJ4ACXX120306:1:2303:15292:24105	83	6	140453090	60	76M	6	140453028	76	CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTA	array('B', [31, 34, 36, 33, 32, 41, 33, 30, 25, 32, 38, 34, 21, 15, 32, 32, 32, 40, 34, 39, 33, 34, 38, 37, 33, 31, 38, 30, 40, 30, 37, 33, 40, 39, 32, 33, 31, 39, 34, 33, 32, 33, 31, 34, 40, 31, 40, 33, 38, 31, 36, 38, 37, 30, 35, 37, 31, 33, 36, 32, 30, 31, 30, 30, 38, 30, 36, 34, 29, 30, 29, 34, 33, 35, 31, 31])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=??;CG@@7:C=.)FC=IGHHGFB>FG=GFCGHEGG@HF<DD<GHHGIGIGHEHBEG@@GFEC>DDDAAB:BD@@?'), ('UQ', 0)]
D0N3RACXX120302:7:1205:20198:183692	83	6	140453091	60	76M	6	140452942	76	CAGACAACTGTTCAAACTGATGGGACCCTCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTAC	array('B', [35, 34, 35, 32, 41, 34, 31, 41, 34, 38, 32, 35, 33, 31, 13, 32, 36, 32, 37, 31, 33, 39, 38, 39, 31, 31, 29, 23, 10, 39, 30, 19, 38, 29, 28, 33, 38, 35, 39, 27, 34, 33, 34, 39, 30, 36, 33, 35, 30, 35, 37, 38, 29, 32, 30, 29, 39, 34, 31, 32, 33, 31, 33, 31, 31, 39, 40, 28, 30, 33, 33, 33, 33, 31, 30, 31])	[('MD', '28A47'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '=AAIIGIIGC>C;=)=A@ECGIIHD@?0*D:6FC<DDGG>E?CEE@EAGHACF<<?GAEEIHD<FFFDDDDDD@@@'), ('UQ', 10)]
C0FJ4ACXX120306:7:1105:21087:61818	1187	6	140453092	60	74M2S	6	140453195	74	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGCTTTCACTGTAGCTAGACCAAAATCACCTATTTTTTCT	array('B', [23, 38, 31, 31, 31, 30, 34, 33, 38, 28, 30, 37, 30, 33, 27, 35, 34, 37, 31, 27, 23, 38, 39, 22, 28, 38, 34, 29, 38, 36, 38, 39, 30, 26, 36, 15, 28, 33, 7, 12, 7, 7, 12, 17, 10, 21, 28, 31, 23, 12, 28, 35, 20, 11, 20, 29, 22, 32, 29, 35, 11, 28, 35, 29, 36, 39, 35, 29, 28, 31, 33, 33, 33, 2, 2, 2])	[('MD', '38A34A0'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '@@;=BADDH<CCDB<FEDDC9FH3<F@?HBGC?9?1:?))***0*09D9*9B4*.8.==F(==;DCD:=AHEH###'), ('UQ', 9)]
D0MUKACXX120302:5:2108:16989:35544	163	6	140453092	60	76M	6	140453126	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [23, 37, 34, 35, 31, 32, 35, 33, 37, 30, 30, 38, 31, 34, 34, 37, 35, 39, 33, 31, 38, 39, 41, 34, 38, 39, 38, 33, 38, 36, 39, 37, 31, 28, 38, 31, 32, 40, 35, 31, 32, 33, 34, 32, 38, 35, 41, 32, 30, 39, 37, 36, 30, 40, 34, 39, 38, 33, 36, 36, 35, 33, 38, 35, 37, 35, 37, 30, 33, 32, 34, 33, 32, 30, 39, 36])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@@FADDFGHHHFIJJJJIGGIJJIJJIIJIGD>GFFHCDEGBBGHHIIGEHGCHIIIGIGDDCGAEEGGIHHGHH'), ('UQ', 0)]
D0N3RACXX120302:4:2303:7656:133024	163	6	140453092	60	76M	6	140453195	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [23, 35, 34, 35, 31, 33, 34, 33, 37, 30, 29, 38, 32, 34, 34, 37, 35, 38, 32, 31, 37, 39, 37, 32, 37, 38, 38, 32, 38, 36, 40, 38, 33, 32, 37, 30, 32, 35, 33, 32, 33, 34, 36, 33, 37, 36, 34, 31, 31, 40, 38, 37, 31, 36, 33, 39, 38, 34, 36, 35, 35, 33, 40, 34, 38, 39, 36, 30, 32, 32, 33, 33, 33, 31, 39, 34])	[('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CC@FFFFFHHFHHIIIHIGIIJIDIIIIIJJJIIGHGGIJJJDIIJEIIHGIIGIHHJJJJJJJIJEEHIGHHHGG'), ('UQ', 0)]
C0FH2ACXX120312:7:2204:19338:186085	83	6	140453092	60	76M	6	140453032	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [35, 39, 32, 41, 33, 33, 42, 34, 38, 37, 34, 42, 32, 33, 32, 41, 34, 40, 32, 34, 39, 39, 40, 32, 40, 40, 38, 32, 40, 34, 39, 40, 32, 33, 32, 40, 36, 40, 32, 36, 36, 34, 41, 31, 41, 33, 39, 31, 35, 39, 40, 31, 36, 38, 29, 40, 41, 34, 33, 33, 31, 32, 38, 32, 40, 40, 30, 32, 36, 35, 34, 35, 29, 32, 35, 31])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHIGHIHHIGHHGGIJJIJIIIGIHGBIIIIGEJJJJIIIIHEJJJJIGHCGE=JJJJIIGGCHHGGFFDFD@@@'), ('UQ', 0)]
D0N3RACXX120302:1:1207:18604:193884	83	6	140453092	60	76M	6	140453010	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [35, 39, 33, 41, 31, 32, 38, 34, 39, 36, 35, 40, 34, 34, 33, 40, 33, 39, 33, 33, 38, 39, 39, 31, 39, 39, 40, 34, 39, 31, 36, 40, 32, 33, 31, 38, 35, 38, 30, 34, 35, 32, 40, 17, 41, 33, 39, 30, 37, 37, 37, 30, 36, 39, 31, 39, 39, 33, 33, 32, 30, 34, 37, 30, 38, 37, 28, 30, 36, 36, 33, 25, 28, 32, 35, 29])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=HGHC=GCIIIIIIIIIGIGIIHFHHFBF>EGHGIHHGC@EEC*IHIGIGGIIGHIIIIHECECFD?BFFDAD@@@'), ('UQ', 0)]
D0N3RACXX120302:3:1306:7934:46361	147	6	140453092	60	76M	6	140453017	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [37, 40, 32, 40, 32, 33, 40, 34, 39, 36, 34, 41, 34, 33, 32, 40, 33, 40, 32, 34, 39, 39, 39, 32, 36, 35, 35, 28, 40, 33, 40, 40, 32, 33, 31, 40, 36, 39, 31, 35, 35, 33, 38, 31, 39, 33, 39, 30, 36, 39, 40, 30, 36, 38, 30, 37, 39, 33, 33, 32, 30, 32, 37, 30, 37, 36, 29, 30, 34, 34, 34, 34, 30, 32, 33, 23])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHJJIHJIJJJJJIHJIJJJJJIHGDGBJIJJIJJJJIIJJJIGJJJJJJJIJHHIJJJIJJHFHHHHFFFFF@CB'), ('UQ', 0)]
D0N3RACXX120302:8:1107:11631:17787	147	6	140453092	60	76M	6	140452889	76	AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT	array('B', [34, 38, 32, 42, 32, 32, 41, 33, 37, 35, 33, 42, 32, 33, 31, 37, 33, 40, 31, 34, 39, 37, 39, 33, 39, 37, 40, 31, 40, 34, 38, 40, 33, 34, 32, 39, 35, 39, 32, 36, 35, 33, 39, 30, 40, 33, 37, 29, 36, 39, 41, 30, 35, 35, 31, 39, 39, 33, 32, 31, 29, 32, 37, 30, 39, 38, 27, 28, 32, 32, 33, 32, 28, 31, 34, 23])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEHHEEGGGHAHEGHEIIGIIGIHFBHFFFIGFFIEGGHCIIHEIIGEJJJIHDHIIJIGF@GFHFDFDEEDD@?@'), ('UQ', 0)]
C0FH2ACXX120312:7:1104:13457:67578	163	6	140453093	60	76M	6	140453135	76	GACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTG	array('B', [23, 33, 36, 31, 34, 33, 32, 35, 29, 30, 34, 31, 35, 34, 35, 35, 39, 32, 30, 38, 36, 37, 33, 35, 36, 37, 32, 38, 36, 40, 38, 33, 32, 40, 33, 33, 41, 34, 33, 34, 33, 38, 33, 38, 35, 39, 33, 31, 41, 40, 35, 30, 41, 34, 39, 38, 32, 36, 32, 35, 32, 38, 34, 38, 38, 36, 30, 31, 34, 33, 35, 33, 30, 38, 35, 35])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFDEDHHDFHIGIIGEGGGIDFHGIJJJIIJIIJIJJIGGHCFHHIJIIIJIHEGCGGEHIIIGIIJJHHGF?'), ('UQ', 0)]
D0N3RACXX120302:2:2306:20821:34699	99	6	140453093	60	76M	6	140453192	76	GACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAGTGTAGCTAGACCAAAATCACCTATTTTTACTG	array('B', [26, 33, 35, 31, 33, 35, 34, 40, 31, 32, 37, 32, 36, 34, 37, 35, 40, 33, 31, 40, 39, 39, 31, 35, 38, 37, 28, 37, 34, 33, 38, 33, 28, 37, 32, 33, 39, 27, 29, 32, 33, 38, 33, 12, 31, 31, 31, 26, 38, 39, 33, 31, 36, 30, 37, 38, 33, 36, 35, 27, 31, 38, 33, 38, 38, 37, 32, 31, 31, 33, 33, 28, 32, 28, 34, 2])	[('MD', '43C32'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?@@ADBDFFHDDHGIGIIIIIIEEEG?GH>GG@CBGH8BDHDC*??F?GH@FE@FHIGG8@FIGGHCE>EA7C7?#'), ('UQ', 12)]
C0FJ4ACXX120306:1:2305:1397:72364	99	6	140453094	60	76M	6	140453177	76	ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [31, 35, 34, 32, 35, 33, 39, 30, 31, 37, 31, 33, 35, 37, 35, 39, 33, 31, 40, 35, 38, 34, 34, 37, 31, 32, 36, 35, 37, 37, 32, 31, 37, 31, 33, 11, 10, 11, 27, 30, 30, 33, 33, 36, 37, 31, 30, 22, 28, 23, 31, 36, 34, 36, 37, 32, 27, 34, 36, 32, 40, 34, 38, 32, 29, 26, 30, 29, 31, 31, 33, 12, 27, 17, 33, 32])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@=DDDADCDDFBGHGBHCHC?@;?EBFE?EC@G))):?9<??B9B494??@@@F9BFGHI@;77C=CAH(7)=A'), ('UQ', 0)]
C0FJ4ACXX120306:2:2304:11465:27253	1123	6	140453094	60	76M	6	140453191	76	ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [32, 34, 33, 35, 35, 35, 40, 32, 32, 38, 33, 35, 35, 38, 36, 41, 33, 31, 41, 40, 41, 33, 38, 38, 38, 33, 36, 36, 39, 37, 34, 32, 38, 33, 33, 40, 35, 32, 34, 33, 39, 34, 38, 36, 41, 32, 31, 42, 39, 37, 31, 41, 34, 38, 37, 33, 35, 36, 35, 32, 41, 34, 38, 39, 37, 31, 32, 34, 33, 34, 35, 31, 37, 35, 41, 31])	[('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFEHHHHHJJJIJJJJJJJJEHGIIIEIJJGIJJIHIJJJFIJJIJIIIJIJJJJJJJJJIGGIJJHHHHF'), ('UQ', 0)]
C0FJ4ACXX120306:3:1201:11909:24566	99	6	140453094	60	76M	6	140453191	76	ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [31, 36, 34, 36, 36, 35, 41, 30, 31, 39, 33, 36, 36, 38, 36, 41, 34, 32, 41, 40, 39, 33, 38, 38, 38, 33, 39, 36, 38, 37, 34, 31, 39, 33, 33, 40, 34, 32, 32, 33, 40, 34, 39, 35, 41, 32, 30, 40, 39, 36, 31, 41, 34, 39, 39, 34, 36, 35, 36, 33, 39, 33, 39, 38, 37, 30, 32, 33, 34, 34, 34, 31, 38, 36, 41, 32])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFFFDHHHHGJJJJIIIJGIJIGJIEHICGIIIIGHIJCHHJGIIIJJIIIIIGGHIHIJJIIIIJJIEFHHH'), ('UQ', 0)]
D0N3RACXX120302:1:2103:18639:59616	163	6	140453094	60	76M	6	140453218	76	ACAACTGTTCAAACTGATTGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [23, 35, 33, 34, 35, 33, 37, 30, 30, 37, 31, 34, 34, 37, 34, 40, 32, 31, 13, 34, 40, 34, 39, 38, 38, 33, 38, 36, 40, 39, 33, 32, 40, 32, 33, 41, 34, 32, 34, 34, 40, 34, 38, 36, 41, 32, 31, 41, 40, 35, 31, 41, 33, 39, 39, 33, 36, 36, 36, 33, 40, 33, 39, 39, 36, 31, 33, 35, 34, 34, 34, 31, 39, 36, 40, 33])	[('MD', '18G57'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJ3AHHIJJJJJJJJJJJJJIJJJJJJJJJJJJJHIJJJJJJJJJJJJJJJJJJJJJHHH'), ('UQ', 13)]
D0N3RACXX120302:7:1306:16646:114795	163	6	140453094	60	76M	6	140453131	76	ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [23, 36, 33, 34, 35, 33, 38, 30, 29, 38, 31, 34, 34, 37, 35, 40, 32, 31, 40, 39, 40, 33, 38, 38, 38, 33, 38, 36, 40, 38, 33, 32, 40, 33, 34, 41, 33, 32, 34, 33, 40, 34, 40, 36, 40, 32, 31, 41, 39, 36, 31, 41, 34, 40, 38, 34, 36, 35, 36, 31, 40, 33, 39, 39, 37, 31, 32, 35, 35, 34, 34, 32, 39, 37, 40, 32])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFFHGHHIJJJIJIJJIJJIJJJIJJJJJJJIJJJJJJIGHJIJGHHHIJJJIIJJJJJJJJJJJHHHHH'), ('UQ', 0)]
C0FJ4ACXX120306:2:2305:5826:69821	83	6	140453094	60	76M	6	140453074	76	ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT	array('B', [33, 38, 32, 32, 41, 33, 37, 36, 34, 40, 32, 33, 31, 40, 33, 37, 32, 33, 38, 38, 36, 32, 36, 32, 35, 31, 38, 31, 32, 40, 30, 33, 31, 38, 36, 37, 31, 36, 36, 34, 41, 32, 39, 32, 35, 31, 35, 37, 39, 31, 35, 35, 32, 39, 41, 33, 33, 33, 31, 32, 40, 30, 35, 40, 30, 31, 35, 36, 34, 34, 30, 30, 38, 34, 33, 31])	[('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CEC=GDIIHF@C=CGC>DDFB:B??9B;AF@EEHGDCHIGIIGGEHHDEGHBCIIIGIIGGFBHBFFBBDDDD@@@'), ('UQ', 0)]
D0N3RACXX120302:1:1203:4907:146297	163	6	140453096	60	76M	6	140453182	76	AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [23, 35, 36, 33, 38, 29, 29, 35, 31, 34, 34, 37, 34, 39, 33, 30, 40, 39, 39, 33, 38, 38, 38, 33, 39, 35, 39, 38, 33, 31, 40, 32, 33, 41, 33, 32, 34, 34, 40, 34, 38, 36, 40, 32, 31, 41, 39, 36, 31, 40, 34, 40, 39, 33, 36, 36, 36, 32, 39, 34, 39, 38, 36, 31, 33, 34, 34, 35, 34, 32, 39, 36, 39, 32, 40, 34])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJIIJJJJJJJJJJJJJIJJJJJJJJJJJIJIJIIIJJHHIJJJJIIJJJJIJJJJJIJJHHHH'), ('UQ', 0)]
C0FH2ACXX120312:7:1104:8721:134744	1107	6	140453096	60	76M	6	140453052	76	AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [32, 32, 39, 33, 38, 37, 35, 40, 32, 35, 33, 41, 33, 39, 32, 33, 37, 38, 39, 32, 38, 41, 38, 31, 40, 34, 31, 40, 32, 33, 31, 38, 36, 38, 32, 35, 34, 33, 39, 33, 40, 33, 38, 32, 35, 38, 40, 31, 36, 40, 32, 38, 39, 33, 33, 31, 31, 33, 38, 29, 39, 39, 30, 31, 31, 35, 33, 33, 30, 30, 40, 32, 37, 34, 35, 31])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '??EEIIIIHG@GHHGEGIGIGIGHFCBHGHGHGGGGEHGFGIIIIGHGEHFGGIGFHEFAIHFF>FDDDDFFF@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:1101:12820:196820	83	6	140453096	60	76M	6	140453052	76	AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [31, 31, 41, 33, 39, 37, 34, 41, 33, 33, 31, 41, 33, 40, 32, 34, 38, 38, 40, 32, 38, 41, 41, 31, 41, 34, 40, 41, 32, 33, 32, 40, 36, 41, 32, 35, 37, 34, 40, 33, 41, 34, 39, 31, 36, 39, 41, 31, 36, 40, 30, 40, 41, 33, 33, 33, 32, 32, 40, 30, 40, 39, 30, 32, 36, 35, 35, 35, 31, 32, 40, 32, 37, 34, 37, 31])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEHHIGIHIJIJJJJJJIHFGIIFJIJIJJJJJJJJJJIGJJJJJJJJJIHJJJJJIHGEJGJHHHHHFFFFFCC@'), ('UQ', 0)]
D0N3RACXX120302:3:2303:1308:147169	83	6	140453096	60	76M	6	140453044	76	AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [34, 32, 37, 34, 39, 36, 34, 40, 34, 35, 32, 40, 34, 41, 32, 33, 39, 39, 39, 31, 40, 38, 38, 30, 40, 33, 41, 40, 32, 34, 31, 40, 36, 40, 33, 37, 36, 35, 40, 33, 40, 34, 39, 31, 36, 40, 40, 31, 36, 38, 31, 40, 40, 33, 34, 33, 32, 33, 37, 29, 40, 40, 30, 32, 35, 35, 35, 35, 31, 32, 36, 33, 36, 35, 36, 31])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EHIJJJJJJJJJJJJJJIHJIHGJJJJJJJJJJJJJJJJJJJJJJJJJHHJJJJJJIHEJJJHGHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:1:2308:2748:9973	147	6	140453097	60	76M	6	140453040	76	ACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAG	array('B', [31, 19, 34, 21, 36, 27, 33, 33, 32, 32, 41, 33, 39, 32, 33, 39, 35, 36, 33, 40, 35, 24, 17, 29, 27, 6, 28, 22, 33, 32, 36, 35, 38, 30, 24, 35, 33, 26, 32, 37, 33, 36, 30, 36, 38, 40, 30, 35, 30, 25, 39, 39, 31, 32, 26, 31, 22, 22, 16, 4, 26, 26, 30, 34, 34, 33, 34, 29, 29, 33, 31, 34, 29, 33, 29, 23])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=3=3C7=CHIIGGHHF@B<FB9*99)93HDFDC?9G@9GCCC@HCHHC<FHHEE<A3<++:>FHHGHHDDFDD=?@'), ('UQ', 0)]
D0N3RACXX120302:8:1306:19567:183510	147	6	140453098	60	76M	6	140452989	76	CTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGG	array('B', [38, 31, 37, 36, 33, 32, 32, 33, 28, 38, 33, 41, 31, 32, 29, 34, 36, 30, 28, 39, 35, 30, 39, 33, 20, 38, 32, 33, 32, 35, 35, 37, 31, 35, 34, 32, 29, 31, 39, 33, 34, 24, 34, 37, 38, 28, 33, 36, 30, 39, 38, 32, 31, 29, 30, 31, 39, 27, 38, 38, 29, 27, 27, 25, 33, 29, 31, 27, 37, 26, 29, 30, 36, 33, 14, 23])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'E?CCB;EC@EFHC@8==;;D?8FD6?GGF@FDGDDB9FGE?<BDE??FEHDIHDF<C<GFGA<:B?C:D;;DD?+B'), ('UQ', 0)]
C0FH2ACXX120312:7:2101:16995:86256	163	6	140453099	37	73M3S	6	140453099	73	TGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAAGA	array('B', [23, 36, 29, 28, 36, 31, 30, 32, 35, 33, 35, 31, 30, 39, 38, 39, 33, 37, 36, 37, 29, 38, 36, 39, 36, 32, 31, 38, 32, 32, 38, 32, 32, 32, 34, 36, 34, 39, 34, 39, 30, 30, 39, 38, 35, 31, 42, 34, 38, 37, 34, 35, 36, 36, 32, 39, 34, 38, 36, 36, 31, 32, 34, 34, 34, 34, 32, 36, 37, 41, 32, 40, 33, 35, 39, 33])	[('MD', '73G1T0'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 37), ('OQ', 'B@?DFFBDHHDBFIIIIIIIEHGGGHGHHGGEHGIFHIEGDFGGGIJIIGGGIIIIJGGEIIJIIICDHIEGCEEE'), ('UQ', 0)]
C0FH2ACXX120312:7:2101:16995:86256	83	6	140453099	37	3S73M	6	140453099	73	TCTTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [34, 40, 36, 33, 37, 35, 35, 40, 32, 32, 32, 42, 33, 39, 31, 33, 37, 38, 35, 30, 29, 39, 32, 28, 32, 34, 37, 41, 33, 34, 33, 39, 36, 41, 32, 36, 35, 33, 39, 32, 41, 34, 38, 31, 35, 39, 40, 32, 35, 39, 32, 39, 40, 34, 33, 33, 32, 34, 39, 30, 40, 41, 31, 32, 35, 35, 35, 34, 31, 32, 40, 32, 37, 33, 37, 32])	[('MD', '0A0A0C73'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 37), ('OQ', 'CHHCGDIIHFGHEIHDFC=6=F?9>GGJJIJIIJJIGHGBIJIJIIHDHGFIIJJJJIHFJIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:7:1307:9217:164847	163	6	140453102	60	76M	6	140453192	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [23, 37, 33, 34, 34, 35, 33, 38, 31, 30, 38, 38, 36, 32, 38, 37, 37, 32, 38, 35, 39, 37, 33, 31, 39, 31, 32, 41, 34, 31, 33, 34, 39, 33, 39, 36, 40, 31, 31, 34, 38, 36, 31, 39, 32, 38, 39, 33, 35, 36, 35, 31, 41, 34, 39, 39, 34, 29, 32, 31, 31, 33, 34, 31, 38, 35, 38, 31, 38, 34, 39, 37, 32, 38, 36, 32])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFDFFHHFHGIJJJJIGIIJGIIGJHIIJGIJJGGGAGHICEHIJJJHIIJJJGEGFHIJJI@ADEHGEHCFH'), ('UQ', 0)]
C0FJ4ACXX120306:1:1106:2337:118212	1107	6	140453102	60	76M	6	140453005	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [34, 40, 33, 33, 33, 41, 35, 40, 32, 34, 38, 38, 39, 30, 41, 37, 40, 31, 41, 34, 38, 41, 32, 34, 32, 39, 36, 40, 32, 35, 36, 34, 41, 31, 41, 34, 39, 31, 37, 40, 41, 31, 35, 39, 31, 40, 41, 33, 34, 33, 32, 33, 40, 31, 39, 40, 30, 31, 35, 35, 35, 35, 30, 31, 40, 32, 38, 32, 38, 35, 37, 36, 33, 37, 34, 31])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHHEGGJIIIIGHAHGGDIIGIIJIGJJJJJJJIJIJJJJJGIHFJJIIJJIGEIIJIJJJIHDHHHHFFFFF@CC'), ('UQ', 0)]
D0MUKACXX120302:5:2101:9596:25754	1171	6	140453102	60	76M	6	140453005	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [34, 39, 32, 32, 32, 41, 34, 39, 33, 34, 39, 38, 41, 32, 40, 39, 38, 31, 41, 33, 40, 40, 32, 33, 32, 39, 36, 40, 32, 36, 35, 33, 40, 32, 41, 34, 38, 31, 35, 40, 41, 31, 36, 40, 32, 40, 40, 33, 34, 33, 32, 33, 38, 31, 40, 40, 30, 31, 35, 34, 34, 34, 30, 30, 39, 32, 37, 31, 35, 33, 36, 35, 32, 38, 35, 23])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HGHHIJJJJJJJIIJIGDJJJJJJIIJJJIJJJJJJJJJJJJIHHIJJJIJHFCJJIJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:2:2307:15728:181423	1171	6	140453102	60	76M	6	140453025	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [34, 37, 32, 32, 32, 41, 34, 41, 32, 33, 37, 38, 41, 32, 40, 37, 41, 31, 40, 34, 39, 41, 30, 33, 32, 39, 36, 39, 31, 36, 36, 33, 41, 32, 40, 34, 39, 31, 36, 40, 41, 30, 36, 40, 31, 39, 40, 34, 33, 33, 32, 33, 38, 32, 39, 37, 30, 31, 35, 34, 34, 33, 29, 31, 36, 31, 36, 31, 36, 33, 36, 35, 30, 37, 35, 23])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HGHHHGIJJIGGIGIEFDIIJICJHHIHIIJIJJJJJJJJJJJIHIIJJJJHGCIGIJJJJIIHGHHHFFFFDCCC'), ('UQ', 0)]
D0N3RACXX120302:3:1104:20776:193084	1171	6	140453102	60	76M	6	140453025	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [33, 38, 32, 33, 31, 38, 34, 35, 26, 34, 23, 35, 37, 31, 38, 38, 36, 29, 37, 33, 38, 37, 32, 33, 30, 39, 35, 34, 32, 34, 35, 32, 26, 21, 31, 33, 35, 30, 35, 37, 38, 29, 36, 40, 32, 36, 38, 33, 32, 33, 31, 31, 34, 30, 39, 39, 30, 31, 34, 34, 34, 34, 31, 30, 36, 31, 31, 32, 35, 33, 36, 29, 32, 32, 35, 23])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHHFHHD@;@6@GAIHF?IIIHJJIHIEIHFF?1CDBIHHIGHHEIIIHGHBF?JJIIJIJIHFHFBGFFFAF@C@'), ('UQ', 0)]
D0N3RACXX120302:4:1105:19762:114976	83	6	140453102	60	76M	6	140453014	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCGCCTATTTTTACTGTGAGGTCTT	array('B', [32, 27, 28, 33, 29, 32, 19, 34, 28, 30, 38, 37, 35, 31, 31, 38, 37, 31, 31, 35, 21, 36, 31, 27, 24, 24, 33, 34, 31, 34, 34, 29, 33, 19, 28, 22, 29, 21, 34, 30, 23, 31, 35, 30, 21, 29, 9, 29, 26, 32, 28, 32, 25, 9, 37, 36, 27, 25, 34, 24, 19, 34, 26, 30, 37, 31, 35, 32, 35, 30, 35, 34, 32, 33, 34, 31])	[('MD', '53A22'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', ';;;?7?.A;>ED@;AFCFAB:CB994EDFFF<B0?0:9D?9FD:1?*<;EFF@+FF?:E:9F<FFFFFD?DBD@@@'), ('UQ', 9)]
D0N3RACXX120302:6:1308:9261:137144	147	6	140453102	60	76M	6	140453025	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [34, 41, 33, 32, 32, 42, 34, 41, 32, 34, 39, 39, 39, 32, 36, 40, 41, 32, 41, 33, 40, 41, 31, 34, 32, 40, 35, 40, 32, 36, 36, 34, 41, 31, 41, 34, 39, 30, 35, 40, 41, 31, 35, 38, 31, 37, 39, 32, 33, 32, 31, 33, 39, 32, 40, 37, 30, 31, 35, 34, 34, 34, 29, 31, 39, 31, 36, 31, 35, 33, 36, 35, 32, 38, 35, 23])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHIJJJJJJJIIEIIHIJJJIIIHGJJJIJJIJJJIGJJIIGFEGIJGHCGCIGIGIIJIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:1207:17091:99164	83	6	140453102	60	76M	6	140453005	76	TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT	array('B', [33, 40, 32, 31, 31, 43, 34, 40, 33, 33, 39, 39, 40, 32, 40, 40, 40, 31, 42, 34, 40, 41, 33, 33, 31, 41, 36, 40, 32, 35, 35, 33, 40, 32, 41, 34, 39, 31, 37, 40, 41, 31, 36, 40, 31, 40, 41, 34, 34, 34, 32, 33, 40, 30, 40, 41, 30, 32, 35, 36, 35, 35, 30, 31, 41, 33, 38, 32, 37, 35, 38, 36, 33, 39, 35, 31])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHIJJJJJJJIJJIHFJJJJJHIJJIJJJJIIJJJJJJJJJIHJJJJJJIGAJIJJJJJJIFHHHFFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:5:1105:5457:182756	83	6	140453103	60	76M	6	140453037	76	CAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTC	array('B', [40, 32, 32, 31, 39, 34, 40, 32, 34, 38, 39, 40, 32, 32, 39, 41, 31, 40, 33, 40, 42, 32, 33, 33, 40, 36, 40, 32, 36, 36, 34, 40, 32, 41, 34, 39, 31, 35, 40, 42, 30, 35, 38, 31, 40, 42, 34, 34, 34, 31, 33, 40, 31, 40, 42, 31, 30, 35, 35, 35, 36, 31, 31, 40, 33, 38, 33, 38, 35, 37, 37, 33, 40, 36, 32, 32])	[('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HEE>ECIIGIHGA=GDBHGJJIGFIJJIJIIIIIJJIGJJIIHGJJJIIHHCEJJIHGIJIIIHHHGHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:2101:2243:31893	83	6	140453103	60	76M	6	140453064	76	CAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTC	array('B', [41, 32, 32, 31, 39, 34, 38, 32, 34, 39, 40, 38, 32, 40, 41, 40, 32, 40, 33, 39, 41, 32, 34, 32, 40, 36, 40, 32, 35, 35, 34, 40, 31, 41, 33, 38, 29, 36, 38, 38, 27, 34, 38, 32, 38, 41, 34, 33, 34, 32, 33, 39, 30, 38, 38, 32, 31, 32, 34, 34, 36, 29, 30, 38, 32, 36, 31, 36, 33, 34, 36, 31, 38, 28, 33, 31])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GHHHEC@EIIHFEFIHFGGGIIIIHIHDBGBHFHGHEIHD>HGHGIIIIGHFAGFDEAGHGEHDFDDFDADAD<@@'), ('UQ', 0)]
C0FJ4ACXX120306:8:1108:12474:182042	83	6	140453105	60	76M	6	140453032	76	AACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT	array('B', [32, 31, 41, 33, 40, 32, 34, 37, 39, 38, 32, 39, 39, 40, 32, 41, 34, 40, 41, 32, 33, 32, 39, 36, 40, 31, 35, 35, 33, 39, 31, 41, 34, 39, 31, 34, 41, 41, 31, 36, 39, 31, 39, 40, 33, 34, 33, 31, 33, 39, 31, 40, 41, 30, 32, 35, 36, 35, 35, 30, 31, 41, 33, 38, 33, 39, 35, 38, 37, 33, 41, 35, 33, 40, 29, 32])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHHIJIIIFFGGGFJIIJIGHHCJIJIHCFJJJIEJIGHGEIJJJIHHDAIJGJIJJJHGIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:3:1203:10562:169856	147	6	140453105	60	76M	6	140453047	76	AACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT	array('B', [31, 32, 26, 31, 30, 27, 34, 35, 38, 30, 33, 30, 28, 26, 29, 33, 33, 31, 34, 33, 29, 14, 40, 36, 36, 32, 36, 34, 32, 31, 32, 34, 33, 36, 26, 36, 39, 28, 31, 32, 37, 29, 32, 39, 32, 24, 33, 26, 32, 9, 21, 34, 34, 21, 25, 25, 26, 30, 31, 28, 28, 29, 32, 32, 31, 38, 34, 36, 34, 31, 29, 32, 31, 30, 30, 23])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CA>;@7DAD;FAA==E=EGE88HGDEBIHEFGCEEIHADFBFBHBDECC+3GF9A::B@EFEFBDHHFDDBDD?B?'), ('UQ', 0)]
C0FH2ACXX120312:7:2106:11118:161212	147	6	140453106	60	76M	6	140452978	76	ACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATG	array('B', [31, 39, 30, 38, 28, 35, 37, 38, 40, 32, 17, 17, 28, 17, 25, 28, 27, 38, 28, 35, 31, 37, 35, 32, 32, 36, 33, 35, 36, 31, 40, 29, 38, 31, 35, 40, 38, 30, 33, 31, 13, 34, 26, 21, 17, 26, 28, 26, 33, 31, 35, 34, 20, 29, 31, 25, 24, 32, 30, 25, 32, 31, 24, 31, 23, 30, 34, 26, 25, 35, 28, 28, 26, 30, 30, 23])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EE;E>GGCHF258)8;<D;FFBD<GGAHDBGAHBIHFDB?)E:94A?<BAEC4B??<@FAAF;C3AC=;DA?A@?B'), ('UQ', 0)]
C0FJ4ACXX120306:3:2108:16634:66706	147	6	140453106	29	76M	6	140452977	76	ACTGATGGGACCCACTCCATCGAGATTTAACTGTAGCTAGACCAAAATAAAATATTTTTACTGTGAGGTCTTCATG	array('B', [31, 32, 31, 38, 30, 33, 30, 38, 35, 31, 25, 36, 41, 32, 40, 34, 29, 39, 31, 34, 17, 39, 36, 38, 31, 36, 30, 31, 5, 30, 34, 20, 8, 31, 29, 28, 7, 24, 30, 38, 21, 36, 24, 7, 28, 29, 17, 12, 6, 21, 5, 15, 25, 28, 33, 35, 35, 34, 30, 30, 38, 30, 37, 31, 37, 34, 36, 32, 31, 38, 34, 31, 38, 30, 34, 23])	[('MD', '28C19C1C0C24'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 29), ('NM', 4), ('SM', 29), ('MQ', 29), ('OQ', 'C;:DC=9D=;9EHGGD>ED?2CIGGGB?0H?:*F?:*<@E?C<2FB<2+A,<EFCFCEIHG>HDDBF?AFEDD@@<'), ('UQ', 31)]
C0FJ4ACXX120306:5:1306:6352:4254	147	6	140453107	60	76M	6	140453022	76	CTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGA	array('B', [31, 33, 38, 30, 34, 37, 38, 38, 33, 34, 34, 29, 17, 40, 32, 38, 39, 31, 33, 32, 40, 36, 39, 32, 34, 34, 31, 40, 29, 39, 32, 34, 30, 35, 36, 37, 25, 33, 34, 28, 39, 35, 30, 33, 32, 30, 10, 30, 17, 24, 26, 30, 31, 32, 32, 33, 35, 30, 29, 39, 31, 32, 32, 36, 35, 25, 36, 31, 37, 32, 29, 38, 29, 34, 36, 23])	[('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';EC>CGHDE@@8)FBGDGGIJIHFDDDGDEDBDF@D<??:G?FEFA+<29<H@@BGIJ?HF@HFC;HHDD;FD@@8'), ('UQ', 0)]
D0N3RACXX120302:7:2208:9680:137856	83	6	140453107	60	76M	6	140453042	76	CTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGA	array('B', [39, 33, 40, 33, 34, 39, 38, 41, 33, 40, 41, 39, 31, 41, 35, 41, 41, 32, 34, 32, 40, 36, 41, 33, 36, 35, 34, 41, 31, 41, 35, 39, 31, 36, 40, 41, 31, 36, 40, 31, 40, 41, 34, 34, 35, 32, 33, 39, 30, 40, 41, 31, 32, 35, 35, 35, 35, 31, 31, 40, 33, 39, 33, 40, 36, 38, 38, 33, 40, 36, 33, 40, 31, 34, 37, 31])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHHJIIIIIIGEJIJJJJIIJJJJJIHGJJJJJJJJJJIJJJJJIHFAJJJIJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2307:2506:121342	163	6	140453108	60	76M	6	140453185	76	TGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAA	array('B', [23, 34, 29, 29, 37, 37, 36, 31, 36, 35, 34, 31, 35, 34, 39, 34, 32, 31, 39, 31, 33, 40, 33, 31, 31, 32, 37, 34, 38, 35, 40, 32, 31, 41, 38, 35, 31, 40, 33, 37, 39, 33, 35, 35, 36, 32, 40, 33, 37, 38, 36, 32, 33, 33, 34, 33, 32, 31, 38, 35, 36, 32, 40, 34, 40, 39, 32, 36, 34, 33, 40, 33, 31, 37, 32, 33])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<?;DDFDFHGBFFHHBHIJJIIIGHGEHIIFIIIGGJJCGHIIJJIIGCHGHIIJJGFHHAGHCHC==@EHDE?>?'), ('UQ', 0)]
D0N3RACXX120302:6:1207:8241:164964	99	6	140453108	60	76M	6	140453191	76	TGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAA	array('B', [31, 34, 34, 31, 40, 39, 39, 33, 39, 38, 38, 32, 36, 35, 38, 37, 33, 31, 40, 32, 33, 40, 34, 32, 33, 34, 40, 33, 38, 34, 39, 32, 30, 39, 38, 35, 31, 41, 34, 34, 35, 32, 35, 36, 35, 32, 37, 34, 39, 39, 35, 31, 31, 32, 32, 33, 32, 30, 38, 36, 42, 33, 42, 34, 41, 40, 32, 40, 37, 34, 39, 33, 32, 40, 32, 34])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFFFFGHFDDGGHHIJIIJIJIIJGG@GGHGHIJJJ?BGHJGHGIJIHBHHHCHGIGIIIIJIDHIGGHHHAA'), ('UQ', 0)]
C0FH2ACXX120312:7:2108:8829:171349	1123	6	140453109	29	76M	6	140453185	76	GATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG	array('B', [24, 27, 30, 34, 33, 27, 32, 35, 21, 30, 32, 31, 35, 31, 35, 32, 31, 38, 31, 33, 39, 35, 27, 29, 33, 37, 30, 22, 24, 21, 32, 32, 30, 36, 32, 31, 40, 33, 36, 38, 34, 35, 32, 32, 30, 38, 33, 35, 36, 33, 31, 33, 27, 33, 32, 32, 31, 38, 35, 40, 32, 37, 30, 27, 18, 31, 38, 35, 32, 39, 35, 30, 39, 34, 33, 35])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 29), ('NM', 0), ('SM', 29), ('MQ', 29), ('OQ', '88?BB=?B1<A;D:A@?CF?F@;AED9114?E<B>GFFFIBG?;BGFBBB?D<CFF=DEG;@:727@DFFICECA?'), ('UQ', 0)]
C0FJ4ACXX120306:3:2307:1703:125755	611	6	140453109	60	76M	6	140453134	76	GATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG	array('B', [30, 13, 26, 39, 36, 37, 32, 36, 23, 27, 34, 30, 34, 37, 34, 33, 31, 24, 30, 33, 40, 33, 28, 31, 31, 14, 16, 38, 34, 39, 29, 31, 39, 24, 36, 30, 38, 32, 38, 37, 33, 36, 31, 37, 27, 37, 31, 36, 37, 35, 32, 30, 31, 33, 31, 32, 31, 38, 36, 40, 32, 40, 33, 39, 37, 30, 39, 35, 33, 40, 35, 32, 41, 32, 32, 37])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?+:DDDDD12C;AC;CC4CEF8AFF**@EE<<C1C?BDEEBD>@<?BDDD@BDIEEDCBDCC:ACACEIIIDC>=='), ('UQ', 0)]
D0N3RACXX120302:4:2306:17439:25442	1689	6	140453109	17	41S35M	6	140453109	35	TGTTACCATGCTCAAAATGGATCCAGACAAGTGTTCTACCTGATGGGACCCAGTCCATCGAGATTTCAGTGTAGCT	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 31, 34, 26, 17, 13, 11, 7, 11, 27, 30, 29, 4, 31, 13, 30, 10, 19, 18, 22, 16, 13, 12, 17, 34, 28, 31, 32, 33, 23])	[('MD', '11C15C7'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 17), ('NM', 2), ('SM', 17), ('OQ', '###############################################AC<2+++1?F<+<,A,2222++3DB?<@='), ('UQ', 23)]
C0FJ4ACXX120306:2:1106:14202:137461	83	6	140453110	60	76M	6	140453079	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [31, 33, 37, 38, 39, 33, 41, 42, 41, 32, 41, 34, 41, 41, 33, 35, 33, 40, 37, 39, 32, 35, 36, 34, 41, 31, 41, 34, 39, 31, 35, 39, 40, 31, 37, 39, 31, 41, 41, 34, 34, 33, 32, 33, 41, 31, 41, 41, 31, 32, 36, 36, 36, 35, 30, 31, 40, 33, 38, 33, 40, 35, 37, 37, 34, 40, 35, 33, 40, 32, 33, 37, 32, 35, 35, 32])	[('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHJIIJJIGIJJIIJIJIJJJJIIHJIJJIIGJJIIJJIJIHGC<JJJJIJJJJIJJJIJIJHGHHHFFFFF@@C'), ('UQ', 0)]
C0FJ4ACXX120306:3:1304:10517:85470	1171	6	140453110	60	76M	6	140452978	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [33, 33, 38, 39, 38, 33, 41, 41, 41, 32, 40, 33, 40, 41, 30, 34, 33, 41, 36, 40, 33, 35, 35, 33, 40, 32, 41, 34, 39, 31, 36, 37, 38, 31, 35, 40, 30, 40, 41, 33, 34, 33, 32, 31, 37, 30, 37, 40, 30, 32, 35, 35, 35, 35, 30, 31, 40, 31, 38, 33, 40, 35, 36, 37, 32, 39, 34, 31, 39, 29, 31, 36, 29, 34, 37, 23])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHCIJJIHIIHHBIIIIIIGHHGGJJJIHGGGHGFIJIJIHFEAGIGJIJIIHHHEJJJIGHGHHFFFFFD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:5:1304:6335:190059	83	6	140453110	60	76M	6	140452929	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [31, 33, 39, 39, 41, 32, 41, 40, 41, 32, 41, 34, 40, 42, 32, 33, 32, 39, 36, 40, 33, 36, 36, 34, 41, 32, 42, 34, 39, 31, 37, 39, 41, 31, 36, 40, 32, 40, 42, 34, 34, 33, 31, 33, 41, 32, 40, 41, 31, 32, 36, 35, 35, 36, 31, 31, 42, 33, 39, 33, 40, 35, 38, 38, 35, 40, 35, 32, 40, 31, 33, 37, 32, 35, 36, 32])	[('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHJJJJJHGIIIJJJJIJJJJJIIIJIJJJJJIIJIJJJJIHGFCJJIJJJJJJJJJJJJJJHGHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1303:8173:106713	147	6	140453110	60	76M	6	140452978	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [32, 33, 40, 40, 40, 33, 41, 40, 40, 32, 41, 34, 39, 42, 32, 34, 33, 41, 37, 40, 32, 36, 36, 35, 40, 32, 41, 32, 39, 31, 35, 39, 42, 30, 36, 40, 31, 39, 40, 33, 33, 32, 31, 33, 40, 30, 40, 40, 29, 32, 36, 35, 36, 35, 30, 31, 40, 32, 39, 32, 39, 34, 37, 37, 32, 39, 34, 31, 38, 29, 30, 35, 29, 35, 36, 23])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHJIHHGF=IHIJJJJJJJJJJJHIJGJJIJJJJHGIIJIGGIHDJJIJJJJJJIJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:2103:19332:163957	1107	6	140453110	60	76M	6	140453079	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [31, 33, 39, 40, 41, 32, 41, 41, 40, 33, 41, 33, 41, 41, 33, 34, 34, 40, 36, 40, 32, 36, 36, 34, 41, 31, 41, 34, 38, 31, 34, 40, 41, 31, 36, 40, 32, 40, 41, 33, 34, 34, 31, 33, 41, 30, 40, 40, 30, 32, 35, 35, 36, 35, 30, 31, 39, 33, 38, 32, 39, 35, 38, 38, 33, 40, 35, 33, 39, 32, 33, 37, 31, 34, 36, 31])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CEHIIHIIHFHGJJIIGIJJJJIJHHIIGIEIJJJJJJIIJIGHHFJIGIIJJJHHEGHEIJJHHHGHFFFFF@@@'), ('UQ', 0)]
D0N3RACXX120302:2:2302:4867:46185	147	6	140453110	60	76M	6	140453071	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [32, 33, 38, 38, 40, 32, 41, 41, 41, 32, 39, 34, 39, 41, 33, 33, 32, 40, 36, 40, 32, 35, 35, 33, 41, 30, 40, 33, 39, 31, 37, 40, 41, 30, 36, 40, 32, 40, 41, 32, 34, 33, 31, 33, 38, 32, 39, 41, 30, 32, 35, 35, 35, 35, 30, 31, 40, 33, 38, 33, 39, 35, 37, 37, 32, 38, 33, 31, 38, 29, 31, 36, 29, 35, 37, 23])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHJJIJJHFIHJJJIJIJJJJJJIIIGJJJJJJJJHJJIJIIGGCIJIJJJJJJIJJJIJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:6:2101:21126:43869	83	6	140453110	60	76M	6	140453022	76	ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA	array('B', [32, 33, 36, 29, 40, 31, 39, 39, 40, 32, 39, 34, 40, 39, 31, 32, 27, 39, 36, 38, 30, 33, 36, 33, 39, 30, 37, 32, 36, 14, 36, 37, 38, 32, 35, 36, 29, 25, 35, 31, 33, 33, 29, 10, 23, 17, 21, 11, 26, 29, 33, 37, 36, 31, 33, 30, 39, 29, 26, 29, 16, 13, 14, 34, 32, 38, 22, 32, 39, 30, 32, 34, 30, 32, 31, 18])	[('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=DA9IDDDCCCCIEB<;EIEADIIEDDDB4CEDCD?8:?BEE?*2+9+<CDCC?CFFA2<+++ABD4BDDD?D??8'), ('UQ', 0)]
C0FJ4ACXX120306:4:1305:13055:48022	147	6	140453112	60	76M	6	140452983	76	GGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAA	array('B', [38, 35, 35, 17, 38, 20, 36, 31, 39, 30, 23, 33, 29, 33, 30, 37, 35, 39, 32, 37, 33, 33, 38, 31, 35, 30, 35, 26, 36, 39, 26, 31, 29, 31, 18, 30, 38, 32, 32, 32, 26, 10, 37, 18, 36, 28, 30, 29, 24, 35, 31, 34, 23, 27, 37, 28, 35, 25, 40, 35, 36, 28, 31, 37, 34, 31, 36, 29, 25, 35, 27, 33, 26, 23, 30, 22])	[('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C?=/C5B8C87==<GFCEFB>ADB@>B<HF9H::1>DFCC:*C2E<EA9F>E:?DAF?HGB;GDFDDD?D?A:8<;'), ('UQ', 0)]
C0FJ4ACXX120306:4:2102:13953:161699	83	6	140453113	60	76M	6	140452979	76	GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGNAGAAAT	array('B', [37, 39, 31, 41, 40, 41, 33, 41, 34, 40, 40, 32, 33, 34, 41, 36, 41, 33, 36, 36, 35, 41, 32, 41, 34, 39, 31, 36, 40, 41, 31, 36, 40, 32, 40, 41, 34, 34, 34, 31, 33, 40, 32, 40, 41, 31, 31, 36, 35, 36, 35, 30, 32, 40, 33, 39, 33, 40, 35, 38, 39, 33, 41, 35, 33, 40, 30, 33, 32, 2, 35, 37, 31, 33, 30, 32])	[('MD', '69A6'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'EHHHJIHIIJJJGJJJJJJJJJIJJJJJJJJJJJJJJJJHHGCJJJIJJJJJJJJJJJJJJJJHHHFC2#FFFCCC'), ('UQ', 2)]
D0MUKACXX120302:3:1204:14877:161615	83	6	140453113	60	76M	6	140453019	76	GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT	array('B', [37, 39, 33, 41, 38, 41, 33, 42, 34, 40, 41, 33, 34, 32, 40, 37, 39, 33, 37, 36, 33, 40, 32, 42, 34, 37, 31, 36, 37, 41, 31, 36, 40, 33, 41, 41, 34, 34, 34, 31, 33, 39, 31, 40, 41, 31, 32, 35, 36, 36, 36, 30, 33, 41, 33, 37, 33, 39, 36, 38, 37, 33, 41, 36, 33, 39, 32, 32, 37, 31, 35, 37, 31, 32, 30, 32])	[('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHIDHFHEFIJIJIJJJJIIIHJIJJJIJJJJJJJJJJIIGHJJIJJJJJGJJJJIJJJJJJHHHGHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:3:2304:11491:27029	83	6	140453113	60	76M	6	140452933	76	GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT	array('B', [36, 35, 27, 28, 40, 41, 32, 42, 34, 39, 39, 31, 35, 32, 40, 37, 39, 31, 30, 35, 33, 40, 32, 31, 35, 34, 30, 36, 37, 40, 30, 36, 38, 31, 37, 38, 33, 33, 33, 29, 34, 37, 30, 40, 40, 31, 32, 35, 35, 35, 36, 30, 31, 38, 35, 28, 31, 38, 34, 36, 35, 33, 40, 36, 34, 34, 30, 31, 37, 31, 34, 37, 31, 31, 30, 30])	[('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=A5<IHGIIGGECIIEHD>HBGF>@CDGGIEHGHGEGGGECE?IHHGGGGIHHEEABIHGGEIHFAFAFFDFF@C@'), ('UQ', 0)]
D0MUKACXX120302:4:2307:21149:101091	1107	6	140453113	60	76M	6	140452933	76	GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT	array('B', [20, 23, 31, 41, 39, 38, 24, 36, 33, 40, 40, 32, 33, 30, 38, 36, 39, 31, 35, 36, 31, 40, 32, 41, 33, 33, 27, 35, 38, 37, 30, 36, 38, 31, 35, 40, 31, 29, 30, 31, 34, 40, 29, 38, 39, 31, 31, 36, 35, 35, 36, 30, 33, 40, 32, 34, 32, 39, 35, 36, 38, 32, 39, 33, 33, 39, 31, 32, 38, 31, 35, 36, 30, 32, 30, 24])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '63HHD@3AGIGHHEGHHFBD<GGHFA>HEBHGGFBGBF@C@HEGGIGHGGIGGIHAEIHBHEHDHGHHFFFDD@@<'), ('UQ', 0)]
D0MUKACXX120302:8:1307:1546:28511	1107	6	140453113	60	76M	6	140452933	76	GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT	array('B', [34, 32, 32, 39, 39, 41, 32, 41, 35, 30, 40, 32, 34, 33, 33, 36, 40, 31, 35, 35, 34, 40, 31, 39, 35, 29, 22, 37, 40, 40, 28, 35, 40, 31, 18, 41, 33, 33, 29, 29, 13, 40, 31, 29, 40, 31, 33, 34, 35, 37, 35, 31, 31, 39, 31, 36, 32, 34, 35, 38, 32, 33, 39, 36, 32, 38, 29, 30, 36, 31, 35, 36, 30, 30, 29, 31])	[('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?>AEGFDHF>EGHF>GHF@DBGFFB94IIG>CHF6GGGFC*C:<IIIGHCHIHHFF?AHFACHBFDD<DFFDD@@?'), ('UQ', 0)]
C0FJ4ACXX120306:1:2108:12052:21457	1187	6	140453116	60	76M	6	140453155	76	CCCACTCCAGCGAGATTGCACTGTAGCTAGACGAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA	array('B', [23, 33, 34, 32, 34, 23, 34, 35, 31, 19, 7, 11, 7, 31, 31, 28, 31, 9, 31, 29, 37, 35, 40, 29, 30, 40, 39, 36, 30, 40, 34, 39, 3, 30, 35, 34, 36, 32, 39, 33, 39, 37, 34, 30, 31, 33, 33, 34, 33, 31, 37, 36, 41, 30, 40, 34, 19, 33, 27, 37, 37, 34, 40, 32, 31, 40, 33, 36, 38, 30, 36, 35, 31, 31, 32, 31])	[('MD', '9T7T14C43'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 3), ('SM', 37), ('MQ', 60), ('OQ', '@<BFD3ADH3+0)>@FH+ACHIJEHIIJJIJJ):@GHHHJJIEGIGJIIIFHIAFG4@@EHIIGEHACE7@DEFFF'), ('UQ', 31)]
D0N3RACXX120302:3:2307:15322:119022	99	6	140453116	60	76M	6	140453164	76	CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA	array('B', [31, 36, 38, 33, 36, 35, 37, 38, 32, 32, 39, 29, 33, 38, 32, 32, 34, 33, 39, 33, 38, 37, 40, 31, 29, 37, 40, 36, 31, 38, 33, 39, 38, 33, 36, 36, 36, 32, 41, 34, 40, 39, 36, 30, 32, 34, 34, 34, 33, 31, 39, 37, 41, 32, 40, 34, 41, 38, 32, 39, 36, 33, 39, 34, 32, 40, 34, 37, 36, 34, 36, 35, 33, 30, 34, 30])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIIJIJJJJJJIHIJJJIIJIJJJIIJJJJJJJJJJJJJJJIJGJIHHIJIEIIIGGJJJIJGA'), ('UQ', 0)]
D0N3RACXX120302:7:1108:18863:147062	163	6	140453116	60	76M	6	140453155	76	CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA	array('B', [23, 35, 36, 31, 35, 33, 36, 35, 31, 30, 38, 31, 32, 39, 32, 31, 32, 33, 39, 31, 38, 35, 40, 33, 31, 38, 38, 33, 30, 40, 33, 39, 39, 33, 36, 35, 32, 31, 39, 31, 38, 38, 36, 30, 30, 32, 34, 34, 34, 30, 36, 36, 40, 33, 41, 33, 40, 41, 32, 39, 36, 33, 40, 33, 31, 41, 33, 35, 41, 33, 35, 35, 32, 31, 32, 29])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFFDHHHHHJIGGIIDHIICF@HEIIIJJIJIBGGAHGIFEHIGIHDHGHHIHHIIIIJGIIGEHIIEGIID'), ('UQ', 0)]
C0FJ4ACXX120306:7:2205:1115:80726	1113	6	140453116	37	76M	6	140453116	76	CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA	array('B', [34, 33, 41, 31, 39, 33, 40, 34, 31, 32, 31, 38, 35, 39, 32, 36, 34, 34, 40, 33, 41, 33, 38, 31, 36, 39, 41, 31, 35, 38, 30, 39, 40, 32, 33, 31, 32, 35, 41, 30, 38, 41, 30, 32, 35, 35, 30, 32, 30, 30, 40, 33, 37, 32, 36, 35, 30, 36, 31, 40, 34, 33, 40, 30, 32, 36, 32, 35, 37, 30, 30, 30, 29, 30, 28, 31])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 0), ('NM', 0), ('SM', 37), ('OQ', '@AC=@HF>F=EFCCGFDCGIIGCGHDIGHFDGGHGFGCC9GGHGHF<<EHHIGHFC9F>GHFFFFFHHDDDDD@<@'), ('UQ', 0)]
C0FJ4ACXX120306:8:1302:7027:47625	147	6	140453116	60	76M	6	140453039	76	CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA	array('B', [42, 39, 42, 32, 40, 34, 40, 42, 33, 35, 32, 40, 36, 40, 33, 36, 36, 34, 41, 32, 42, 34, 39, 31, 36, 39, 41, 31, 36, 39, 31, 40, 40, 34, 34, 33, 31, 33, 40, 32, 40, 41, 31, 32, 35, 35, 35, 35, 31, 32, 41, 33, 39, 33, 39, 36, 38, 38, 33, 40, 35, 32, 39, 31, 31, 37, 30, 33, 35, 29, 29, 30, 29, 29, 30, 23])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIHEJJJJJJJJJJIIJJJIJJJJIJJJJIHJIJJJIHGCJJJJIJJIJJJJJJJJJJJJJIJHGHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1208:15795:144587	83	6	140453116	60	20S56M	6	140452951	56	ATCTGTTCAAACTGATGGGACCCTCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 32, 30, 13, 36, 32, 19, 33, 29, 25, 21, 37, 29, 30, 11, 35, 33, 30, 33, 18, 29, 33, 37, 31, 35, 38, 39, 18, 34, 37, 31, 30, 15, 30, 31, 32, 29, 33, 39, 30, 39, 40, 30, 31, 35, 35, 35, 35, 29, 30, 40, 33, 36, 33, 36, 31])	[('MD', '3A52'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#####################?7*?D6::33D9:*CD::19GEECBF4BFF?,HCHAICAGIIFHHFFDDFFF@@@'), ('UQ', 13)]
C0FJ4ACXX120306:8:2206:8037:177929	99	6	140453117	60	76M	6	140453180	76	CCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGGCTTCATGAAGAAATATAT	array('B', [30, 32, 15, 35, 35, 30, 29, 32, 29, 36, 26, 33, 39, 32, 30, 32, 32, 37, 31, 37, 35, 38, 31, 29, 39, 37, 33, 25, 13, 11, 30, 37, 33, 35, 35, 34, 23, 31, 33, 37, 37, 30, 32, 27, 31, 33, 32, 32, 29, 30, 35, 38, 31, 38, 34, 37, 34, 5, 31, 35, 33, 26, 16, 28, 31, 35, 33, 38, 31, 36, 36, 29, 28, 29, 31, 31])	[('MD', '57T18'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?<+B?:=BAD:DDIEBEE?DEEBBEEF9++<C;EED39BDD<@9DCDDA9BBE@BA?(7BC3)77@A@CEI:;>C='), ('UQ', 5)]
D0N3RACXX120302:7:1208:14483:71038	163	6	140453118	60	76M	6	140453167	76	CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAAGTCTTCATGAAGAAATATATC	array('B', [23, 33, 36, 34, 36, 13, 29, 25, 35, 31, 30, 37, 32, 31, 32, 32, 39, 33, 38, 35, 36, 31, 26, 30, 31, 35, 27, 39, 34, 38, 38, 33, 35, 36, 36, 32, 36, 32, 38, 38, 35, 31, 32, 33, 35, 34, 34, 28, 37, 34, 39, 32, 42, 34, 33, 38, 22, 31, 34, 34, 39, 33, 32, 38, 33, 36, 41, 33, 37, 37, 32, 30, 31, 31, 32, 38])	[('MD', '54G21'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?@@FF+A;CFDBFHJJJCIIBH<<<E@FHIIJHJJJ@GIIGJIIJJJ?GBDHHIDG49DGEHHEEGHGFGGIIIIG'), ('UQ', 33)]
C0FJ4ACXX120306:1:1206:11701:42451	83	6	140453118	60	76M	6	140453081	76	CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATC	array('B', [35, 31, 41, 33, 41, 41, 32, 33, 32, 40, 36, 40, 32, 36, 35, 34, 41, 31, 41, 34, 39, 32, 37, 40, 40, 31, 36, 40, 32, 40, 40, 34, 34, 33, 31, 34, 40, 32, 40, 40, 31, 32, 36, 35, 36, 35, 31, 32, 41, 34, 38, 34, 40, 36, 37, 38, 33, 40, 35, 33, 40, 32, 33, 39, 32, 35, 39, 32, 32, 31, 31, 31, 31, 30, 33, 31])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=EGIIGIGIJJIJJJJJIIIJJJJIJJIIJIIIIHCE@IIIJJJJIJJJJIJJIIJJIJJIJJGHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:4:1304:18933:23139	163	6	140453119	60	76M	6	140453163	76	ACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCT	array('B', [23, 35, 35, 36, 35, 30, 30, 36, 29, 32, 37, 32, 31, 28, 30, 39, 32, 36, 34, 35, 30, 28, 34, 37, 36, 30, 36, 32, 38, 38, 33, 35, 36, 35, 31, 36, 33, 35, 36, 37, 29, 32, 33, 33, 33, 33, 28, 38, 35, 39, 32, 36, 33, 34, 34, 33, 38, 34, 33, 37, 33, 33, 40, 34, 35, 39, 32, 36, 35, 31, 30, 33, 31, 32, 40, 34])	[('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFDDFFHHHDHDHIIGEGGDGGJJGIIJJJJGHBHFEHAGGIJGDGGIHDGCGBFFHGGHJGIIAFHIIJJJIG'), ('UQ', 0)]
D0MUKACXX120302:6:2106:9910:116898	1683	6	140453119	60	13S63M	6	140452978	63	ACTGATGGGACCCGCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATGTTTACTGTGAGGTCTTCATG	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 38, 33, 38, 34, 10, 23, 7, 34, 25, 23, 30, 29, 35, 33, 38, 32, 28, 34, 27, 30, 29, 35, 12, 32, 32, 27, 33, 13, 22, 31, 31, 30, 10, 23, 34, 17, 14, 10, 17, 20, 26, 9, 35, 27, 26, 27, 25, 25, 34, 30, 21, 12, 32, 17, 11, 28, 29, 29, 36, 30, 28, 12])	[('MD', '0A41T20'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '##############CGF?*0(?04?<EIG?9CDC9?*B?9C14BFA+2A23+33<+F<?<::CA2+A2+=;;DB;+'), ('UQ', 11)]
D0MUKACXX120302:7:2107:9365:181919	147	6	140453119	60	76M	6	140453063	76	ACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCT	array('B', [29, 38, 33, 33, 38, 32, 34, 32, 38, 35, 31, 31, 34, 35, 34, 40, 32, 38, 33, 40, 31, 36, 38, 40, 30, 36, 40, 32, 41, 37, 33, 33, 34, 31, 32, 38, 30, 38, 39, 30, 31, 31, 28, 33, 34, 25, 32, 41, 32, 37, 31, 39, 31, 26, 33, 32, 37, 31, 32, 39, 30, 32, 39, 29, 34, 36, 29, 29, 30, 29, 29, 28, 29, 27, 35, 23])	[('MD', '76'), ('PG', 'bwa.7'), ('RG', 'D0MUK.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=GG@@HFDCF:BEIGDB?EGEHGFDGJJHBIIGDDD?CFGF><?F>CHDEAHA:@AE>GIGJHDHFBFBBDDB;?@'), ('UQ', 0)]
C0FJ4ACXX120306:7:1108:1990:199223	99	6	140453122	60	76M	6	140453147	76	CCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAG	array('B', [29, 31, 34, 28, 36, 31, 32, 40, 33, 30, 30, 32, 36, 32, 38, 36, 40, 30, 30, 39, 38, 35, 31, 40, 34, 37, 38, 33, 35, 36, 35, 31, 37, 32, 38, 36, 34, 32, 31, 34, 32, 33, 34, 30, 38, 36, 41, 32, 40, 33, 40, 38, 33, 38, 34, 31, 38, 33, 31, 40, 34, 35, 40, 33, 36, 37, 33, 32, 32, 30, 32, 38, 36, 41, 32, 35])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';=@?DDDFFDFHFEIIGFIFF@FFEGIGIICEBAEBBCFICIIFIII?DFHD??DDFGGCHBDHCFHHGGHF@C;='), ('UQ', 0)]
D0MUKACXX120302:6:1107:19198:26461	83	6	140453122	60	76M	6	140453036	76	CCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAG	array('B', [33, 42, 32, 33, 32, 40, 38, 41, 33, 36, 35, 34, 41, 32, 41, 34, 38, 31, 36, 40, 42, 31, 37, 40, 32, 40, 41, 33, 33, 34, 32, 34, 41, 31, 40, 42, 31, 32, 36, 36, 36, 36, 31, 31, 41, 33, 38, 33, 40, 36, 38, 38, 33, 40, 36, 33, 41, 32, 33, 40, 33, 36, 40, 32, 32, 32, 31, 31, 31, 32, 33, 39, 33, 37, 34, 32])	[('MD', '76'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GIIHDIJJIGIGIIIIIJIJIJJJIIJJJJJJIHJJJJIJJJIIJIJJJJJJJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:1206:14087:187089	1619	6	140453122	60	31S45M	6	140452942	45	CAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTAC	array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 35, 25, 29, 28, 16, 21, 29, 23, 28, 10, 29, 14, 31, 36, 32, 24, 22, 27, 25, 28, 8, 16, 34, 32, 9, 35, 28, 13, 24, 29, 28, 29, 18, 35, 38, 33, 25, 28, 28, 20, 32, 23, 30, 23])	[('MD', '45'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '################################?7>?*471:*:*BB@77=7<+,AA0@>,2=<<+BC@=<<1A=:='), ('UQ', 0)]
C0FJ4ACXX120306:7:2106:15175:63094	99	6	140453123	60	76M	6	140453186	76	CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG	array('B', [32, 33, 30, 37, 32, 33, 40, 32, 31, 32, 32, 38, 33, 38, 36, 41, 30, 29, 39, 38, 36, 30, 39, 33, 38, 37, 34, 35, 35, 36, 31, 38, 33, 37, 38, 35, 33, 31, 33, 34, 33, 33, 30, 37, 36, 40, 30, 40, 34, 39, 39, 32, 40, 37, 34, 40, 34, 32, 41, 34, 36, 41, 33, 35, 35, 32, 32, 32, 31, 33, 38, 36, 40, 32, 41, 37])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFFFDHHHGHIIIEGHGGIGEHIJIJIGEHGGECEHJIIGGIGDFEFGHJJJIGHIIGHAHEHIIJIGHGEHD'), ('UQ', 0)]
C0FJ4ACXX120306:3:2205:17332:54473	83	6	140453123	60	76M	6	140453066	76	CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG	array('B', [39, 28, 34, 30, 34, 37, 39, 33, 36, 35, 33, 42, 31, 40, 33, 39, 32, 36, 39, 41, 32, 36, 37, 31, 35, 40, 34, 34, 32, 32, 33, 40, 31, 41, 40, 31, 33, 35, 36, 36, 35, 30, 32, 40, 34, 39, 33, 40, 36, 38, 37, 32, 40, 35, 33, 39, 32, 33, 39, 32, 35, 39, 33, 32, 33, 31, 32, 30, 30, 32, 40, 32, 38, 35, 37, 31])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@;H@:IHGIGIGEIGIIIIIGGFDEGIIHGHGCIIIGGGGGIIIIIIIHIHDHGIHIIGIIIIHGHHHDAFFFCC@'), ('UQ', 0)]
D0N3RACXX120302:1:1107:6701:81808	595	6	140453123	29	76M	6	140452995	76	CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG	array('B', [33, 28, 34, 26, 13, 17, 36, 26, 25, 29, 33, 39, 31, 37, 32, 35, 30, 34, 38, 27, 25, 34, 37, 33, 40, 38, 31, 34, 31, 30, 32, 33, 22, 5, 34, 9, 30, 20, 34, 33, 35, 31, 21, 32, 11, 30, 11, 29, 31, 13, 30, 31, 24, 34, 13, 34, 24, 31, 25, 32, 32, 32, 32, 30, 15, 26, 27, 29, 30, 32, 24, 26, 33, 29, 31, 24])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 29), ('NM', 0), ('SM', 29), ('MQ', 29), ('OQ', '==@=))@44:DC=EDAEDB99DD;IDBBDBD?1*?*:3EDEC2A+<+:<+;<<A,A3A4EB>EC,A:BD?:?B;<?'), ('UQ', 0)]
D0N3RACXX120302:1:2107:11120:27129	163	6	140453124	60	76M	6	140453185	76	ATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGT	array('B', [23, 29, 37, 30, 32, 37, 31, 30, 30, 30, 37, 33, 37, 34, 39, 30, 30, 40, 39, 35, 30, 40, 33, 38, 38, 33, 35, 35, 36, 32, 40, 33, 38, 39, 35, 31, 33, 34, 34, 34, 33, 31, 38, 36, 41, 32, 40, 34, 41, 40, 35, 40, 37, 33, 40, 33, 32, 41, 34, 36, 41, 33, 36, 37, 33, 31, 33, 32, 33, 40, 36, 41, 33, 41, 39, 32])	[('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHGHJJIJJJJJJJJIJJJJJJJJJJJJJJJJJJJJIIJJJJIHIJJJJJJJJJJJJJJJJJJJJJC'), ('UQ', 0)]
D0MUKACXX120302:5:1303:4376:135167	83	6	140453124	60	76M	6	140452916	76	ATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGT	array('B', [30, 36, 33, 40, 36, 39, 34, 35, 36, 35, 39, 32, 41, 33, 38, 30, 36, 39, 41, 31, 34, 35, 30, 36, 40, 32, 33, 34, 33, 33, 40, 33, 38, 38, 30, 32, 35, 36, 36, 36, 30, 32, 41, 34, 38, 34, 40, 36, 38, 38, 33, 41, 36, 33, 40, 32, 33, 40, 33, 36, 40, 33, 33, 32, 31, 31, 30, 31, 32, 39, 33, 37, 35, 38, 35, 32])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DGJJJIGGJIGHIJJIJIJIFB;BIGJIIHF?HHCJJIIIIJJJJJIIIJGJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:5:2107:2516:43946	1107	6	140453124	60	6S70M	6	140453081	70	CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCGCCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATC	array('B', [2, 2, 2, 2, 2, 2, 2, 34, 30, 31, 37, 36, 30, 35, 22, 34, 39, 31, 38, 35, 34, 32, 35, 39, 40, 31, 35, 32, 33, 29, 31, 31, 31, 32, 26, 9, 23, 10, 23, 38, 29, 28, 33, 34, 33, 33, 30, 30, 41, 33, 37, 34, 39, 35, 36, 38, 33, 40, 35, 32, 39, 31, 32, 36, 32, 34, 29, 30, 30, 30, 29, 30, 28, 30, 33, 30])	[('MD', '31A38'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#######C@;G@@@4BCBCC@CHGFBD>G:<???0):*9ED>DHBHEAIIGIIHEHBGIHCGGFHF<>ADDDD@@@'), ('UQ', 10)]
C0FJ4ACXX120306:7:2106:7109:75175	147	6	140453125	60	76M	6	140453056	76	TCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTG	array('B', [22, 30, 38, 35, 36, 23, 33, 33, 13, 31, 32, 31, 30, 37, 29, 32, 37, 38, 31, 34, 37, 30, 39, 41, 31, 31, 31, 31, 30, 23, 13, 23, 36, 32, 30, 35, 35, 35, 31, 33, 31, 39, 33, 38, 35, 32, 31, 38, 29, 23, 37, 35, 33, 23, 31, 23, 38, 26, 30, 38, 31, 31, 30, 23, 30, 29, 30, 31, 38, 31, 35, 33, 35, 34, 31, 23])	[('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '3>EC=7=>)<F<ACB?BCHFB8FFAFDH90*9EHEIGFAC?FECC@<C<4EHC:I:HA>GHFG<FBHHFFFDD???'), ('UQ', 0)]
C0FH2ACXX120312:7:1206:13203:124056	163	6	140453126	60	76M	6	140453201	76	CGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGT	array('B', [23, 28, 33, 34, 32, 26, 25, 29, 35, 30, 34, 34, 36, 25, 26, 35, 33, 32, 30, 33, 29, 35, 36, 34, 35, 35, 34, 31, 38, 31, 34, 38, 32, 28, 32, 29, 33, 34, 34, 22, 34, 34, 33, 17, 23, 32, 39, 33, 20, 36, 35, 28, 36, 33, 33, 39, 29, 29, 37, 34, 34, 35, 30, 31, 30, 31, 31, 37, 35, 39, 35, 38, 37, 27, 31, 30])	[('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@DFAADFDFHDA@CBEJCDEEHIGEGGDEHBDHBHII;BC?1:?FC3??<BFEC<8D@DG@FCCGFFGHDG7=='), ('UQ', 0)]
D0MUKACXX120302:5:2108:16989:35544	83	6	140453126	60	76M	6	140453092	76	CGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGT	array('B', [31, 39, 35, 40, 32, 35, 37, 34, 39, 33, 42, 34, 39, 31, 36, 39, 39, 31, 35, 38, 31, 40, 40, 33, 33, 34, 32, 34, 39, 31, 37, 39, 29, 32, 35, 34, 32, 36, 30, 32, 38, 31, 38, 33, 39, 36, 37, 37, 33, 38, 36, 34, 36, 31, 33, 39, 33, 36, 39, 30, 30, 30, 28, 32, 31, 31, 33, 40, 32, 37, 34, 36, 35, 34, 34, 31])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DIIHGIGGGHIIIHHDGFBDBIHGIIGEGBGGDIHGBIGIEDGHGGEGIGIHBBIIIIIHDGBHFHHHFFDDD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:4:2105:14262:47111	1635	6	140453127	60	76M	6	140453155	76	GAGATTNCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTA	array('B', [30, 31, 33, 32, 30, 31, 2, 32, 33, 33, 25, 33, 24, 29, 36, 36, 29, 29, 32, 34, 38, 38, 33, 34, 35, 32, 31, 24, 33, 36, 38, 35, 30, 31, 29, 31, 33, 32, 26, 37, 34, 38, 32, 27, 33, 36, 38, 31, 34, 36, 28, 37, 24, 29, 30, 30, 34, 39, 34, 36, 35, 32, 31, 31, 30, 32, 38, 34, 38, 33, 41, 37, 32, 37, 32, 31])	[('MD', '6T69'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '???D??#2=<1A2AEB:CEFIDCEF>F3CBEAEB:DCD;DBD?BDEDB??<D?998?DDCDEICEDCDEIIC@CIC'), ('UQ', 2)]
D0N3RACXX120302:5:2307:8953:61063	99	6	140453127	60	76M	6	140453154	76	GAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTA	array('B', [31, 33, 39, 33, 31, 31, 31, 37, 33, 38, 35, 40, 32, 31, 41, 39, 36, 31, 41, 33, 39, 39, 33, 35, 36, 36, 32, 40, 34, 39, 38, 36, 31, 32, 34, 34, 34, 34, 31, 38, 36, 41, 32, 41, 34, 42, 41, 31, 40, 36, 33, 40, 34, 32, 41, 34, 36, 41, 34, 36, 36, 33, 31, 33, 31, 33, 40, 37, 41, 35, 42, 41, 31, 40, 31, 33])	[('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJIJJJIJJJJJJJJIJJIIJJJHIJJJJJJJJJIIJJJJJJJIJIJJEGEC'), ('UQ', 0)]
C0FJ4ACXX120306:1:1202:13169:44559	99	6	140453128	60	76M	6	140453163	76	AGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAG	array('B', [31, 36, 34, 32, 31, 31, 37, 33, 37, 36, 40, 31, 31, 41, 39, 36, 30, 41, 33, 38, 38, 33, 36, 36, 35, 32, 40, 34, 39, 38, 36, 30, 32, 34, 33, 34, 34, 31, 39, 36, 41, 31, 41, 34, 42, 40, 31, 37, 35, 33, 39, 33, 32, 41, 34, 36, 41, 33, 36, 36, 32, 30, 32, 32, 33, 39, 36, 41, 34, 39, 39, 32, 40, 31, 32, 35])	[('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJIJIIIJJIJJJJJIJGIDHJJJBFGGIIJIHIIFGIIJIIGGGGIGG=F@@='), ('UQ', 0)]
D0N3RACXX120302:8:2305:4402:136981	99	6	140453129	60	76M	6	140453160	76	GATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGT	array('B', [32, 30, 31, 31, 31, 37, 33, 36, 35, 40, 31, 30, 41, 38, 36, 29, 39, 32, 38, 38, 33, 35, 35, 36, 32, 40, 34, 39, 38, 36, 30, 32, 34, 34, 34, 33, 31, 39, 36, 41, 32, 40, 32, 40, 40, 31, 38, 36, 34, 40, 34, 33, 41, 34, 36, 41, 33, 36, 36, 32, 31, 32, 30, 33, 41, 37, 41, 34, 40, 39, 31, 39, 31, 30, 41, 32])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'BBCFFFFFHHFFHIGHGHGIJJJJJJIJJJIIJJJIJJIIIGGIJGGIJJIJIJJJGIJJJJJJJJIGIIFGFHIG'), ('UQ', 0)]
D0MUKACXX120302:5:1208:18766:114279	99	6	140453130	60	76M	6	140453260	76	ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA	array('B', [31, 30, 32, 31, 37, 33, 36, 34, 40, 31, 29, 37, 38, 34, 29, 40, 33, 38, 38, 33, 36, 35, 36, 32, 39, 33, 38, 38, 36, 31, 32, 33, 34, 34, 33, 29, 38, 35, 39, 29, 39, 33, 38, 40, 30, 39, 36, 34, 40, 32, 31, 40, 33, 35, 39, 34, 36, 36, 32, 30, 33, 31, 32, 40, 37, 41, 34, 39, 40, 34, 41, 32, 30, 39, 34, 31])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFFHHFDFHGIIJJJJJJGGIJJJIIJJJIEGHGBCHHIFHEIIEHGGGGIIJJIJIJJJIGFHCF@DGG@'), ('UQ', 0)]
D0N3RACXX120302:3:2201:21289:121967	99	6	140453130	60	76M	6	140453197	76	ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA	array('B', [16, 29, 30, 30, 19, 11, 34, 32, 18, 24, 2, 7, 31, 35, 25, 19, 16, 15, 9, 31, 32, 32, 25, 27, 36, 22, 27, 14, 29, 22, 28, 32, 30, 30, 28, 22, 33, 38, 10, 25, 10, 21, 33, 26, 21, 31, 35, 29, 35, 32, 28, 20, 32, 20, 20, 32, 33, 34, 23, 19, 32, 29, 23, 19, 17, 17, 29, 34, 5, 25, 30, 27, 23, 28, 33, 2])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ':??D:2BD<=,,ABE:22+AFE;BA:A3A9C@>E>;?C*1*:C>0?DDDEC<D49??D:8D?4///=B(8@8;AC#'), ('UQ', 0)]
D0N3RACXX120302:2:1307:14096:92571	1171	6	140453130	60	76M	6	140453052	76	ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA	array('B', [32, 34, 35, 32, 39, 32, 41, 35, 39, 31, 37, 40, 41, 30, 36, 39, 31, 39, 40, 29, 31, 32, 31, 32, 40, 32, 35, 41, 31, 32, 35, 35, 35, 36, 30, 32, 37, 32, 39, 32, 39, 35, 33, 36, 19, 37, 35, 33, 40, 32, 32, 37, 31, 35, 40, 32, 31, 30, 29, 31, 30, 31, 32, 39, 32, 37, 34, 36, 35, 30, 35, 27, 32, 35, 31, 23])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GGIGGEIJJJJJIGHEIHF<EHDDFHBIJJIIGIGFDIHGHGAB4GJGJHBGHCIGFEIJIJJHHHHDDDDDB@@@'), ('UQ', 0)]
D0N3RACXX120302:2:2207:10930:105773	147	6	140453130	60	76M	6	140453052	76	ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA	array('B', [34, 36, 35, 34, 39, 31, 41, 35, 37, 31, 37, 39, 36, 30, 37, 40, 33, 40, 41, 33, 30, 32, 33, 33, 40, 32, 41, 41, 31, 32, 36, 35, 35, 35, 31, 31, 40, 33, 39, 32, 39, 35, 37, 39, 32, 37, 35, 33, 39, 32, 33, 39, 32, 35, 40, 33, 33, 30, 28, 31, 30, 31, 32, 39, 31, 37, 34, 36, 35, 30, 35, 29, 33, 35, 31, 23])	[('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIJIG@FCGHFBEGJIGJHHFF??FEJJIJJHGJIGIJJIIIIHGEIIIJJJIIJJJGEIIJJHGGHHFDDFF@@B'), ('UQ', 0)]
C0FJ4ACXX120306:8:1203:3075:44765	163	6	140453131	60	76M	6	140453291	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [23, 31, 31, 36, 31, 35, 32, 38, 29, 29, 38, 37, 35, 29, 40, 33, 38, 37, 32, 35, 35, 35, 32, 39, 33, 39, 38, 36, 31, 32, 33, 33, 33, 33, 31, 39, 36, 41, 31, 39, 33, 41, 41, 31, 39, 35, 34, 40, 33, 32, 40, 33, 36, 41, 33, 36, 36, 32, 31, 32, 31, 32, 40, 36, 41, 34, 42, 41, 32, 40, 31, 31, 42, 32, 31, 36])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIJJJJIJJJJJJJJJJJJJJJJJIJGIJJJFHIJJJJIIJJIIJIJJIJJJJJJJCFGHJEHI'), ('UQ', 0)]
C0FJ4ACXX120306:8:2306:7294:129815	163	6	140453131	60	76M	6	140453196	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [23, 31, 31, 36, 31, 35, 33, 38, 29, 28, 38, 37, 35, 29, 40, 33, 36, 38, 33, 35, 35, 35, 31, 37, 33, 36, 38, 36, 31, 31, 33, 33, 33, 33, 31, 39, 35, 39, 31, 39, 33, 38, 39, 31, 36, 35, 31, 39, 33, 32, 39, 33, 36, 41, 33, 34, 34, 33, 31, 31, 31, 32, 40, 36, 41, 33, 40, 39, 28, 36, 31, 32, 39, 31, 31, 35])	[('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFDDFDHHHJIEGHJIIIGEEFHHJIIIJIJJGFIIDCHBDBFHIIEGGIIEGHIGIJJJGEGH7=8CGDDE'), ('UQ', 0)]
D0N3RACXX120302:3:2108:20826:32731	1123	6	140453131	60	76M	6	140453198	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [31, 32, 33, 37, 33, 37, 33, 36, 25, 26, 32, 27, 33, 30, 35, 30, 35, 36, 30, 34, 36, 34, 32, 34, 31, 38, 37, 36, 27, 33, 33, 34, 33, 33, 31, 35, 36, 38, 31, 32, 35, 30, 32, 30, 38, 36, 34, 39, 30, 32, 36, 33, 29, 35, 32, 35, 35, 30, 30, 30, 30, 32, 38, 36, 38, 34, 36, 37, 33, 36, 31, 23, 36, 32, 31, 30])	[('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFDF?DF?FGHBFGEHIHIEHIIICHIIGIIGIIH@GDEHHIGIBIGCBGBHHEIEDHGGHEFFCFA=FGH;'), ('UQ', 0)]
D0N3RACXX120302:4:1303:4608:65724	99	6	140453131	60	76M	6	140453198	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [32, 31, 33, 38, 33, 37, 35, 38, 32, 30, 35, 39, 36, 31, 40, 32, 38, 38, 33, 35, 35, 36, 32, 40, 33, 39, 38, 37, 31, 32, 33, 34, 34, 34, 31, 39, 36, 41, 32, 39, 33, 39, 40, 31, 40, 36, 33, 41, 33, 32, 40, 33, 36, 40, 33, 36, 36, 33, 31, 33, 31, 33, 41, 36, 40, 34, 41, 41, 32, 38, 32, 30, 38, 32, 31, 32])	[('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHGHHJJJIJJJJJJJIJJJJJJJJJJIIJIIIIJHIJJJJJJJIJIJJIJJJJJJJIJJCFFHIIID'), ('UQ', 0)]
D0MUKACXX120302:5:2207:16829:143643	659	6	140453131	60	76M	6	140453024	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [34, 35, 32, 40, 33, 32, 33, 38, 31, 36, 38, 41, 32, 36, 38, 32, 39, 38, 33, 33, 32, 32, 33, 38, 23, 37, 37, 30, 32, 35, 35, 35, 35, 31, 32, 39, 33, 37, 33, 36, 33, 37, 39, 34, 38, 34, 33, 40, 29, 33, 40, 32, 35, 33, 31, 33, 31, 29, 31, 29, 31, 31, 39, 32, 38, 33, 35, 36, 30, 34, 29, 33, 35, 31, 31, 23])	[('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DD>CC;DEGGGHIHGHHDIGHGFB4DBIHBHBJJIDGGHF@GIIGGIIDIJGH@GJHGIGGEIHHBDHDFFFD@@@'), ('UQ', 0)]
D0N3RACXX120302:7:1306:16646:114795	83	6	140453131	60	76M	6	140453094	76	TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA	array('B', [35, 35, 34, 41, 32, 42, 34, 41, 31, 36, 40, 40, 31, 37, 41, 33, 40, 41, 34, 33, 34, 32, 34, 40, 30, 40, 41, 31, 32, 36, 37, 36, 36, 31, 31, 41, 34, 39, 34, 39, 36, 39, 39, 34, 42, 36, 34, 41, 32, 34, 40, 34, 36, 40, 33, 33, 32, 31, 31, 30, 32, 33, 41, 33, 40, 35, 38, 38, 33, 37, 31, 35, 37, 32, 31, 31])	[('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HJJJHJJJJIJJIIJJJJJJIIHD?IJJJJJIIIHJJJJIJJJJJIJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:1304:13977:36981	1171	6	140453133	60	76M	6	140453030	76	TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT	array('B', [34, 39, 32, 41, 34, 39, 31, 37, 40, 41, 31, 36, 40, 32, 40, 41, 34, 34, 34, 31, 34, 40, 32, 40, 41, 30, 31, 35, 35, 35, 34, 32, 31, 40, 33, 38, 33, 40, 36, 37, 37, 33, 38, 36, 33, 41, 32, 32, 38, 33, 36, 37, 33, 32, 31, 29, 31, 30, 31, 32, 40, 32, 38, 35, 36, 36, 31, 36, 27, 33, 35, 28, 30, 34, 35, 23])	[('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GCCHIJJJJJIGGGIJJJJJIGIIIGHGGGGHEHGIIIIGGGGJIJIGGIHEJGGEJIJJIHIHGHHHDFFDF@CC'), ('UQ', 0)]
D0N3RACXX120302:5:1304:9653:65296	147	6	140453133	60	76M	6	140453030	76	TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT	array('B', [34, 39, 30, 43, 33, 39, 32, 37, 40, 41, 31, 37, 40, 33, 40, 41, 33, 34, 34, 33, 33, 39, 31, 40, 40, 29, 32, 36, 35, 35, 35, 31, 32, 41, 33, 39, 34, 40, 36, 38, 39, 34, 41, 36, 33, 41, 32, 33, 40, 34, 36, 39, 33, 33, 31, 30, 31, 30, 31, 32, 40, 32, 38, 34, 37, 37, 31, 36, 29, 33, 34, 28, 30, 34, 35, 23])	[('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIGJIJJIJJJJJJJJJJJJIGFJIIJJJJJJIJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:2205:15260:28841	83	6	140453133	60	76M	6	140452930	76	TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT	array('B', [34, 42, 31, 39, 32, 38, 32, 34, 36, 38, 31, 35, 39, 32, 38, 41, 31, 34, 32, 31, 32, 40, 32, 39, 41, 31, 32, 35, 35, 36, 35, 31, 30, 38, 33, 39, 32, 36, 35, 34, 38, 33, 40, 36, 33, 39, 33, 33, 40, 34, 36, 40, 34, 34, 32, 31, 31, 30, 31, 33, 38, 33, 39, 35, 37, 36, 32, 38, 31, 35, 36, 31, 31, 36, 34, 31])	[('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@IIGGGHC@EGDGHGIDIHGFF?HFDHHDDDD?GGHHFHAIGIIIGIIIJJJJIJIHHIGGIIHFDHHFFFFFC@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2301:8334:182439	147	6	140453134	60	76M	6	140453069	76	CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA	array('B', [39, 31, 40, 34, 40, 31, 36, 39, 38, 32, 35, 39, 32, 40, 41, 31, 32, 31, 29, 33, 33, 28, 39, 39, 30, 29, 33, 34, 35, 31, 30, 23, 34, 33, 37, 31, 37, 30, 34, 37, 32, 40, 32, 33, 40, 32, 34, 39, 31, 35, 37, 29, 24, 28, 30, 28, 30, 29, 33, 39, 32, 38, 34, 37, 36, 31, 34, 29, 33, 35, 29, 28, 33, 35, 30, 23])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GHGGIHGGEGGGFHHCGD?@?9HFF?@EGDB?DCGFGCEEGGDIIIJIGIGHDDGCHEHGGGGHGHFFFDFBD?<B'), ('UQ', 0)]
C0FJ4ACXX120306:3:2307:1703:125755	659	6	140453134	60	76M	6	140453109	76	CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA	array('B', [25, 31, 42, 34, 38, 32, 35, 39, 42, 30, 35, 39, 33, 40, 41, 31, 31, 32, 31, 33, 37, 33, 37, 40, 30, 31, 30, 33, 35, 35, 31, 32, 39, 32, 36, 31, 37, 35, 36, 40, 32, 42, 35, 31, 40, 32, 29, 36, 29, 35, 37, 32, 28, 26, 26, 27, 30, 25, 32, 37, 32, 38, 34, 37, 28, 31, 35, 28, 33, 35, 28, 28, 32, 35, 31, 23])	[('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '7HIGEIHGHEGEIHCFDGDBB?FHGBBBGJJIHEEFGGGHGHGEHHDEHIGIHC?BE?FEGGGC;DDBDDDDBB?@'), ('UQ', 0)]
C0FJ4ACXX120306:6:1108:9868:95295	147	6	140453134	60	76M	6	140453073	76	CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA	array('B', [2, 34, 39, 33, 36, 29, 33, 36, 36, 29, 33, 36, 29, 35, 36, 30, 31, 31, 29, 32, 34, 20, 36, 35, 29, 28, 32, 33, 31, 32, 28, 29, 35, 31, 34, 30, 35, 33, 34, 35, 31, 37, 33, 28, 36, 29, 13, 36, 31, 34, 35, 31, 33, 28, 28, 31, 31, 31, 34, 37, 32, 37, 34, 36, 36, 31, 35, 30, 33, 34, 29, 29, 32, 34, 30, 22])	[('MD', '76'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '#CGHEEAFCGGIHEGEIGEF?0DBCFFHAFCGIIIGHEEIIHC?CA+HGGGIJDACIIIHGJHDHGHHFFEDD@@<'), ('UQ', 0)]

The output from the above command is a tab-delimited human readable table of a slice of the BAM file. This table gives us information on reads that mapped to the region that we "extracted" from chromosome 7 between the coordinates of 140453130 and 140453135.

Now, let's suppose you would like to save those reads to your own Google cloud storage bucket...


In [0]:
samfile = pysam.AlignmentFile('gs://isb-ccle-open/gdc/0a109993-2d5b-4251-bcab-9da4a611f2b1/C836.Calu-3.2.bam', "rb")
fetchedreads = pysam.AlignmentFile("test.bam", "wb", template=samfile)
for read in samfile.fetch('7', 140453130, 140453135):
  fetchedreads.write(read)

fetchedreads.close()
samfile.close()

Let's see if we saved it?


In [0]:
!ls -lha


total 5.7M
drwxr-xr-x 1 root root 4.0K Jan 29 23:20 .
drwxr-xr-x 1 root root 4.0K Jan 29 23:14 ..
-rw-r--r-- 1 root root 2.6K Jan 29 23:16 adc.json
-rw-r--r-- 1 root root 5.6M Jan 29 23:20 C836.Calu-3.2.bam.bai
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .config
drwxr-xr-x 1 root root 4.0K Jan 28 17:05 sample_data
-rw-r--r-- 1 root root  28K Jan 29 23:20 test.bam

In [0]:
#if you don't already have a google cloud storage bucket, you can make one using the following command:
#The mb command creates a new bucket. 
#gsutil mb gs://your_bucket

In [0]:
#to see what's in the bucket..
#!gsutil ls gs://your_bucket/

In [0]:
# then we can copy over the file

!gsutil cp gs://bam_bucket_1/test.bam test_dl.bam


Copying gs://bam_bucket_1/test.bam...
/ [1 files][ 27.5 KiB/ 27.5 KiB]                                                
Operation completed over 1 objects/27.5 KiB.                                     

In [0]:
# and it made it?

!gsutil ls gs://bam_bucket_1/


gs://bam_bucket_1/test.bam
gs://bam_bucket_1/test_2.bam
gs://bam_bucket_1/test_3.bam

Now, can we read it back?!?


In [0]:
newsamfile = pysam.AlignmentFile('gs://bam_bucket_1/test.bam', 'rb')
for r in newsamfile.fetch(until_eof=True):
  print(r)
#  
#  
# No. But maybe soon. #


---------------------------------------------------------------------------
PermissionError                           Traceback (most recent call last)
<ipython-input-15-2ba9acdc4ae9> in <module>()
----> 1 newsamfile = pysam.AlignmentFile('gs://bam_bucket_1/test.bam', 'rb')
      2 for r in newsamfile.fetch(until_eof=True):
      3   print(r)
      4 #
      5 #

pysam/libcalignmentfile.pyx in pysam.libcalignmentfile.AlignmentFile.__cinit__()

pysam/libcalignmentfile.pyx in pysam.libcalignmentfile.AlignmentFile._open()

PermissionError: [Errno 13] could not open alignment file `gs://bam_bucket_1/test.bam`: Permission denied

Let's move our slice back to this instance.


In [0]:
!gsutil ls gs://bam_bucket_1/

In [0]:
!gsutil cp gs://bam_bucket_1/test.bam test_dl.bam

Now we're ready to work with our bam-slice!

Very brief examples of working with reads.

The Alignment file is read as a pysam.AlignedSegment, which is a python class. The methods and class variables can be found here: https://pysam.readthedocs.io/en/latest/api.html#pysam.AlignedSegment


In [0]:
import numpy as np

# first we'll open our bam-slice
dlsamfile = pysam.AlignmentFile('test_dl.bam', 'rb')

# and we'll save the read quality scores in a list
quality = []
for read in dlsamfile:
  quality.append(read.mapping_quality)
  
# then we can compute statistics on them
print("Average quality score")
print(np.mean(quality))


Average quality score
58.861111111111114

In [0]:
# again open our bam-slice
dlsamfile = pysam.AlignmentFile('test_dl.bam', 'rb')

# here, we'll extract the sequences to process
seqs = []
for read in dlsamfile:
  seqs.append(read.query_sequence)
  

# let's count the number of times nucleotide bases are read.
baseCount = dict()
baseCount['A'] = 0
baseCount['C'] = 0
baseCount['G'] = 0
baseCount['T'] = 0
baseCount['N'] = 0
totalCount = 0

for si in seqs:
  for base in si:
    baseCount[base] += 1
    totalCount +=1

for bi in ['A', 'G', 'C', 'T']:
  baseCount[bi] /= totalCount
    
print("Percent bases")
print(baseCount)


Percent bases
{'A': 0.3117690058479532, 'C': 0.24978070175438596, 'G': 0.16564327485380118, 'T': 0.27266081871345027, 'N': 2}