Welcome to the ‘Query of the Month’. This is part of our collection of new and interesting queries to demonstrate the powerful combination of BigData from the NCI cancer programs like TCGA, and BigQuery from Google.
Please let us know if you have an idea or a suggestion for our next QotM!
Query of the Month is produced by:
David L Gibbs (david.gibbs ( ~ at ~ ) systemsbiology ( ~ dot ~ ) org) Kawther Abdilleh (kawther.abdilleh ( ~ at ~ ) gdit (~ dot ~) com) Sheila M Reynolds (sheila.reynolds ( ~ at ~ ) systemsbiology ( ~ dot ~ ) org)
In [0]:
from google.colab import auth
auth.authenticate_user()
print('Authorized')
Authorized
Pysam is a python wrapper around samtools, and samtools uses the HTSlib (http://www.htslib.org/). So we need to make sure we have the necessary libraries to compile HTSlib and samtools. The compilation is needed to activate the ability to read from google cloud buckets.
In [0]:
import os
os.environ['HTSLIB_CONFIGURE_OPTIONS'] = "--enable-gcs"
In [0]:
!ls -lha
total 28K
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .
drwxr-xr-x 1 root root 4.0K Jan 29 23:14 ..
-rw-r--r-- 1 root root 2.6K Jan 29 23:16 adc.json
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .config
drwxr-xr-x 1 root root 4.0K Jan 28 17:05 sample_data
In [0]:
!sudo apt-get install autoconf automake make gcc perl zlib1g-dev libbz2-dev liblzma-dev libcurl4-openssl-dev libssl-dev
Reading package lists... Done
Building dependency tree
Reading state information... Done
liblzma-dev is already the newest version (5.2.2-1.3).
liblzma-dev set to manually installed.
make is already the newest version (4.1-9.1ubuntu1).
make set to manually installed.
zlib1g-dev is already the newest version (1:1.2.11.dfsg-0ubuntu2).
zlib1g-dev set to manually installed.
gcc is already the newest version (4:7.3.0-3ubuntu2.1).
gcc set to manually installed.
perl is already the newest version (5.26.1-6ubuntu0.3).
perl set to manually installed.
The following additional packages will be installed:
autotools-dev bzip2-doc libsigsegv2 libssl-doc libssl1.1 m4
Suggested packages:
autoconf-archive gnu-standards autoconf-doc libtool gettext libcurl4-doc
libidn11-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev m4-doc
The following NEW packages will be installed:
autoconf automake autotools-dev bzip2-doc libbz2-dev libcurl4-openssl-dev
libsigsegv2 libssl-dev libssl-doc m4
The following packages will be upgraded:
libssl1.1
1 upgraded, 10 newly installed, 0 to remove and 12 not upgraded.
Need to get 5,459 kB of archives.
After this operation, 17.4 MB of additional disk space will be used.
Get:1 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl1.1 amd64 1.1.0g-2ubuntu4.3 [1,130 kB]
Get:2 http://archive.ubuntu.com/ubuntu bionic/main amd64 libsigsegv2 amd64 2.12-1 [14.7 kB]
Get:3 http://archive.ubuntu.com/ubuntu bionic/main amd64 m4 amd64 1.4.18-1 [197 kB]
Get:4 http://archive.ubuntu.com/ubuntu bionic/main amd64 autoconf all 2.69-11 [322 kB]
Get:5 http://archive.ubuntu.com/ubuntu bionic/main amd64 autotools-dev all 20180224.1 [39.6 kB]
Get:6 http://archive.ubuntu.com/ubuntu bionic/main amd64 automake all 1:1.15.1-3ubuntu2 [509 kB]
Get:7 http://archive.ubuntu.com/ubuntu bionic/main amd64 bzip2-doc all 1.0.6-8.1 [294 kB]
Get:8 http://archive.ubuntu.com/ubuntu bionic/main amd64 libbz2-dev amd64 1.0.6-8.1 [29.5 kB]
Get:9 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libcurl4-openssl-dev amd64 7.58.0-2ubuntu3.5 [294 kB]
Get:10 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl-dev amd64 1.1.0g-2ubuntu4.3 [1,374 kB]
Get:11 http://archive.ubuntu.com/ubuntu bionic-updates/main amd64 libssl-doc all 1.1.0g-2ubuntu4.3 [1,255 kB]
Fetched 5,459 kB in 2s (3,134 kB/s)
debconf: unable to initialize frontend: Dialog
debconf: (No usable dialog-like program is installed, so the dialog based frontend cannot be used. at /usr/share/perl5/Debconf/FrontEnd/Dialog.pm line 76, <> line 11.)
debconf: falling back to frontend: Readline
debconf: unable to initialize frontend: Readline
debconf: (This frontend requires a controlling tty.)
debconf: falling back to frontend: Teletype
dpkg-preconfigure: unable to re-open stdin:
(Reading database ... 110851 files and directories currently installed.)
Preparing to unpack .../00-libssl1.1_1.1.0g-2ubuntu4.3_amd64.deb ...
Unpacking libssl1.1:amd64 (1.1.0g-2ubuntu4.3) over (1.1.0g-2ubuntu4.1) ...
Selecting previously unselected package libsigsegv2:amd64.
Preparing to unpack .../01-libsigsegv2_2.12-1_amd64.deb ...
Unpacking libsigsegv2:amd64 (2.12-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../02-m4_1.4.18-1_amd64.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../03-autoconf_2.69-11_all.deb ...
Unpacking autoconf (2.69-11) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../04-autotools-dev_20180224.1_all.deb ...
Unpacking autotools-dev (20180224.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../05-automake_1%3a1.15.1-3ubuntu2_all.deb ...
Unpacking automake (1:1.15.1-3ubuntu2) ...
Selecting previously unselected package bzip2-doc.
Preparing to unpack .../06-bzip2-doc_1.0.6-8.1_all.deb ...
Unpacking bzip2-doc (1.0.6-8.1) ...
Selecting previously unselected package libbz2-dev:amd64.
Preparing to unpack .../07-libbz2-dev_1.0.6-8.1_amd64.deb ...
Unpacking libbz2-dev:amd64 (1.0.6-8.1) ...
Selecting previously unselected package libcurl4-openssl-dev:amd64.
Preparing to unpack .../08-libcurl4-openssl-dev_7.58.0-2ubuntu3.5_amd64.deb ...
Unpacking libcurl4-openssl-dev:amd64 (7.58.0-2ubuntu3.5) ...
Selecting previously unselected package libssl-dev:amd64.
Preparing to unpack .../09-libssl-dev_1.1.0g-2ubuntu4.3_amd64.deb ...
Unpacking libssl-dev:amd64 (1.1.0g-2ubuntu4.3) ...
Selecting previously unselected package libssl-doc.
Preparing to unpack .../10-libssl-doc_1.1.0g-2ubuntu4.3_all.deb ...
Unpacking libssl-doc (1.1.0g-2ubuntu4.3) ...
Setting up libbz2-dev:amd64 (1.0.6-8.1) ...
Setting up libsigsegv2:amd64 (2.12-1) ...
Setting up m4 (1.4.18-1) ...
Processing triggers for libc-bin (2.27-3ubuntu1) ...
Setting up autotools-dev (20180224.1) ...
Setting up bzip2-doc (1.0.6-8.1) ...
Setting up libssl1.1:amd64 (1.1.0g-2ubuntu4.3) ...
debconf: unable to initialize frontend: Dialog
debconf: (No usable dialog-like program is installed, so the dialog based frontend cannot be used. at /usr/share/perl5/Debconf/FrontEnd/Dialog.pm line 76.)
debconf: falling back to frontend: Readline
Processing triggers for man-db (2.8.3-2ubuntu0.1) ...
Setting up libssl-doc (1.1.0g-2ubuntu4.3) ...
Setting up libcurl4-openssl-dev:amd64 (7.58.0-2ubuntu3.5) ...
Setting up libssl-dev:amd64 (1.1.0g-2ubuntu4.3) ...
Setting up autoconf (2.69-11) ...
Setting up automake (1:1.15.1-3ubuntu2) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Processing triggers for libc-bin (2.27-3ubuntu1) ...
In [0]:
!pip3 install pysam -v --force-reinstall --no-binary :all:
# Without forcing the compilation, we get error
# [Errno 93] could not open alignment file '...': Protocol not supported
Created temporary directory: /tmp/pip-ephem-wheel-cache-grc7x9pg
Created temporary directory: /tmp/pip-req-tracker-_0vdrlxw
Created requirements tracker '/tmp/pip-req-tracker-_0vdrlxw'
Created temporary directory: /tmp/pip-install-4mbemz89
Collecting pysam
1 location(s) to search for versions of pysam:
* https://pypi.org/simple/pysam/
Getting page https://pypi.org/simple/pysam/
Looking up "https://pypi.org/simple/pysam/" in the cache
Request header has "max_age" as 0, cache bypassed
Starting new HTTPS connection (1): pypi.org:443
https://pypi.org:443 "GET /simple/pysam/ HTTP/1.1" 200 9072
Updating cache with response from "https://pypi.org/simple/pysam/"
Caching due to etag
Analyzing links from page https://pypi.org/simple/pysam/
Found link https://files.pythonhosted.org/packages/7f/ce/e9405fcf72096f78dc7d75e8ce2a1cd907e1b4a9af0dbf1fc4dac5770f81/pysam-0.4.tar.gz#sha256=d8d437fadc283be6fc96f932a1417c43f5fb0a7cf267f8a750e819aa2babe1c5 (from https://pypi.org/simple/pysam/), version: 0.4
Found link https://files.pythonhosted.org/packages/df/58/508dc40f603551d34b815560d52d9532dd243f1a8c35d9317ebff15d27e7/pysam-0.4.1.tar.gz#sha256=4a358266f93c103e4f003ae9a539fef1d91f572a6cbe7ace9a03ea220712d195 (from https://pypi.org/simple/pysam/), version: 0.4.1
Found link https://files.pythonhosted.org/packages/64/7b/09ff2b61c7600a5aefd7ee0c37cec60140d31f8194d237e1d63c4d457931/pysam-0.7.6.tar.gz#sha256=d082ee3c8d7f105968719170956456d3660ef3a199bf53f9667f959ca4d11200 (from https://pypi.org/simple/pysam/), version: 0.7.6
Found link https://files.pythonhosted.org/packages/46/b5/877f40fbb84f588b69b4afcb1409b8bdeed7ef980113d3e8ef69bab26e09/pysam-0.7.7.tar.gz#sha256=c9f3018482eec99ee199dda3fdef2aa7424dde6574672a4c0d209a10985755cc (from https://pypi.org/simple/pysam/), version: 0.7.7
Found link https://files.pythonhosted.org/packages/b5/0f/436d15f08096dd9869a956e502fd119c15efbd84896aa53df50c7c6c0e13/pysam-0.7.8.tar.gz#sha256=d5deb64156ced1b95799854d8e9d5acdea1b2c9fdb7ffc3348e599a907bb810a (from https://pypi.org/simple/pysam/), version: 0.7.8
Found link https://files.pythonhosted.org/packages/a4/ea/901d47d5621f15c05079dcf45e746a77bab21dbf0f9ce272993a3ca3a367/pysam-0.8.0.tar.gz#sha256=50cb6a68ce18eec604a6ef10fd6e85d4b836aa570758acbe02c54e0ff51bf282 (from https://pypi.org/simple/pysam/), version: 0.8.0
Found link https://files.pythonhosted.org/packages/0e/4a/d1625792b2fd3a172d4bad096ab1559bcb7a81fa5fa6f9bc3937de23340d/pysam-0.8.1.tar.gz#sha256=a9105a1aa65f5a93e1e2cfb0e3009190b7a8a82ad7fb29cceaaaffbba08966b9 (from https://pypi.org/simple/pysam/), version: 0.8.1
Found link https://files.pythonhosted.org/packages/10/42/7f51e1ad0c283e1d6bf826d3a193fa0644e675c9c6d42263b69fefc3b527/pysam-0.8.2.tar.gz#sha256=90cf4c05358b8e545f4f00c0637488d85b78d6170af093cd1e4762128b6427f2 (from https://pypi.org/simple/pysam/), version: 0.8.2
Found link https://files.pythonhosted.org/packages/07/6b/3f48a2f05fbde46f2c52fc5f9adc15d928951cd54035109d553e14b774c7/pysam-0.8.2.1.tar.gz#sha256=8dc442b5b185bda37be8c3053b7f4fac438e3836dc2b190254d666d67ebb3a03 (from https://pypi.org/simple/pysam/), version: 0.8.2.1
Found link https://files.pythonhosted.org/packages/f9/b9/8cfad46376335001f0cbbc46bf402fa107b0e8af8fe9e4192702b251f628/pysam-0.8.3.tar.gz#sha256=343e91a1882278455ef9a5f3c9fc4921c37964341785bf22432381d18e6d115e (from https://pypi.org/simple/pysam/), version: 0.8.3
Found link https://files.pythonhosted.org/packages/27/89/bf8c44d0bfe9d0cadab062893806994c168c9f490f67370fc56d6e8ba224/pysam-0.8.4.tar.gz#sha256=30cf23931edf8a426678811f234bca4a83a53438028b323f2ef55792562d9dea (from https://pypi.org/simple/pysam/), version: 0.8.4
Found link https://files.pythonhosted.org/packages/0f/37/fa514cb2163997551e95f63ec12f7bec7b640a601456f1d0ab3ab900c05f/pysam-0.9.0.tar.gz#sha256=90edf568835245e03eea176196cfafdfcb3af7e5fb40e48923a63f75c266c03c (from https://pypi.org/simple/pysam/), version: 0.9.0
Found link https://files.pythonhosted.org/packages/40/15/20b22dc3d017ec123e533d062b982b111b0214168905de3221b5caf5f766/pysam-0.9.1.tar.gz#sha256=2969e080d435c62c4dd497294dfdb36eb92cd31f551c1030c0159481a5ef101e (from https://pypi.org/simple/pysam/), version: 0.9.1
Found link https://files.pythonhosted.org/packages/f7/ae/59341d9fd2bed1cc32225115fc3f866a0e4e020f31073d698785c956360f/pysam-0.9.1.1.tar.gz#sha256=c3c106fc5e93f226d7830bbb4bb2c7238a993ef7de07c627f90944140a997d3d (from https://pypi.org/simple/pysam/), version: 0.9.1.1
Found link https://files.pythonhosted.org/packages/76/62/908776209238850eca22e7139cc23ce2ba14b2941ceb438b1572f84e8d82/pysam-0.9.1.2.tar.gz#sha256=da49d15c3adca67c46d0aa418e8d2b27d1667890a444886dd95d6da55e6e5e2b (from https://pypi.org/simple/pysam/), version: 0.9.1.2
Found link https://files.pythonhosted.org/packages/e7/e9/db49c8bd39673c1f48200f69ccc34784016d664136f36e03a090411a95fc/pysam-0.9.1.3.tar.gz#sha256=137fa5e288284e3708a7287ad9b4d08c0f069af8da5811e575e9aeabdcfa227b (from https://pypi.org/simple/pysam/), version: 0.9.1.3
Found link https://files.pythonhosted.org/packages/de/03/02934438b204565bc5231f38a11da840a3c3e4b2beac8c8770d675770668/pysam-0.9.1.4.tar.gz#sha256=56ee7f8d07fa9d78b5c00dfbf335c95edbfed1518a2c14f8f108e58599922dc4 (from https://pypi.org/simple/pysam/), version: 0.9.1.4
Skipping link https://files.pythonhosted.org/packages/29/5a/0b25d6d734e1797c7ce06442ff6714af53cb1c8cd6c6cfd1a32df4587e33/pysam-0.10.0-cp27-cp27m-manylinux1_x86_64.whl#sha256=7fe3ee09e9eb70887f04900ce9444ab52ad16b78b85be6e3b1857a14b2ee36f9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/72/d2/d106b2fc317e838f7eea7140c8d0ad4df4fde6a456a526649a58397f638c/pysam-0.10.0-cp27-cp27mu-manylinux1_x86_64.whl#sha256=01b3c10052c561f9dacf98478ef7195dc68a92706eb6d279c8fdc3c0ef14629a (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0c/55/d775726477bfe55e06c88701c8cf9a4b2596a877b09e562551c00cf4a931/pysam-0.10.0-cp34-cp34m-manylinux1_x86_64.whl#sha256=e2b86a6aac3df4fd5f658604af934c7fce61ba4ade188d1af1c17cce17d38094 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/89/ea/01735cceef15296bad16873979ae6848efebbbc9ab20eba244d532846dbf/pysam-0.10.0-cp35-cp35m-manylinux1_x86_64.whl#sha256=a2838dc68f6ec91957347c8e286bec9d2a8557ae44bc59232aefc6c5a7a25e81 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/8a/09/526378006226fb39eb54d9935c407c9b3c0302792c89e50d6b4f14d6f4b8/pysam-0.10.0-cp36-cp36m-manylinux1_x86_64.whl#sha256=81e3a70c6801b92714123d576f23aab792f5111a49282f7c050fd2620d38e465 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/87/8e/d2d8238558970df37c7aa01ddec63057a98042334e939b4c1c69cb9a2504/pysam-0.10.0.tar.gz#sha256=1e925d2c9bf7b1753392da4fee3c0c184f8b062acd074905caa20569f87354e0 (from https://pypi.org/simple/pysam/), version: 0.10.0
Skipping link https://files.pythonhosted.org/packages/93/f5/bfca0394bb90cc5993b7595d7c6aeebfc43dce8bf97394df4bfba9141caf/pysam-0.11-cp27-cp27m-manylinux1_x86_64.whl#sha256=0196588bf9a2d499abf1882e3c04431dc81faaa4432feddd6eb03fe7a430a62e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/4b/ff/7e0c6169883a26cee912ce25ef98893c13966cce1064fd6136b53e28d365/pysam-0.11-cp27-cp27mu-manylinux1_x86_64.whl#sha256=9de9d06f2de8949d062cd995bee982940283c309426d7ee287a2de22e3b2e92e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/39/ba/91614d3e18818011decdb5cda8991cea11330d274399492822fb50b7478e/pysam-0.11-cp34-cp34m-manylinux1_x86_64.whl#sha256=f3280509966dbc44e1d5669ce9fe523e67eebe970f304e626f210df999b12731 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/3e/6f/2b166df4d7d55e2f69551b85ec2bba01048e5dc2307163ab8ad7d694bde1/pysam-0.11-cp35-cp35m-manylinux1_x86_64.whl#sha256=1943e27e8584dacbd1098fc17b55c6fc80765c1df6b9fb4844d3925232453afe (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0b/28/cd6fde9c19444f779130e27195b4c1d9d896266e4e0b0bc8d515c031854f/pysam-0.11-cp36-cp36m-manylinux1_x86_64.whl#sha256=4f598c325cefba2b09adc53e4e7fd669f6855ab6db52f27ff4d73da48bc2b2a9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/f4/bb/c5fcaace8857bdf8a430de41b5298c602fdce4917494f7a941c038e5861a/pysam-0.11.tar.gz#sha256=815c8a6150c5fe21df227e730dd57e4212984ae568854fcc5873e243072dcbad (from https://pypi.org/simple/pysam/), version: 0.11
Skipping link https://files.pythonhosted.org/packages/81/01/2304e5367c566f538cf64bad1bd41ec41e47d8aeefd197a209c8c1cf14fa/pysam-0.11.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=4ade89003f13c6eb6b243c76eb782b2bcf3f8320a7675758b553d7c2e7214743 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/ef/b3/b7ea200fc6e16af0cd2397659a2a2dd383f4ea71d2e0948f7215e73fb6a6/pysam-0.11.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=5a4ac394b644c7cb9782351aff7e782c7f4c670df54c0bb170fa36c10e1a5c86 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/e5/00/0d55946c0b1c781caee096ef9c4e9e54047ecf897874bf791c5ea8351df3/pysam-0.11.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=19f37b28ec1f5125a47080ea2b87cd801a8cf3c67dd4f2a872cfd0ecb6673ecb (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/45/2a/b5e9e88b0d5097fa45f0832a05acfb39879679a087e55145198d47bb6099/pysam-0.11.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=ec38dddadc0c6cbcbfc38f481ffbb33f888a91665a29bca10077a4380eeb4aae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/6e/0e/967ed910f8ce74ed5ea6b7a4775a86d05205963bf927a8452604ad277913/pysam-0.11.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=1663730a69bfe7e84e7dcd9bcc3a35d8d2ad2c023746f1806b678e294fe21b8a (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/be/70/16cdd6c5ef799b2db2af4fd5f9720df0f3206b0a06ed40e03692aa80ae25/pysam-0.11.1.tar.gz#sha256=fbc710f82cb4334b3b88be9b7a9781547456fdcb2135755b68e041e96fc28de1 (from https://pypi.org/simple/pysam/), version: 0.11.1
Found link https://files.pythonhosted.org/packages/89/d9/52995323a3a15e14f2cd579a49f953c804b36a1a7d7dc09a08b7de3591d2/pysam-0.11.2.tar.gz#sha256=d64e1b5b6b0aeac2effa7f9f6117f5413ccf6a0028935d45491a1553154a17b1 (from https://pypi.org/simple/pysam/), version: 0.11.2
Skipping link https://files.pythonhosted.org/packages/8f/23/12b4829036ce49ec068c61a28057029dd19a6a1a29855dff0efb785e0d12/pysam-0.11.2.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=da2dc02fc9d92ed72bdcf22e03e06ba06c6119c858b1de5cec992e2e98977ea5 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0a/d8/daa0986a5049b66b4ab2fc8093a17a961cedc75d1a39e1a4821d19f4f13f/pysam-0.11.2.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=713e897ab7e3a82cb92a0a5fda1fd7e968c75a4d990c778e2433cf6f10d12b2f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/34/5f/254cec485fedd72269c061262eb2bc36f8a438a5badb78c8582e46905623/pysam-0.11.2.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=89d1715f90e65ffce7dfca7fa5040b8965b6324f1b343ebd540500eed9c1862b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/c3/cc/47ae71c341bd822dfeec2148f6521c1bba690e4581814114519b3cc611d4/pysam-0.11.2.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=acbfdffa8dae9dd3569af65569639694f128a598691ec471de3c54e3831baee4 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/c7/b0/4acf13c3b125db232e8ed93fec3e5b3a90abe47fd27aaacc15c9e03caf6f/pysam-0.11.2.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=71f2c4ef61ac64954bf1fdfcf6ea1912350145ede753db10e04fb3d87ffec2e2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/4b/d2/152284e08c551471c7a7b9b23b4d0916637705ee4f979314ca1750b37c83/pysam-0.11.2.1.tar.gz#sha256=5de4744e451652db70bfd5494606fde8d4c58d3ae55b9816329dc905c80a7c60 (from https://pypi.org/simple/pysam/), version: 0.11.2.1
Skipping link https://files.pythonhosted.org/packages/24/dd/2a9226b90d8c98482209617c2376434e1c19da4981de49c78af0e763988f/pysam-0.11.2.2-cp27-cp27m-manylinux1_x86_64.whl#sha256=e7826460c3178ff35e91b511a8fb3e978fc916c3e1d9b388eb9f62bb51410b58 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0d/9d/d30859cf5a7555719e9b28d34f61bbd4ef0e811fb8a857a986ee9913b79a/pysam-0.11.2.2-cp27-cp27mu-manylinux1_x86_64.whl#sha256=7af66c50f7766419ad458f55b0349597361a38eb45b7d98e3730863f60d7d4ae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/d8/34/b0a7ece94bf7af7d482282ccd8430fe291147960d900b514b7aa606c9170/pysam-0.11.2.2-cp34-cp34m-manylinux1_x86_64.whl#sha256=6a86f8ed81ceae1122edfcff65329b260a359ed601a657f47f33f7009d8c2516 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/9d/a0/2bc18552108cf9605e0ffa7c31673bc56653c0cd7521730a2d5eeb06939f/pysam-0.11.2.2-cp35-cp35m-manylinux1_x86_64.whl#sha256=8362ef266063047d156770ae2bff875aa7ec0d906b8b298479705e6117370f6f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/23/c0/18436ad1db0ed38c997b7fda42db8b6489c50abcb321320015de12bdd164/pysam-0.11.2.2-cp36-cp36m-manylinux1_x86_64.whl#sha256=ee5126b00628fd959cb99d4ff196493c0bc952f51dcb558f4154407c3d31a10b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/a4/1b/b6dfd92aea876647d20d9a8bd8618e4f2af6300539426be83c8bb0912d6f/pysam-0.11.2.2.tar.gz#sha256=9cd66406eaff40986302e9e1edc5872538f0fed9623aa8ceb15f9b80bbabfe03 (from https://pypi.org/simple/pysam/), version: 0.11.2.2
Skipping link https://files.pythonhosted.org/packages/be/3c/9c0d31f4baa506057e781641325f52f709ca4fe777065e39be08e690752b/pysam-0.12-cp27-cp27m-manylinux1_x86_64.whl#sha256=dcd17f2dbe7b9e0742856cd23fd4ae7d6ecc9c48e3baa91bf019b63d935fa1e9 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/5e/f1/28f7e3df4941ac01c2c1794b1009000fad81cf026da6c04e223e5e86e6ad/pysam-0.12-cp27-cp27mu-manylinux1_x86_64.whl#sha256=e8205678d96c33f122caa1e12dcb41a2db20d9147ef02c4f4f9c76b98a6362d8 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/e7/a7/9225250a464b91caba6c88e82b59755e07a30aa803085febbb923655d2d5/pysam-0.12-cp34-cp34m-manylinux1_x86_64.whl#sha256=b50500a772b9e3b13daea2ca43bfc0c7251369bf361b6579ad579d4f8887b9d2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/c6/ce/08728c6f395b46cdb75b79d4c554184b624fbe344a6a99b62b1a7f58a5df/pysam-0.12-cp35-cp35m-manylinux1_x86_64.whl#sha256=454e083cb80cf14fd73b5230c9f58836215b0bc961ec3d88a25897d05d24cd5f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/ef/bd/a741af36309bfbd8d40e5c5c9fc9f2ca3c7a86c2d1ff7c2563a81d851a44/pysam-0.12-cp36-cp36m-manylinux1_x86_64.whl#sha256=692afc5ae93ca6dbd6aaf12d79e9c376d7df42e600ceb73dcf1c1d3c238d6a67 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/0f/e0/19046ae89307ddeadfa8dabc305a9cfce67865de06b762057edd84bc0fd6/pysam-0.12.tar.gz#sha256=33922cb3277ed9a63457c1b6a9dcad2774a217ababcc97a854435be87ba80488 (from https://pypi.org/simple/pysam/), version: 0.12
Skipping link https://files.pythonhosted.org/packages/15/bc/9d27138acddecbeca3a010691e71e89ad02e5c6dc3a38ca9d8cc94c92295/pysam-0.12.0.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=ecde3b5e8051c04ab455a5822e4b5dd58b48344ca2f256d6f0f899426e823b05 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/29/d9/7a508464feb23b750ba0d56e10e014f0d1a8cd6a4e8fe3887c75affa5fa9/pysam-0.12.0.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=035238322ad06d853173ad4203f393e1c2fff9e6bb560b90a37890a77e4d9f1d (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/eb/d5/4b67f2767fc352d8246c3eed4ce0f5d61fdbf6cef6e5b57d433ed63f7ed8/pysam-0.12.0.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=02d818752e93a4263a6d41a4fc6e46ad6180e1bdc6906da0f88d7ef0a986ff14 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0e/d9/91db21a596a3a896365a90c5b44c6722b4e0acfd5e90c52071175e77aad4/pysam-0.12.0.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=a99cd626ff0fdc09b68a1cc9cc9551f4dc3c4cd49872583de1a2f39e69520923 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/50/28/f3a3989a9a34fa6c84fdba3d80b4b1624b2c253d7906a13638152b20555b/pysam-0.12.0.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=f1cd051d474a72079dbeaa3d6cb1b26dac005af8e4cf71b4dddad7c66b08ce26 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/b9/98/d98b250f98a6b91df71a03083219bec786cdda5408f77997f8ad81d06058/pysam-0.12.0.1.tar.gz#sha256=04837bf0b1313e57d50076f228463262b9982c410b973eb184c033528f83d523 (from https://pypi.org/simple/pysam/), version: 0.12.0.1
Skipping link https://files.pythonhosted.org/packages/14/cd/676a08a4bd77fd21716add76f946235780a5673c75c7408b2449db2dde5a/pysam-0.13-cp27-cp27m-manylinux1_x86_64.whl#sha256=a87d86c69c4007b898e1c0256da1eef6f9c67d8bfaa2208591e7e43b02c8ee92 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/59/7e/55048651e80ca7ebbed41489ec53da863a500d536fbff5884175e81b40c1/pysam-0.13-cp27-cp27mu-manylinux1_x86_64.whl#sha256=d977b0cfed87ae9fc0fcac1b03a676f95ce9b6f574105311d7f1e106826d8256 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/fc/63/4a758298dafa37a719540fd55c4e76de15e3ad6be0201c9e0e6ed59b3d8c/pysam-0.13-cp34-cp34m-manylinux1_x86_64.whl#sha256=539203173afb0f8672284969077f32e487690dd1a3e7458d3cd1e2f69dfe7637 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/8b/08/8f6ea307458945f9e5db70e460b7902f210f08646af35800372907095f06/pysam-0.13-cp35-cp35m-manylinux1_x86_64.whl#sha256=c0b11efe9ffc66e4ccbbadb992a0ca39ba736ca985cb02423ec1a7ed95b3f6d8 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/f1/dd/5f41722f95749537e2f5a84414a4b08fc4e14d39552df8171e375129edf5/pysam-0.13-cp36-cp36m-manylinux1_x86_64.whl#sha256=cd86023f429ef7eeb8dd19f85553c2f4544e2927e0d23d99cbc907f4c74dce8d (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/31/17/31d317006a74941d2caddac97c5106601fe4da467653d0f061702e9ead95/pysam-0.13.tar.gz#sha256=1829035f58bddf26b0cb6867968178701c2a243518ea697dcedeebff487979af (from https://pypi.org/simple/pysam/), version: 0.13
Skipping link https://files.pythonhosted.org/packages/c9/0b/ca7620a778a1ac5a6669b750ab82cd8e2ca29f671cf2ab929cf907338bf5/pysam-0.14-cp27-cp27m-manylinux1_x86_64.whl#sha256=f08e3ee089a1691be837473a40eea097be7de3c066ce3ebc1e2d486d0ebda29c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/2b/ff/a7cdcde7f79ca59cd6a6921f55f0cce8fb3d4ff273257e313efc3e52853a/pysam-0.14-cp27-cp27mu-manylinux1_x86_64.whl#sha256=f0973c10a3377d5d8291aeebd03ce9a79192581903407b475223428b0843e063 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/51/c1/474c632acbbd7c06921a4ad31b237c3f41fe662101ec775be6a9c3c8cf20/pysam-0.14-cp34-cp34m-manylinux1_x86_64.whl#sha256=6da96be7861ca95a7c4378ac15c2e9372b45d99a3f5360d88e21a9d45fe6718c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/f7/53/6e677a66b02755d9d631a7ffa37b23b8eca7b2463faf14dcf3bcbbcbec24/pysam-0.14-cp35-cp35m-manylinux1_x86_64.whl#sha256=02cb2d210be93782179e94565ee7531a7e4ff2ddff05967ed9c502445a7544ed (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/96/7b/845e49997825cf2aaef3719853e8d2d07b43d3a5e096cb9863208b7d0af8/pysam-0.14-cp36-cp36m-manylinux1_x86_64.whl#sha256=2aec5aebb90c1c1fe0f596984663773af7cc98ef1de0db047d93c99aac52177f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/d8/78/8b3fad13d3bd8787c0d922056061727c2a0cf91c45a836c98342594dd293/pysam-0.14.tar.gz#sha256=c9c8ea82b4deee7607d5885fc7cc92311f06e765ff30e0b2b2d3d85b28cf5687 (from https://pypi.org/simple/pysam/), version: 0.14
Skipping link https://files.pythonhosted.org/packages/cd/9b/2627df910452b49bef57dd5ce720832d49faadea3e3d86f940f168b807b4/pysam-0.14.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=d571e8536b3bc9807577e0e2744247d1887b90a6ad005c0dedea7639bb04d5fd (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/b3/96/a9b21863c30c00bde76ab9bd3b538ed9f4d872f6767217c930cd0246fd21/pysam-0.14.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=dadf1c6c7c3be79d526c38fcf6ff577062efed814b17341a4b8fbde7226a9555 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/a0/ba/95ee9ea7921ae153c51880ffe047269a7ccf396442214f4fc965cc66ea68/pysam-0.14.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=3d064977832536287d95e657d9ed184a0cc6e331b877637b203d50d4762bec5e (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/09/a9/d74aa164efb28ce328cd4890b0182ccdf2e781c192910072717c965765c6/pysam-0.14.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=4279edd397a32e665e20d53d878a5604b98cc57067a0fc3d58f6933a5b6f82fb (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/97/bb/65b3a258ffca71251ae1d07c1d3eb54448da31ee74106e49e2f251f066d4/pysam-0.14.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=37fba70c6273329eb60383154189c6a72a960186d5e9d8cf0f757f2ba9f08b32 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/fc/9b/4bb8d016406dcff47e2866e14d3dcb10741ec3920649e8c521996830944f/pysam-0.14.1.tar.gz#sha256=2e86f5228429d08975c8adb9030296699012a8deba8ba26cbfc09b374f792c97 (from https://pypi.org/simple/pysam/), version: 0.14.1
Skipping link https://files.pythonhosted.org/packages/2f/d8/57e6c36c4069e3b240115b3cb98bf1d5a2989d76815aff14fb0149d27781/pysam-0.15.0-cp27-cp27m-manylinux1_x86_64.whl#sha256=3cb1cda2a501751231fc7358d4b8d981ca13d9fe5e9a5a04ccd728a56a28bb96 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/dc/af/c14708a4d43effb82bd14302e41e9fa818b724ada9b9d89283319a22a585/pysam-0.15.0-cp27-cp27mu-manylinux1_x86_64.whl#sha256=43165efe8f1d8b7e2dd254dae93e88b5ed3de4fb6e9c54f32274c1e2c6124a68 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/15/77/2e258a5ff090226516c4338d682c6f8ed13e5be2ac7a67e6b452b04b0237/pysam-0.15.0-cp34-cp34m-manylinux1_x86_64.whl#sha256=c66d08f45dd2b3404d65429f792c9b79fac8ab29b09941aff0cb47cd29a7d16f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0d/5d/d96d3662647a3cf33b1e3fe6d21eaecd00f47d39edbe4cd85486639cb603/pysam-0.15.0-cp35-cp35m-manylinux1_x86_64.whl#sha256=044541e8310c64993ba201cd9c32659acd2f1400a5094c52353030e082f2a831 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/47/da/6a0cc06c65acaea0b8830e632712d53fa8bc88ea19096038b3bef22b25da/pysam-0.15.0-cp36-cp36m-manylinux1_x86_64.whl#sha256=dbb2de0144fb16adaa49bfd67ca919e27404996bdd060a06bbcd82eb60ff09de (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/f9/c4/f1b6963a05f415aa69c8efd64ebe460d56d03ecc75db70b0e8606b589ade/pysam-0.15.0.tar.gz#sha256=51e7030bebff68502a69fabc601727f827cd6e7c08c5899b11ad8c6084ba4ba5 (from https://pypi.org/simple/pysam/), version: 0.15.0
Skipping link https://files.pythonhosted.org/packages/b4/d8/9afa92bd4b48ebd6896d22bb7cdaeb5aa4577983333df5e99160c62fb6ff/pysam-0.15.1-cp27-cp27m-manylinux1_x86_64.whl#sha256=cc6b5bcc464bebe5c932cb1ba0ff9d3a6193d9b72d05aba9f16e8d115c06149c (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/66/6b/f1a4f142d884b6e1cda6542bf4b89ce88ad8465197511d83994f2cf6484d/pysam-0.15.1-cp27-cp27mu-manylinux1_x86_64.whl#sha256=e1271bfb05a87cff378c88c956c96f6ae040a2d996104a31effa817929578e8f (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/69/5f/030c774b44932d2e23d773558679d553fb31dd5ecdb094b8e26b316de784/pysam-0.15.1-cp34-cp34m-manylinux1_x86_64.whl#sha256=d164917496b6569d727505fef0b6623dc3485d6f45ebd8394b124b155a3c0419 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/37/27/7d7ce83c0acac59b95849f2fb678484147f1e1393162ee0975cb7f84e53c/pysam-0.15.1-cp35-cp35m-manylinux1_x86_64.whl#sha256=c54403c26490afdfc5db68a0ca1e846b94daa8ee0f571e278efda428257016af (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/6f/f4/e12faf1618e977a868fe66d40288fc3dd989a10cc4c77603da33a7634a18/pysam-0.15.1-cp36-cp36m-manylinux1_x86_64.whl#sha256=8616649ad4e3538236636d068361bc9716ad45700f65bd46b7508cbc69ca49d7 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/1e/04/3e22a04ade5291e968b3f3e9195929574221d86fd8982a4976a40b045060/pysam-0.15.1-cp37-cp37m-manylinux1_x86_64.whl#sha256=1173a05c88752f2b871cc902fa33769a85c052f28bf0a94946f4a1576e300bce (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/73/59/c319f1bde3019bbce4583cecb12b9e3e52ffcfbe2c96d8b1fb131c0d4fb7/pysam-0.15.1.tar.gz#sha256=658421124c2f3de1b7445e03ca8413df0077f67ea9980abdaab0d1b5f7a8936f (from https://pypi.org/simple/pysam/), version: 0.15.1
Skipping link https://files.pythonhosted.org/packages/1b/7d/68b6555c7bb414b655495305d2add784c251fc83d4e698878e6d1d35fc9a/pysam-0.15.2-cp27-cp27m-manylinux1_x86_64.whl#sha256=34dd4cf08cbdea1329a140f5446c319992460d400b9851c0cb5607f3c58ad256 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/0f/bd/f5ab828a9ff45a6ca14d5ea2a3580f720134052db258cd7ef929a4ed1d7a/pysam-0.15.2-cp27-cp27mu-manylinux1_x86_64.whl#sha256=236ae950c0194037ac3e8a11fa7bda6b46db17ee3f86e1111775ed4b9cdaf95b (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/4b/04/d5a6386b6d124bcdf27d81ab952e5d24e37ff98b97f992aa5b83c647e9c9/pysam-0.15.2-cp34-cp34m-manylinux1_x86_64.whl#sha256=975fbd395b5c4d360be5fde2e34d418c64718ba732ae5b2bfb712e6cefa750d5 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/aa/e6/0b18d30c30e3690c5774446c1d7246c5e37c4710e38d93a20bb56cad4bc0/pysam-0.15.2-cp35-cp35m-manylinux1_x86_64.whl#sha256=1e0a6abf4fe0d3934fee8d662f6fda28e466b60209b5b1fd41070e1ccfbe87f2 (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/f1/fc/d2be1a093bd8494ab63e3168aca36c2494753bbff190f3201ce2e7da9cda/pysam-0.15.2-cp36-cp36m-manylinux1_x86_64.whl#sha256=0f063380ebd727f58483b256fe21d90358527fbdf48b925ae2680cc1f2c553ae (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Skipping link https://files.pythonhosted.org/packages/20/1a/4fd27da2d19f7d914f757097605709a6509776b4cb63f42bca63f3531058/pysam-0.15.2-cp37-cp37m-manylinux1_x86_64.whl#sha256=e8166058e01d5b7fd2d82c5fee29f9c22e6016091b8c397cc029f7cc2f2f61ff (from https://pypi.org/simple/pysam/); No binaries permitted for pysam
Found link https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 (from https://pypi.org/simple/pysam/), version: 0.15.2
Using version 0.15.2 (newest of versions: 0.4, 0.4.1, 0.7.6, 0.7.7, 0.7.8, 0.8.0, 0.8.1, 0.8.2, 0.8.2.1, 0.8.3, 0.8.4, 0.9.0, 0.9.1, 0.9.1.1, 0.9.1.2, 0.9.1.3, 0.9.1.4, 0.10.0, 0.11, 0.11.1, 0.11.2, 0.11.2.1, 0.11.2.2, 0.12, 0.12.0.1, 0.13, 0.14, 0.14.1, 0.15.0, 0.15.1, 0.15.2)
Created temporary directory: /tmp/pip-unpack-kl3k8fgj
Looking up "https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz" in the cache
No cache entry available
Starting new HTTPS connection (1): files.pythonhosted.org:443
https://files.pythonhosted.org:443 "GET /packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz HTTP/1.1" 200 3225916
Downloading https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz (3.2MB)
Downloading from URL https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 (from https://pypi.org/simple/pysam/)
99% |████████████████████████████████| 3.2MB 61.5MB/s eta 0:00:01 Ignoring unknown cache-control directive: immutable
Updating cache with response from "https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz"
Caching due to etag
100% |████████████████████████████████| 3.2MB 10.5MB/s
Added pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 to build tracker '/tmp/pip-req-tracker-_0vdrlxw'
Running setup.py (path:/tmp/pip-install-4mbemz89/pysam/setup.py) egg_info for package pysam
Running command python setup.py egg_info
checking for gcc... gcc
checking whether the C compiler works... yes
checking for C compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking for ranlib... ranlib
checking for grep that handles long lines and -e... /bin/grep
checking for C compiler warning flags... -Wall
checking for special C compiler options needed for large files... no
checking for _FILE_OFFSET_BITS value needed for large files... no
checking for _LARGEFILE_SOURCE value needed for large files... no
checking shared library type for unknown-Linux... plain .so
checking how to run the C preprocessor... gcc -E
checking for egrep... /bin/grep -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking for stdlib.h... (cached) yes
checking for unistd.h... (cached) yes
checking for sys/param.h... yes
checking for getpagesize... yes
checking for working mmap... yes
checking for gmtime_r... yes
checking for fsync... yes
checking for drand48... yes
checking whether fdatasync is declared... yes
checking for fdatasync... yes
checking for library containing log... -lm
checking for zlib.h... yes
checking for inflate in -lz... yes
checking for library containing recv... none required
checking for bzlib.h... yes
checking for BZ2_bzBuffToBuffCompress in -lbz2... yes
checking for lzma.h... yes
checking for lzma_easy_buffer_encode in -llzma... yes
checking for libdeflate.h... no
checking for libdeflate_deflate_compress in -ldeflate... no
checking for curl_easy_pause in -lcurl... yes
checking for CCHmac... no
checking for library containing HMAC... -lcrypto
checking whether PTHREAD_MUTEX_RECURSIVE is declared... yes
configure: creating ./config.status
config.status: creating config.mk
config.status: creating htslib.pc.tmp
config.status: creating config.h
make: ./version.sh: Command not found
make: ./version.sh: Command not found
# pysam: cython is available - using cythonize if necessary
# pysam: htslib mode is shared
# pysam: HTSLIB_CONFIGURE_OPTIONS=--enable-gcs
# pysam: htslib configure options: --enable-gcs
# pysam: htslib_config LDFLAGS=
# pysam: htslib_config LIBHTS_OBJS=kfunc.o knetfile.o kstring.o bcf_sr_sort.o bgzf.o errmod.o faidx.o hfile.o hfile_net.o hts.o hts_os.o md5.o multipart.o probaln.o realn.o regidx.o sam.o synced_bcf_reader.o vcf_sweep.o tbx.o textutils.o thread_pool.o vcf.o vcfutils.o cram/cram_codecs.o cram/cram_decode.o cram/cram_encode.o cram/cram_external.o cram/cram_index.o cram/cram_io.o cram/cram_samtools.o cram/cram_stats.o cram/files.o cram/mFILE.o cram/open_trace_file.o cram/pooled_alloc.o cram/rANS_static.o cram/sam_header.o cram/string_alloc.o hfile_libcurl.o hfile_gcs.o hfile_s3.o
# pysam: htslib_config LIBS=-llzma -lbz2 -lz -lm -lcurl -lcrypto
# pysam: htslib_config PLATFORM=default
# pysam: config_option: ENABLE_PLUGINS=0
# pysam: config_option: HAVE_COMMONCRYPTO=0
# pysam: config_option: HAVE_GMTIME_R=1
# pysam: config_option: HAVE_HMAC=1
# pysam: config_option: HAVE_IRODS=0
# pysam: config_option: HAVE_LIBCURL=1
# pysam: config_option: HAVE_MMAP=1
running egg_info
creating pip-egg-info/pysam.egg-info
writing pip-egg-info/pysam.egg-info/PKG-INFO
writing dependency_links to pip-egg-info/pysam.egg-info/dependency_links.txt
writing top-level names to pip-egg-info/pysam.egg-info/top_level.txt
writing manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
package init file 'samtools/__init__.py' not found (or not a regular file)
package init file 'bcftools/__init__.py' not found (or not a regular file)
package init file 'samtools/win32/__init__.py' not found (or not a regular file)
package init file 'htslib/__init__.py' not found (or not a regular file)
package init file 'htslib/htslib/__init__.py' not found (or not a regular file)
reading manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no files found matching 'KNOWN_BUGS'
warning: no files found matching 'THANKS'
no previously-included directories found matching 'tests/'
warning: no files found matching 'samtools/configure'
warning: no files found matching 'samtools/config.mk.in'
warning: no files found matching 'samtools/config.h.in'
writing manifest file 'pip-egg-info/pysam.egg-info/SOURCES.txt'
Source in /tmp/pip-install-4mbemz89/pysam has version 0.15.2, which satisfies requirement pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9
Removed pysam from https://files.pythonhosted.org/packages/15/f6/ce0611aaa1865a616f7dc164fbf046eaf38f2b17c6d404403c56250beb93/pysam-0.15.2.tar.gz#sha256=d049efd91ed5b1af515aa30280bc9cb46a92ddd15d546c9b21ee68a6ed4055d9 from build tracker '/tmp/pip-req-tracker-_0vdrlxw'
Skipping bdist_wheel for pysam, due to binaries being disabled for it.
Installing collected packages: pysam
Created temporary directory: /tmp/pip-record-s9nep6mv
Running setup.py install for pysam ... Running command /usr/bin/python3 -u -c "import setuptools, tokenize;__file__='/tmp/pip-install-4mbemz89/pysam/setup.py';f=getattr(tokenize, 'open', open)(__file__);code=f.read().replace('\r\n', '\n');f.close();exec(compile(code, __file__, 'exec'))" install --record /tmp/pip-record-s9nep6mv/install-record.txt --single-version-externally-managed --compile
# pysam: cython is available - using cythonize if necessary
# pysam: htslib mode is shared
# pysam: HTSLIB_CONFIGURE_OPTIONS=--enable-gcs
checking for gcc... gcc
checking whether the C compiler works... yes
checking for C compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking for ranlib... ranlib
checking for grep that handles long lines and -e... /bin/grep
checking for C compiler warning flags... -Wall
checking for special C compiler options needed for large files... no
checking for _FILE_OFFSET_BITS value needed for large files... no
checking for _LARGEFILE_SOURCE value needed for large files... no
checking shared library type for unknown-Linux... plain .so
checking how to run the C preprocessor... gcc -E
checking for egrep... /bin/grep -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking for stdlib.h... (cached) yes
checking for unistd.h... (cached) yes
checking for sys/param.h... yes
checking for getpagesize... yes
checking for working mmap... yes
checking for gmtime_r... yes
checking for fsync... yes
checking for drand48... yes
checking whether fdatasync is declared... yes
checking for fdatasync... yes
checking for library containing log... -lm
checking for zlib.h... yes
checking for inflate in -lz... yes
checking for library containing recv... none required
checking for bzlib.h... yes
checking for BZ2_bzBuffToBuffCompress in -lbz2... yes
checking for lzma.h... yes
checking for lzma_easy_buffer_encode in -llzma... yes
checking for libdeflate.h... no
checking for libdeflate_deflate_compress in -ldeflate... no
checking for curl_easy_pause in -lcurl... yes
checking for CCHmac... no
checking for library containing HMAC... -lcrypto
checking whether PTHREAD_MUTEX_RECURSIVE is declared... yes
configure: creating ./config.status
config.status: creating config.mk
config.status: creating htslib.pc.tmp
config.status: creating config.h
config.status: config.h is unchanged
# pysam: htslib configure options: --enable-gcs
make: ./version.sh: Command not found
make: ./version.sh: Command not found
# pysam: htslib_config LDFLAGS=
# pysam: htslib_config LIBHTS_OBJS=kfunc.o knetfile.o kstring.o bcf_sr_sort.o bgzf.o errmod.o faidx.o hfile.o hfile_net.o hts.o hts_os.o md5.o multipart.o probaln.o realn.o regidx.o sam.o synced_bcf_reader.o vcf_sweep.o tbx.o textutils.o thread_pool.o vcf.o vcfutils.o cram/cram_codecs.o cram/cram_decode.o cram/cram_encode.o cram/cram_external.o cram/cram_index.o cram/cram_io.o cram/cram_samtools.o cram/cram_stats.o cram/files.o cram/mFILE.o cram/open_trace_file.o cram/pooled_alloc.o cram/rANS_static.o cram/sam_header.o cram/string_alloc.o hfile_libcurl.o hfile_gcs.o hfile_s3.o
# pysam: htslib_config LIBS=-llzma -lbz2 -lz -lm -lcurl -lcrypto
# pysam: htslib_config PLATFORM=default
# pysam: config_option: ENABLE_PLUGINS=0
# pysam: config_option: HAVE_COMMONCRYPTO=0
# pysam: config_option: HAVE_GMTIME_R=1
# pysam: config_option: HAVE_HMAC=1
# pysam: config_option: HAVE_IRODS=0
# pysam: config_option: HAVE_LIBCURL=1
# pysam: config_option: HAVE_MMAP=1
running install
running build
running build_py
creating build
creating build/lib.linux-x86_64-3.6
creating build/lib.linux-x86_64-3.6/pysam
copying pysam/bcftools.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/samtools.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/__init__.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/version.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/utils.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/config.py -> build/lib.linux-x86_64-3.6/pysam
copying pysam/Pileup.py -> build/lib.linux-x86_64-3.6/pysam
creating build/lib.linux-x86_64-3.6/pysam/include
copying pysam/include/__init__.py -> build/lib.linux-x86_64-3.6/pysam/include
package init file 'samtools/__init__.py' not found (or not a regular file)
package init file 'bcftools/__init__.py' not found (or not a regular file)
package init file 'samtools/win32/__init__.py' not found (or not a regular file)
package init file 'htslib/__init__.py' not found (or not a regular file)
package init file 'htslib/htslib/__init__.py' not found (or not a regular file)
copying pysam/libchtslib.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcutils.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcalignedsegment.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcsamfile.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libctabix.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcbcf.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcvcf.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libctabixproxies.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcfaidx.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcsamtools.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcalignmentfile.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/libcbcftools.pxd -> build/lib.linux-x86_64-3.6/pysam
copying pysam/csamtools_util.h -> build/lib.linux-x86_64-3.6/pysam
copying pysam/pysam_util.h -> build/lib.linux-x86_64-3.6/pysam
copying pysam/htslib_util.h -> build/lib.linux-x86_64-3.6/pysam
copying pysam/pysam_stream.h -> build/lib.linux-x86_64-3.6/pysam
copying pysam/cbcftools_util.h -> build/lib.linux-x86_64-3.6/pysam
creating build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/tmp_file.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bedidx.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bam_plbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bam2bcf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bam_endian.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/sam_header.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/sam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/sam_opts.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/stats_isize.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/samtools.pysam.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/bam_lpileup.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/samtools.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/sample.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/version.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
copying samtools/config.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools
creating build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/call.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/gvcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/bcftools.pysam.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/regidx.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/hclust.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/bam2bcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/vcfbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/kmin.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/bin.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/mw.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/vcmp.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/rbuf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/bcftools.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/ploidy.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/tsv2vcf.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/kheap.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/HMM.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/version.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/khash_str2str.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/bam_sample.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/config.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/prob1.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/filter.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/smpl_ilist.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
copying bcftools/convert.h -> build/lib.linux-x86_64-3.6/pysam/include/bcftools
creating build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
copying samtools/win32/xcurses.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
copying samtools/win32/zconf.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
copying samtools/win32/zlib.h -> build/lib.linux-x86_64-3.6/pysam/include/samtools/win32
creating build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/thread_pool_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/hfile_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/version.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/hts_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/config.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/textutils_internal.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
copying htslib/bcf_sr_sort.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib
creating build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/kstring.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/regidx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/vcf.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hts_os.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/synced_bcf_reader.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/knetfile.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hts.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/sam.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/cram.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/ksort.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/vcfutils.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hts_endian.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/thread_pool.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/kseq.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/faidx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hts_defs.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hfile.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/bgzf.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/kbitset.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/khash.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/kfunc.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/khash_str2int.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/klist.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/vcf_sweep.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/hts_log.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
copying htslib/htslib/tbx.h -> build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib
Fixing build/lib.linux-x86_64-3.6/pysam/bcftools.py build/lib.linux-x86_64-3.6/pysam/samtools.py build/lib.linux-x86_64-3.6/pysam/__init__.py build/lib.linux-x86_64-3.6/pysam/version.py build/lib.linux-x86_64-3.6/pysam/utils.py build/lib.linux-x86_64-3.6/pysam/config.py build/lib.linux-x86_64-3.6/pysam/Pileup.py build/lib.linux-x86_64-3.6/pysam/include/__init__.py
Skipping optional fixer: buffer
Skipping optional fixer: idioms
Skipping optional fixer: set_literal
Skipping optional fixer: ws_comma
Fixing build/lib.linux-x86_64-3.6/pysam/bcftools.py build/lib.linux-x86_64-3.6/pysam/samtools.py build/lib.linux-x86_64-3.6/pysam/__init__.py build/lib.linux-x86_64-3.6/pysam/version.py build/lib.linux-x86_64-3.6/pysam/utils.py build/lib.linux-x86_64-3.6/pysam/config.py build/lib.linux-x86_64-3.6/pysam/Pileup.py build/lib.linux-x86_64-3.6/pysam/include/__init__.py
Skipping optional fixer: buffer
Skipping optional fixer: idioms
Skipping optional fixer: set_literal
Skipping optional fixer: ws_comma
running build_ext
skipping 'pysam/libchtslib.c' Cython extension (up-to-date)
building 'pysam.libchtslib' extension
creating build/temp.linux-x86_64-3.6
creating build/temp.linux-x86_64-3.6/pysam
creating build/temp.linux-x86_64-3.6/htslib
creating build/temp.linux-x86_64-3.6/htslib/cram
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libchtslib.c -o build/temp.linux-x86_64-3.6/pysam/libchtslib.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/htslib_util.c -o build/temp.linux-x86_64-3.6/pysam/htslib_util.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/kfunc.c -o build/temp.linux-x86_64-3.6/htslib/kfunc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/knetfile.c -o build/temp.linux-x86_64-3.6/htslib/knetfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/kstring.c -o build/temp.linux-x86_64-3.6/htslib/kstring.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/bcf_sr_sort.c -o build/temp.linux-x86_64-3.6/htslib/bcf_sr_sort.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/bgzf.c -o build/temp.linux-x86_64-3.6/htslib/bgzf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/errmod.c -o build/temp.linux-x86_64-3.6/htslib/errmod.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/faidx.c -o build/temp.linux-x86_64-3.6/htslib/faidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile.c -o build/temp.linux-x86_64-3.6/htslib/hfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_net.c -o build/temp.linux-x86_64-3.6/htslib/hfile_net.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hts.c -o build/temp.linux-x86_64-3.6/htslib/hts.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hts_os.c -o build/temp.linux-x86_64-3.6/htslib/hts_os.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/md5.c -o build/temp.linux-x86_64-3.6/htslib/md5.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/multipart.c -o build/temp.linux-x86_64-3.6/htslib/multipart.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/probaln.c -o build/temp.linux-x86_64-3.6/htslib/probaln.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/realn.c -o build/temp.linux-x86_64-3.6/htslib/realn.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/regidx.c -o build/temp.linux-x86_64-3.6/htslib/regidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/sam.c -o build/temp.linux-x86_64-3.6/htslib/sam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/synced_bcf_reader.c -o build/temp.linux-x86_64-3.6/htslib/synced_bcf_reader.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcf_sweep.c -o build/temp.linux-x86_64-3.6/htslib/vcf_sweep.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/tbx.c -o build/temp.linux-x86_64-3.6/htslib/tbx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/textutils.c -o build/temp.linux-x86_64-3.6/htslib/textutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/thread_pool.c -o build/temp.linux-x86_64-3.6/htslib/thread_pool.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcf.c -o build/temp.linux-x86_64-3.6/htslib/vcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/vcfutils.c -o build/temp.linux-x86_64-3.6/htslib/vcfutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_codecs.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_codecs.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_decode.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_decode.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_encode.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_encode.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_external.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_external.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_index.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_index.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_io.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_io.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_samtools.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_samtools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/cram_stats.c -o build/temp.linux-x86_64-3.6/htslib/cram/cram_stats.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/files.c -o build/temp.linux-x86_64-3.6/htslib/cram/files.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/mFILE.c -o build/temp.linux-x86_64-3.6/htslib/cram/mFILE.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/open_trace_file.c -o build/temp.linux-x86_64-3.6/htslib/cram/open_trace_file.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/pooled_alloc.c -o build/temp.linux-x86_64-3.6/htslib/cram/pooled_alloc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/rANS_static.c -o build/temp.linux-x86_64-3.6/htslib/cram/rANS_static.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/sam_header.c -o build/temp.linux-x86_64-3.6/htslib/cram/sam_header.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/cram/string_alloc.c -o build/temp.linux-x86_64-3.6/htslib/cram/string_alloc.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_libcurl.c -o build/temp.linux-x86_64-3.6/htslib/hfile_libcurl.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_gcs.c -o build/temp.linux-x86_64-3.6/htslib/hfile_gcs.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c htslib/hfile_s3.c -o build/temp.linux-x86_64-3.6/htslib/hfile_s3.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libchtslib.o build/temp.linux-x86_64-3.6/pysam/htslib_util.o build/temp.linux-x86_64-3.6/htslib/kfunc.o build/temp.linux-x86_64-3.6/htslib/knetfile.o build/temp.linux-x86_64-3.6/htslib/kstring.o build/temp.linux-x86_64-3.6/htslib/bcf_sr_sort.o build/temp.linux-x86_64-3.6/htslib/bgzf.o build/temp.linux-x86_64-3.6/htslib/errmod.o build/temp.linux-x86_64-3.6/htslib/faidx.o build/temp.linux-x86_64-3.6/htslib/hfile.o build/temp.linux-x86_64-3.6/htslib/hfile_net.o build/temp.linux-x86_64-3.6/htslib/hts.o build/temp.linux-x86_64-3.6/htslib/hts_os.o build/temp.linux-x86_64-3.6/htslib/md5.o build/temp.linux-x86_64-3.6/htslib/multipart.o build/temp.linux-x86_64-3.6/htslib/probaln.o build/temp.linux-x86_64-3.6/htslib/realn.o build/temp.linux-x86_64-3.6/htslib/regidx.o build/temp.linux-x86_64-3.6/htslib/sam.o build/temp.linux-x86_64-3.6/htslib/synced_bcf_reader.o build/temp.linux-x86_64-3.6/htslib/vcf_sweep.o build/temp.linux-x86_64-3.6/htslib/tbx.o build/temp.linux-x86_64-3.6/htslib/textutils.o build/temp.linux-x86_64-3.6/htslib/thread_pool.o build/temp.linux-x86_64-3.6/htslib/vcf.o build/temp.linux-x86_64-3.6/htslib/vcfutils.o build/temp.linux-x86_64-3.6/htslib/cram/cram_codecs.o build/temp.linux-x86_64-3.6/htslib/cram/cram_decode.o build/temp.linux-x86_64-3.6/htslib/cram/cram_encode.o build/temp.linux-x86_64-3.6/htslib/cram/cram_external.o build/temp.linux-x86_64-3.6/htslib/cram/cram_index.o build/temp.linux-x86_64-3.6/htslib/cram/cram_io.o build/temp.linux-x86_64-3.6/htslib/cram/cram_samtools.o build/temp.linux-x86_64-3.6/htslib/cram/cram_stats.o build/temp.linux-x86_64-3.6/htslib/cram/files.o build/temp.linux-x86_64-3.6/htslib/cram/mFILE.o build/temp.linux-x86_64-3.6/htslib/cram/open_trace_file.o build/temp.linux-x86_64-3.6/htslib/cram/pooled_alloc.o build/temp.linux-x86_64-3.6/htslib/cram/rANS_static.o build/temp.linux-x86_64-3.6/htslib/cram/sam_header.o build/temp.linux-x86_64-3.6/htslib/cram/string_alloc.o build/temp.linux-x86_64-3.6/htslib/hfile_libcurl.o build/temp.linux-x86_64-3.6/htslib/hfile_gcs.o build/temp.linux-x86_64-3.6/htslib/hfile_s3.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -o build/lib.linux-x86_64-3.6/pysam/libchtslib.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcsamtools.c' Cython extension (up-to-date)
building 'pysam.libcsamtools' extension
creating build/temp.linux-x86_64-3.6/samtools
creating build/temp.linux-x86_64-3.6/samtools/lz4
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcsamtools.c -o build/temp.linux-x86_64-3.6/pysam/libcsamtools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_plcmd.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_plcmd.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_split.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_split.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_view.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_view.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_markdup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_markdup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_opts.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_opts.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_rmdupse.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_rmdupse.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_quickcheck.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_quickcheck.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/faidx.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/faidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_sort.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_sort.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_color.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_color.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_stat.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_stat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_lpileup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_lpileup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2bcf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2bcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_index.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_index.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_rmdup.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_rmdup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/samtools.pysam.c -o build/temp.linux-x86_64-3.6/samtools/samtools.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_flags.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_flags.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bedcov.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bedcov.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2bcf_indel.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2bcf_indel.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/tmp_file.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/tmp_file.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sample.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sample.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bamshuf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bamshuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_header.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_header.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_md.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_md.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bedidx.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bedidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/phase.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/phase.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/cut_target.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/cut_target.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bamtk.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bamtk.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam2depth.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam2depth.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_plbuf.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_plbuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/padding.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/padding.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_import.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_import.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_mate.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_mate.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/sam_utils.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/sam_utils.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/dict.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/dict.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_cat.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_cat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/stats_isize.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/stats_isize.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_addrprg.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_addrprg.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_reheader.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_reheader.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/bam_aux.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/bam_aux.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/stats.c.pysam.c -o build/temp.linux-x86_64-3.6/samtools/stats.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c samtools/lz4/lz4.c -o build/temp.linux-x86_64-3.6/samtools/lz4/lz4.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcsamtools.o build/temp.linux-x86_64-3.6/samtools/bam_plcmd.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_split.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_view.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_markdup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_opts.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_rmdupse.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_quickcheck.c.pysam.o build/temp.linux-x86_64-3.6/samtools/faidx.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_sort.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_color.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_stat.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_lpileup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2bcf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_index.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_rmdup.c.pysam.o build/temp.linux-x86_64-3.6/samtools/samtools.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_flags.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bedcov.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2bcf_indel.c.pysam.o build/temp.linux-x86_64-3.6/samtools/tmp_file.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sample.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bamshuf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_header.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_md.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bedidx.c.pysam.o build/temp.linux-x86_64-3.6/samtools/phase.c.pysam.o build/temp.linux-x86_64-3.6/samtools/cut_target.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bamtk.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam2depth.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_plbuf.c.pysam.o build/temp.linux-x86_64-3.6/samtools/padding.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_import.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_mate.c.pysam.o build/temp.linux-x86_64-3.6/samtools/sam_utils.c.pysam.o build/temp.linux-x86_64-3.6/samtools/dict.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_cat.c.pysam.o build/temp.linux-x86_64-3.6/samtools/stats_isize.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_addrprg.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_reheader.c.pysam.o build/temp.linux-x86_64-3.6/samtools/bam_aux.c.pysam.o build/temp.linux-x86_64-3.6/samtools/stats.c.pysam.o build/temp.linux-x86_64-3.6/samtools/lz4/lz4.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcsamtools.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcbcftools.c' Cython extension (up-to-date)
building 'pysam.libcbcftools' extension
creating build/temp.linux-x86_64-3.6/bcftools
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbcftools.c -o build/temp.linux-x86_64-3.6/pysam/libcbcftools.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/tsv2vcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/tsv2vcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/gvcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/gvcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/prob1.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/prob1.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/mcall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/mcall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfview.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfview.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/reheader.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/reheader.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfsort.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfsort.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/regidx.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/regidx.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcffilter.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcffilter.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfgtcheck.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfgtcheck.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfisec.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfisec.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfindex.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfindex.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/em.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/em.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/main.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/main.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfannotate.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfannotate.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam2bcf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam2bcf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfroh.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfroh.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfconvert.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfconvert.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfcall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfcall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/version.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/version.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/kmin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/kmin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam_sample.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam_sample.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfmerge.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfmerge.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bcftools.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bcftools.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bam2bcf_indel.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bam2bcf_indel.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/ploidy.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/ploidy.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfstats.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfstats.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/hclust.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/hclust.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfcnv.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfcnv.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/bin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/bin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/consensus.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/consensus.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/mpileup.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/mpileup.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfplugin.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfplugin.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcmp.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcmp.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/ccall.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/ccall.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfquery.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfquery.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfbuf.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfbuf.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/convert.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/convert.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfnorm.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfnorm.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/filter.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/filter.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/HMM.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/HMM.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/csq.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/csq.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/smpl_ilist.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/smpl_ilist.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/tabix.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/tabix.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfconcat.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfconcat.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c bcftools/vcfsom.c.pysam.c -o build/temp.linux-x86_64-3.6/bcftools/vcfsom.c.pysam.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbcftools.o build/temp.linux-x86_64-3.6/bcftools/tsv2vcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/gvcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/prob1.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/mcall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfview.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/reheader.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfsort.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/regidx.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcffilter.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfgtcheck.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfisec.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfindex.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/em.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/main.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfannotate.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam2bcf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfroh.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfconvert.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfcall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/version.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/kmin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam_sample.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfmerge.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bcftools.pysam.o build/temp.linux-x86_64-3.6/bcftools/bam2bcf_indel.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/ploidy.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfstats.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/hclust.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfcnv.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/bin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/consensus.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/mpileup.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfplugin.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcmp.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/ccall.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfquery.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfbuf.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/convert.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfnorm.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/filter.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/HMM.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/csq.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/smpl_ilist.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/tabix.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfconcat.c.pysam.o build/temp.linux-x86_64-3.6/bcftools/vcfsom.c.pysam.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbcftools.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcutils.c' Cython extension (up-to-date)
building 'pysam.libcutils' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcutils.c -o build/temp.linux-x86_64-3.6/pysam/libcutils.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libcutils.c: In function ‘__pyx_pf_5pysam_9libcutils_8_pysam_dispatch’:
pysam/libcutils.c:6272:3: warning: implicit declaration of function ‘bcftools_set_stderr’; did you mean ‘samtools_set_stderr’? [-Wimplicit-function-declaration]
bcftools_set_stderr(__pyx_t_10);
^~~~~~~~~~~~~~~~~~~
samtools_set_stderr
pysam/libcutils.c:6444:5: warning: implicit declaration of function ‘bcftools_set_stdout_fn’; did you mean ‘samtools_set_stdout_fn’? [-Wimplicit-function-declaration]
bcftools_set_stdout_fn(__pyx_t_13);
^~~~~~~~~~~~~~~~~~~~~~
samtools_set_stdout_fn
pysam/libcutils.c:6455:5: warning: implicit declaration of function ‘bcftools_set_stdout’; did you mean ‘samtools_set_stdout’? [-Wimplicit-function-declaration]
bcftools_set_stdout(__pyx_t_10);
^~~~~~~~~~~~~~~~~~~
samtools_set_stdout
pysam/libcutils.c:7287:5: warning: implicit declaration of function ‘bcftools_set_optind’; did you mean ‘samtools_set_optind’? [-Wimplicit-function-declaration]
bcftools_set_optind(1);
^~~~~~~~~~~~~~~~~~~
samtools_set_optind
pysam/libcutils.c:7366:22: warning: implicit declaration of function ‘bcftools_main’; did you mean ‘samtools_main’? [-Wimplicit-function-declaration]
__pyx_v_retval = bcftools_main((__pyx_v_n + 2), __pyx_v_cargs);
^~~~~~~~~~~~~
samtools_main
pysam/libcutils.c:7435:3: warning: implicit declaration of function ‘bcftools_unset_stderr’; did you mean ‘samtools_unset_stderr’? [-Wimplicit-function-declaration]
bcftools_unset_stderr();
^~~~~~~~~~~~~~~~~~~~~
samtools_unset_stderr
pysam/libcutils.c:7471:5: warning: implicit declaration of function ‘bcftools_unset_stdout’; did you mean ‘samtools_unset_stdout’? [-Wimplicit-function-declaration]
bcftools_unset_stdout();
^~~~~~~~~~~~~~~~~~~~~
samtools_unset_stdout
pysam/libcutils.c: In function ‘__pyx_pw_5pysam_9libcutils_9_pysam_dispatch’:
pysam/libcutils.c:480:40: warning: ‘__pyx_v_retval’ may be used uninitialized in this function [-Wmaybe-uninitialized]
#define PyInt_FromLong PyLong_FromLong
^~~~~~~~~~~~~~~
pysam/libcutils.c:5971:7: note: ‘__pyx_v_retval’ was declared here
int __pyx_v_retval;
^~~~~~~~~~~~~~
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/pysam_util.c -o build/temp.linux-x86_64-3.6/pysam/pysam_util.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcutils.o build/temp.linux-x86_64-3.6/pysam/pysam_util.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcsamtools.cpython-36m-x86_64-linux-gnu -lcbcftools.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcutils.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcalignmentfile.c' Cython extension (up-to-date)
building 'pysam.libcalignmentfile' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcalignmentfile.c -o build/temp.linux-x86_64-3.6/pysam/libcalignmentfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libcalignmentfile.c: In function ‘__pyx_f_5pysam_17libcalignmentfile_14IteratorColumn_cnext’:
pysam/libcalignmentfile.c:30112:126: warning: passing argument 5 of ‘bam_mplp_auto’ from incompatible pointer type [-Wincompatible-pointer-types]
__pyx_v_ret = bam_mplp_auto(__pyx_v_self->pileup_iter, (&__pyx_v_self->tid), (&__pyx_v_self->pos), (&__pyx_v_self->n_plp), (&__pyx_v_self->plp));
^
In file included from pysam/htslib_util.h:4:0,
from pysam/libcalignmentfile.c:573:
/tmp/pip-install-4mbemz89/pysam/htslib/htslib/sam.h:686:9: note: expected ‘const bam_pileup1_t ** {aka const struct <anonymous> **}’ but argument is of type ‘bam_pileup1_t ** {aka struct <anonymous> **}’
int bam_mplp_auto(bam_mplp_t iter, int *_tid, int *_pos, int *n_plp, const bam_pileup1_t **plp);
^~~~~~~~~~~~~
pysam/libcalignmentfile.c: In function ‘__pyx_f_5pysam_17libcalignmentfile_20IteratorRowSelection_cnext’:
pysam/libcalignmentfile.c:28365:9: warning: ignoring return value of ‘bgzf_seek’, declared with attribute warn_unused_result [-Wunused-result]
(void)(bgzf_seek(hts_get_bgzfp(__pyx_v_self->__pyx_base.htsfile), __pyx_v_pos, 0));
^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
pysam/libcalignmentfile.c: In function ‘__pyx_pf_5pysam_17libcalignmentfile_13AlignmentFile_6_open’:
pysam/libcalignmentfile.c:13973:13: warning: ignoring return value of ‘sam_hdr_write’, declared with attribute warn_unused_result [-Wunused-result]
(void)(sam_hdr_write(__pyx_v_self->__pyx_base.htsfile, __pyx_v_hdr));
^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcalignmentfile.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcsamfile.c' Cython extension (up-to-date)
building 'pysam.libcsamfile' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcsamfile.c -o build/temp.linux-x86_64-3.6/pysam/libcsamfile.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcsamfile.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcsamfile.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcalignedsegment.c' Cython extension (up-to-date)
building 'pysam.libcalignedsegment' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcalignedsegment.c -o build/temp.linux-x86_64-3.6/pysam/libcalignedsegment.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libcalignedsegment.c: In function ‘__pyx_pf_5pysam_18libcalignedsegment_14AlignedSegment_18fromstring’:
pysam/libcalignedsegment.c:14379:3: warning: ignoring return value of ‘sam_parse1’, declared with attribute warn_unused_result [-Wunused-result]
(void)(sam_parse1((&__pyx_v_line), __pyx_v_dest->header->ptr, __pyx_v_dest->_delegate));
^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcalignedsegment.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libctabix.c' Cython extension (up-to-date)
building 'pysam.libctabix' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libctabix.c -o build/temp.linux-x86_64-3.6/pysam/libctabix.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libctabix.c: In function ‘__pyx_pf_5pysam_9libctabix_9TabixFile_7contigs___get__’:
pysam/libctabix.c:8706:27: warning: assignment from incompatible pointer type [-Wincompatible-pointer-types]
__pyx_v_sequences = tbx_seqnames(__pyx_v_self->index, (&__pyx_v_nsequences));
^
In file included from pysam/libctabix.c:580:0:
pysam/libctabix.c: In function ‘__pyx_pf_5pysam_9libctabix_4tabix_index’:
/tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
#define TBX_UCSC 0x10000
^
pysam/libctabix.c:13977:39: note: in expansion of macro ‘TBX_UCSC’
__pyx_t_2 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 975, __pyx_L1_error)
^~~~~~~~
/tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
#define TBX_UCSC 0x10000
^
pysam/libctabix.c:14009:39: note: in expansion of macro ‘TBX_UCSC’
__pyx_t_3 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 976, __pyx_L1_error)
^~~~~~~~
/tmp/pip-install-4mbemz89/pysam/htslib/htslib/tbx.h:41:21: warning: overflow in implicit constant conversion [-Woverflow]
#define TBX_UCSC 0x10000
^
pysam/libctabix.c:14379:43: note: in expansion of macro ‘TBX_UCSC’
__pyx_t_3 = __Pyx_PyInt_From_int8_t(TBX_UCSC); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 1005, __pyx_L1_error)
^~~~~~~~
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libctabix.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libctabix.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcfaidx.c' Cython extension (up-to-date)
building 'pysam.libcfaidx' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcfaidx.c -o build/temp.linux-x86_64-3.6/pysam/libcfaidx.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcfaidx.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcfaidx.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcbcf.c' Cython extension (up-to-date)
building 'pysam.libcbcf' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbcf.c -o build/temp.linux-x86_64-3.6/pysam/libcbcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libcbcf.c: In function ‘__pyx_pf_5pysam_7libcbcf_13VariantHeader_12__str__’:
pysam/libcbcf.c:33142:3: warning: ‘bcf_hdr_fmt_text’ is deprecated: use bcf_hdr_format() instead [-Wdeprecated-declarations]
__pyx_v_hstr = bcf_hdr_fmt_text(__pyx_v_self->ptr, 0, (&__pyx_v_hlen));
^~~~~~~~~~~~
In file included from pysam/htslib_util.h:5:0,
from pysam/libcbcf.c:572:
/tmp/pip-install-4mbemz89/pysam/htslib/htslib/vcf.h:439:11: note: declared here
char *bcf_hdr_fmt_text(const bcf_hdr_t *hdr, int is_bcf, int *len)
^~~~~~~~~~~~~~~~
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbcf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbcf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcbgzf.c' Cython extension (up-to-date)
building 'pysam.libcbgzf' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcbgzf.c -o build/temp.linux-x86_64-3.6/pysam/libcbgzf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcbgzf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcbgzf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libctabixproxies.c' Cython extension (up-to-date)
building 'pysam.libctabixproxies' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libctabixproxies.c -o build/temp.linux-x86_64-3.6/pysam/libctabixproxies.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libctabixproxies.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libctabixproxies.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
skipping 'pysam/libcvcf.c' Cython extension (up-to-date)
building 'pysam.libcvcf' extension
x86_64-linux-gnu-gcc -pthread -DNDEBUG -g -fwrapv -O2 -Wall -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -fPIC -I/tmp/pip-install-4mbemz89/pysam/htslib -I/tmp/pip-install-4mbemz89/pysam/samtools -I/tmp/pip-install-4mbemz89/pysam/samtools/lz4 -I/tmp/pip-install-4mbemz89/pysam/bcftools -I/tmp/pip-install-4mbemz89/pysam/pysam -I/tmp/pip-install-4mbemz89/pysam -I/usr/include/python3.6m -c pysam/libcvcf.c -o build/temp.linux-x86_64-3.6/pysam/libcvcf.o -Wno-unused -Wno-strict-prototypes -Wno-sign-compare -Wno-error=declaration-after-statement
pysam/libcvcf.c: In function ‘__pyx_pf_5pysam_7libcvcf_3VCF_32parse_data.isra.77’:
pysam/libcvcf.c:24714:15: warning: ‘__pyx_v_qual’ may be used uninitialized in this function [-Wmaybe-uninitialized]
__pyx_t_9 = PyFloat_FromDouble(__pyx_v_qual); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 873, __pyx_L1_error)
^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
x86_64-linux-gnu-gcc -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-Bsymbolic-functions -Wl,-z,relro -g -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 build/temp.linux-x86_64-3.6/pysam/libcvcf.o -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam/pysam -L/tmp/pip-install-4mbemz89/pysam -L/tmp/pip-install-4mbemz89/pysam/build/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -Lbuild/lib.linux-x86_64-3.6/pysam -lz -llzma -lbz2 -lz -lm -lcurl -lcrypto -lchtslib.cpython-36m-x86_64-linux-gnu -lcutils.cpython-36m-x86_64-linux-gnu -o build/lib.linux-x86_64-3.6/pysam/libcvcf.cpython-36m-x86_64-linux-gnu.so -Wl,-rpath,$ORIGIN
running install_lib
creating /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libchtslib.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcvcf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcsamtools.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcutils.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcbcf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/bcftools.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libctabix.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
creating /usr/local/lib/python3.6/dist-packages/pysam/include
copying build/lib.linux-x86_64-3.6/pysam/include/__init__.py -> /usr/local/lib/python3.6/dist-packages/pysam/include
creating /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/tmp_file.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bedidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
creating /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/xcurses.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/zconf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/win32/zlib.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools/win32
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_plbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam2bcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_endian.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam_header.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sam_opts.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/stats_isize.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/samtools.pysam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/bam_lpileup.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/samtools.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/sample.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
copying build/lib.linux-x86_64-3.6/pysam/include/samtools/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/samtools
creating /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/thread_pool_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/hfile_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/hts_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/textutils_internal.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/bcf_sr_sort.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib
creating /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kstring.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/regidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_os.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/synced_bcf_reader.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/knetfile.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/sam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/cram.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/ksort.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcfutils.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_endian.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/thread_pool.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kseq.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/faidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_defs.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hfile.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/bgzf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kbitset.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/khash.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/kfunc.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/khash_str2int.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/klist.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/vcf_sweep.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/hts_log.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
copying build/lib.linux-x86_64-3.6/pysam/include/htslib/htslib/tbx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/htslib/htslib
creating /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/call.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/gvcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bcftools.pysam.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/regidx.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/hclust.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bam2bcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/vcfbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/kmin.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bin.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/mw.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/vcmp.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/rbuf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bcftools.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/ploidy.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/tsv2vcf.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/kheap.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/HMM.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/version.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/khash_str2str.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/bam_sample.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/config.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/prob1.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/filter.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/smpl_ilist.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/include/bcftools/convert.h -> /usr/local/lib/python3.6/dist-packages/pysam/include/bcftools
copying build/lib.linux-x86_64-3.6/pysam/samtools.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcalignedsegment.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcbgzf.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/__init__.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/csamtools_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcsamfile.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libctabix.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcbcf.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcvcf.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libchtslib.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libctabixproxies.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcutils.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/version.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcbcftools.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcfaidx.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/utils.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/pysam_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/config.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/htslib_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcfaidx.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/pysam_stream.h -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcsamtools.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcsamfile.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libctabixproxies.cpython-36m-x86_64-linux-gnu.so -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/cbcftools_util.h -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcalignmentfile.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/Pileup.py -> /usr/local/lib/python3.6/dist-packages/pysam
copying build/lib.linux-x86_64-3.6/pysam/libcbcftools.pxd -> /usr/local/lib/python3.6/dist-packages/pysam
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/bcftools.py to bcftools.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/include/__init__.py to __init__.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/samtools.py to samtools.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/__init__.py to __init__.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/version.py to version.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/utils.py to utils.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/config.py to config.cpython-36.pyc
byte-compiling /usr/local/lib/python3.6/dist-packages/pysam/Pileup.py to Pileup.cpython-36.pyc
running install_egg_info
running egg_info
writing pysam.egg-info/PKG-INFO
writing dependency_links to pysam.egg-info/dependency_links.txt
writing top-level names to pysam.egg-info/top_level.txt
reading manifest file 'pysam.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no files found matching 'KNOWN_BUGS'
warning: no files found matching 'THANKS'
no previously-included directories found matching 'tests/'
warning: no files found matching 'samtools/configure'
warning: no files found matching 'samtools/config.mk.in'
warning: no files found matching 'samtools/config.h.in'
writing manifest file 'pysam.egg-info/SOURCES.txt'
Copying pysam.egg-info to /usr/local/lib/python3.6/dist-packages/pysam-0.15.2-py3.6.egg-info
running install_scripts
writing list of installed files to '/tmp/pip-record-s9nep6mv/install-record.txt'
done
Removing source in /tmp/pip-install-4mbemz89/pysam
Successfully installed pysam-0.15.2
Cleaning up...
Removed build tracker '/tmp/pip-req-tracker-_0vdrlxw'
In [0]:
import pysam
In [0]:
# First, we need to set our project. Replace the assignment below
# with your project ID.
# project_id = 'isb-cgc-02-0001'
#!gcloud config set project {project_id}
#import os
#os.environ['GCS_OAUTH_TOKEN'] = "gcloud auth application-default print-access-token"
In the query below, we are looking to identify the Google Cloud Storage bucket locations for TCGA Ovarian Cancer BAMs obtained via whole genome sequencing (WGS) generated using the SOLiD sequencing system
In [0]:
%%bigquery --project isb-cgc-02-0001 df
SELECT * FROM `isb-cgc.TCGA_hg19_data_v0.tcga_metadata_data_hg19_18jul`
where
data_format = 'BAM'
AND disease_code = 'OV'
AND experimental_strategy = "WGS"
AND platform = 'ABI SOLiD'
LIMIT 5
Out[0]:
file_gdc_id
case_gdc_id
case_barcode
sample_gdc_id
sample_barcode
project_short_name
disease_code
program_name
data_type
data_category
...
type
file_size
data_format
platform
file_name_key
index_file_id
index_file_name_key
index_file_size
access
acl
0
cfb89251-618c-405e-ab84-9d432170a04a
92960f76-0242-4a1c-bf7d-014c2f720219
TCGA-29-1692
a2bc957e-2263-4b0a-b889-70553f59e0e8
TCGA-29-1692-10A
TCGA-OV
OV
TCGA
Aligned reads
Raw sequencing data
...
file
14924511066
BAM
ABI SOLiD
gs://7008814a-277f-4fd4-aa61-flattened/cfb8925...
e3ff985e-47a3-4553-892b-bc7ffb02c776
gs://7008814a-277f-4fd4-aa61-flattened/e3ff985...
7707512
controlled
phs000178
1
18ab4527-5346-437e-829f-27121f372bef
7fd6ab8a-201e-431d-a886-6ab553b6ca36
TCGA-29-1707
0fdb716d-d203-4ac2-9250-d273715055d3
TCGA-29-1707-10A
TCGA-OV
OV
TCGA
Aligned reads
Raw sequencing data
...
file
303193177515
BAM
ABI SOLiD
gs://7008814a-277f-4fd4-aa61-flattened/18ab452...
e0135f4d-9bbb-4395-9e58-75b146c24627
gs://7008814a-277f-4fd4-aa61-flattened/e0135f4...
9044192
controlled
phs000178
2
8006ca66-a708-4296-986b-4c8a91df4cee
a2319490-b85d-4219-a1b0-fa1ec432d5c8
TCGA-29-2414
3a79f24c-a6c3-4b31-9551-37d97c6027ad
TCGA-29-2414-10A
TCGA-OV
OV
TCGA
Aligned reads
Raw sequencing data
...
file
358029548606
BAM
ABI SOLiD
gs://7008814a-277f-4fd4-aa61-flattened/8006ca6...
b26a334f-e553-48e1-9a94-55e556384410
gs://7008814a-277f-4fd4-aa61-flattened/b26a334...
9089040
controlled
phs000178
3
5d04200b-f2c8-4ffc-8540-46ceb1382a9d
7248cd60-be22-44bc-bc58-f644db0940a2
TCGA-13-1489
0276787c-0e07-4452-9eae-54e2778617d7
TCGA-13-1489-10A
TCGA-OV
OV
TCGA
Aligned reads
Raw sequencing data
...
file
13437326688
BAM
ABI SOLiD
gs://7008814a-277f-4fd4-aa61-flattened/5d04200...
c35343b1-74c4-4713-b774-94ae1e60146f
gs://7008814a-277f-4fd4-aa61-flattened/c35343b...
7541408
controlled
phs000178
4
c70ba617-9462-42cd-b043-f66715910a19
7248cd60-be22-44bc-bc58-f644db0940a2
TCGA-13-1489
4b2b6e5e-248c-46f6-938a-95571577e02d
TCGA-13-1489-01A
TCGA-OV
OV
TCGA
Aligned reads
Raw sequencing data
...
file
12072487137
BAM
ABI SOLiD
gs://7008814a-277f-4fd4-aa61-flattened/c70ba61...
10740816-f723-4fe3-b750-a1c0613b9341
gs://7008814a-277f-4fd4-aa61-flattened/1074081...
7508824
controlled
phs000178
5 rows × 21 columns
In [0]:
samfile = pysam.AlignmentFile('gs://isb-ccle-open/gdc/0a109993-2d5b-4251-bcab-9da4a611f2b1/C836.Calu-3.2.bam', "rb")
for read in samfile.fetch('7', 140453130, 140453135):
print(read)
samfile.close()
D0MUKACXX120302:5:1103:20853:162833 83 6 140453055 60 76M 6 140453011 76 AAATAGCCTCAATTCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGA array('B', [33, 32, 31, 30, 34, 17, 41, 39, 34, 30, 32, 29, 36, 32, 39, 35, 28, 5, 41, 41, 31, 33, 40, 41, 32, 41, 33, 34, 34, 32, 34, 38, 39, 32, 33, 41, 40, 36, 40, 31, 40, 32, 32, 41, 33, 38, 36, 33, 40, 33, 31, 32, 41, 33, 39, 32, 33, 38, 38, 38, 30, 39, 38, 39, 30, 40, 33, 39, 38, 31, 34, 31, 37, 35, 37, 32]) [('MD', '17A58'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?DEE?1HD@:D;C8C@8(JJHHIIHJJJJJJJJJJJJJIHIGIJIIIHIJHHJIJJJJIHFIHFDHHHFFFFFCCC'), ('UQ', 5)]
C0FJ4ACXX120306:7:2106:7109:75175 99 6 140453056 60 76M 6 140453125 76 AATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGAT array('B', [29, 34, 30, 29, 35, 37, 36, 35, 36, 30, 25, 28, 33, 24, 35, 32, 30, 23, 38, 32, 32, 31, 37, 29, 37, 33, 35, 35, 33, 31, 39, 35, 32, 31, 39, 37, 33, 40, 26, 38, 33, 25, 35, 35, 34, 30, 32, 38, 32, 35, 36, 36, 34, 39, 23, 31, 31, 36, 32, 34, 38, 38, 39, 34, 36, 35, 34, 38, 33, 32, 39, 27, 33, 34, 32, 28]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';@@DADDAF>2<C4CGB4CDE;F9F@CG?BEBFGGGIC3CD3?D>DFE>FCFE@3?:B=FFEFF?@>CEEC;?=;5'), ('UQ', 0)]
C0FJ4ACXX120306:4:2308:5502:24253 595 6 140453056 60 76M 6 140452982 76 AATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGAT array('B', [33, 31, 23, 17, 31, 33, 24, 30, 26, 33, 28, 33, 13, 32, 34, 13, 32, 38, 38, 32, 34, 32, 24, 27, 38, 30, 34, 33, 31, 33, 37, 37, 23, 34, 27, 39, 35, 37, 32, 37, 29, 31, 37, 32, 37, 36, 33, 36, 31, 32, 30, 38, 25, 37, 31, 27, 36, 32, 37, 32, 25, 35, 28, 16, 37, 32, 37, 38, 31, 32, 29, 37, 28, 34, 30, 30]) [('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=C=(5@.;=@78)@=)8DBBC?3DDAIEDEDDDD<EEDFD>FDEEEBB@EFC3FA3EEEE:E<+DADDADBB:?<?'), ('UQ', 0)]
D0MUKACXX120302:4:1302:19156:47363 163 6 140453057 60 76M 6 140453141 76 ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATT array('B', [23, 29, 30, 38, 36, 36, 33, 36, 31, 33, 30, 30, 38, 34, 32, 30, 37, 37, 33, 31, 39, 38, 33, 39, 33, 35, 35, 36, 31, 40, 38, 33, 32, 40, 38, 33, 41, 33, 38, 33, 35, 39, 36, 40, 32, 33, 40, 33, 36, 36, 38, 36, 40, 34, 32, 40, 40, 39, 34, 39, 39, 40, 33, 40, 35, 41, 38, 33, 31, 40, 32, 33, 41, 34, 32, 31]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJIJIJJJJJJIJJJIIGIJJIJJJJIJJJJJJJJJJIHGIJIIIJJJJJJJJIJEIHHHHFF'), ('UQ', 0)]
D0N3RACXX120302:6:1207:3520:49064 147 6 140453057 60 76M 6 140452964 76 ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATT array('B', [32, 29, 35, 38, 39, 37, 33, 40, 33, 31, 36, 34, 39, 36, 32, 32, 40, 39, 31, 33, 40, 40, 33, 41, 33, 33, 34, 32, 34, 39, 40, 32, 34, 40, 40, 37, 40, 32, 40, 31, 32, 41, 34, 38, 35, 34, 39, 32, 32, 31, 40, 33, 40, 31, 33, 38, 37, 39, 32, 39, 39, 37, 32, 39, 32, 38, 38, 30, 31, 30, 35, 33, 36, 30, 35, 23]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEFEHEACIGG@GF@8IGGFIHFIGBJJHJHHFJIJHHIHIJJJJIIIIIJJJJJJIHHJHGCHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:2201:1749:176613 163 6 140453058 60 76M 6 140453084 76 TAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTT array('B', [23, 31, 38, 37, 36, 33, 35, 31, 33, 30, 30, 38, 34, 32, 29, 38, 37, 32, 31, 39, 38, 33, 38, 33, 35, 35, 35, 32, 40, 39, 34, 32, 40, 38, 33, 41, 34, 38, 34, 36, 38, 36, 40, 32, 34, 40, 33, 35, 36, 39, 36, 41, 33, 32, 40, 40, 40, 33, 39, 39, 39, 33, 39, 36, 40, 39, 33, 32, 41, 34, 35, 41, 33, 33, 32, 32]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJHHIJJJJJJJIJJIIJIJJJJJHGIJJIJJJJJJJJJJJJJJJHHGFFF'), ('UQ', 0)]
D0MUKACXX120302:4:2204:18554:31278 147 6 140453059 60 76M 6 140453031 76 AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC array('B', [32, 31, 33, 14, 31, 24, 33, 30, 35, 32, 40, 33, 32, 32, 42, 41, 32, 33, 41, 41, 32, 41, 34, 34, 33, 32, 34, 39, 40, 32, 33, 41, 40, 36, 40, 32, 41, 33, 32, 41, 33, 39, 35, 33, 39, 33, 33, 31, 40, 33, 40, 31, 33, 38, 37, 39, 31, 39, 40, 39, 29, 39, 32, 39, 38, 30, 31, 30, 36, 33, 36, 30, 34, 35, 33, 23]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=;?)=3E@D;FA@=JJJHJIIJJJHIJIJIIJJJJIJIHIJJIHHJIGJIJJJJIHHIHGCJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2303:2594:176944 83 6 140453059 60 76M 6 140452955 76 AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC array('B', [29, 25, 39, 37, 31, 31, 33, 32, 35, 31, 39, 33, 27, 31, 40, 41, 31, 34, 41, 40, 33, 41, 34, 34, 32, 31, 34, 38, 39, 33, 34, 41, 40, 36, 40, 31, 41, 34, 32, 41, 33, 39, 36, 34, 40, 33, 33, 32, 40, 34, 40, 32, 34, 39, 39, 40, 32, 39, 39, 38, 31, 40, 33, 39, 40, 32, 33, 31, 38, 35, 38, 31, 35, 36, 34, 31]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=5C@:<HGD;C=8=IIHCIGHJJJHHIIHJGJIJJIIIIIIJJJIJIJJJIJJJJJIIIHFJIHHHGHFFFFF@@B'), ('UQ', 0)]
D0N3RACXX120302:3:2305:14759:1759 83 6 140453060 60 76M 6 140453040 76 GCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCA array('B', [36, 38, 37, 33, 34, 32, 32, 35, 34, 36, 36, 28, 30, 41, 40, 32, 34, 38, 38, 32, 38, 34, 34, 34, 32, 34, 38, 40, 32, 34, 38, 39, 36, 40, 33, 41, 34, 32, 40, 34, 39, 36, 33, 40, 34, 33, 33, 37, 32, 40, 32, 34, 38, 38, 39, 32, 38, 36, 33, 28, 37, 31, 40, 37, 31, 33, 29, 38, 35, 37, 32, 35, 35, 35, 34, 31]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHFGGHHEEGF@;JJJIIHFIJJJIHIJIGIIIIJJJIJJJJJJIIGIGJJIJJIIIHFCIGJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:7:1108:3410:52880 147 6 140453060 60 3S73M 6 140452949 73 ATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACCGTTCAAACTGATGGGACCCACTCCATCGAGATT array('B', [2, 2, 2, 2, 37, 39, 32, 36, 32, 30, 26, 12, 33, 21, 33, 31, 37, 38, 34, 32, 38, 38, 32, 35, 32, 32, 29, 32, 32, 36, 15, 30, 34, 15, 39, 35, 37, 30, 26, 19, 16, 19, 4, 34, 22, 30, 34, 31, 30, 28, 39, 34, 15, 12, 30, 27, 20, 22, 28, 32, 29, 37, 30, 34, 21, 2, 34, 27, 20, 26, 34, 33, 36, 30, 34, 23]) [('MD', '39T33'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '####EC====7)=.@=EEHGGE===8>GD?*?@3DBB@60)8)?4<?F?<EC++A:338@?BCA2)A=3AABD@@?'), ('UQ', 4)]
D0N3RACXX120302:1:1107:19002:45996 99 6 140453061 60 76M 6 140453088 76 CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC array('B', [29, 36, 35, 37, 33, 36, 32, 32, 38, 34, 33, 31, 38, 37, 33, 31, 39, 38, 33, 38, 33, 36, 35, 34, 32, 40, 39, 33, 28, 39, 39, 32, 40, 34, 37, 32, 35, 39, 36, 41, 32, 33, 38, 31, 35, 35, 37, 35, 40, 34, 32, 40, 40, 40, 34, 38, 38, 40, 33, 39, 36, 40, 39, 33, 33, 40, 31, 35, 39, 34, 32, 32, 33, 38, 32, 36]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@C@FFFFFHFGHHJIGIHIIJJFGHIFFDGHEHEEGGIIJCBGDHGGGICHIIJIJGIGIIIJGHHGCD?EEEED?'), ('UQ', 0)]
D0N3RACXX120302:6:1108:3852:64373 99 6 140453061 60 76M 6 140453193 76 CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC array('B', [31, 33, 34, 37, 32, 35, 31, 31, 40, 35, 31, 32, 38, 38, 33, 32, 40, 37, 33, 39, 33, 35, 36, 36, 32, 41, 39, 34, 33, 39, 39, 33, 40, 34, 39, 33, 35, 38, 36, 41, 32, 31, 40, 34, 35, 36, 39, 37, 41, 34, 32, 41, 39, 40, 34, 39, 38, 39, 33, 40, 36, 40, 39, 33, 32, 40, 32, 33, 41, 34, 32, 32, 32, 40, 33, 37]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFFFHHFGHJJJJGIIIJJJJJJIJIIIJJJIJIJIHHIJJJJJJJJJIIIJIJHIGIJJJIJJJHHHHHF?'), ('UQ', 0)]
C0FJ4ACXX120306:2:2205:7019:198160 595 6 140453061 60 6S70M 6 140452965 70 AAAGAACCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTAAAACTGATGGGACCCACTCCATCGAGA array('B', [2, 2, 2, 2, 2, 2, 2, 36, 32, 37, 33, 31, 34, 33, 31, 14, 28, 29, 29, 36, 29, 13, 34, 33, 32, 34, 31, 30, 30, 29, 32, 11, 33, 32, 32, 30, 35, 34, 35, 32, 32, 31, 31, 36, 35, 33, 32, 30, 10, 32, 32, 31, 25, 30, 35, 33, 31, 24, 13, 29, 15, 30, 28, 31, 31, 30, 12, 27, 35, 31, 32, 27, 12, 33, 32, 29]) [('MD', '42C27'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#######A=AAAA>8)88<=9*A;==A?A<=)>A<>????=A:@@A??+B@<3<AB?3+2)A;<A<+=AA;?+==='), ('UQ', 10)]
D0N3RACXX120302:1:1304:15674:165318 83 6 140453061 60 76M 6 140452995 76 CCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAC array('B', [33, 41, 34, 32, 31, 32, 36, 34, 41, 36, 32, 32, 41, 42, 32, 34, 40, 40, 32, 42, 33, 34, 34, 32, 34, 39, 40, 32, 33, 40, 41, 36, 40, 32, 42, 33, 32, 41, 34, 38, 35, 34, 40, 33, 34, 32, 41, 33, 40, 32, 33, 38, 38, 39, 31, 40, 39, 39, 30, 40, 33, 40, 40, 32, 33, 31, 38, 35, 38, 32, 36, 36, 33, 39, 29, 31]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHC>HIHEIHC@JJJIJIHJJJJJJJJJJJJJJJJIIIJJJJJJIIJJJJJJJIHJIHFJJJJHHHHHFFFFFCBC'), ('UQ', 0)]
C0FJ4ACXX120306:8:2108:18240:24066 99 6 140453062 60 76M 6 140453195 76 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [32, 34, 38, 33, 35, 31, 31, 37, 35, 32, 31, 39, 38, 33, 31, 39, 38, 33, 39, 34, 35, 36, 36, 32, 41, 40, 33, 32, 40, 38, 34, 41, 33, 38, 33, 36, 39, 36, 41, 32, 33, 40, 34, 36, 36, 39, 36, 41, 33, 32, 42, 40, 41, 34, 39, 38, 38, 34, 39, 36, 38, 39, 34, 33, 41, 33, 35, 42, 31, 32, 32, 32, 39, 33, 39, 33]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHGJJJJJJJJJIIJJGIJJJJJIJJJIJIJJJIJJJJIJJJJIJJGIJJGJJIIIIJGHHHHGHD'), ('UQ', 0)]
C0FJ4ACXX120306:3:1302:17665:147035 147 6 140453062 60 76M 6 140452980 76 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [26, 24, 34, 31, 23, 33, 27, 37, 36, 28, 16, 36, 41, 32, 33, 40, 41, 33, 41, 33, 34, 33, 32, 32, 38, 40, 32, 33, 40, 40, 35, 40, 30, 40, 29, 30, 38, 33, 38, 35, 33, 41, 33, 32, 31, 40, 34, 39, 31, 33, 38, 37, 35, 31, 39, 39, 39, 30, 39, 32, 40, 39, 31, 33, 30, 37, 34, 37, 28, 34, 34, 32, 39, 29, 38, 23]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '73;C7=4@@8)EGHEJIIIIJIIGIHJIIIIIGF@BGIIJIIJIIIJJIIJIHGIIGGGHJJJHHHHHEFFFFBC@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2304:2394:192642 83 6 140453062 60 76M 6 140452950 76 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [37, 34, 39, 34, 32, 36, 34, 41, 35, 32, 31, 40, 41, 32, 33, 41, 41, 32, 41, 34, 34, 34, 33, 34, 38, 40, 32, 34, 40, 41, 36, 40, 31, 41, 33, 32, 42, 34, 38, 36, 33, 42, 34, 33, 32, 41, 33, 40, 32, 33, 38, 38, 40, 31, 40, 40, 40, 31, 40, 34, 40, 40, 31, 34, 32, 39, 36, 39, 31, 36, 36, 33, 41, 28, 37, 32]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EEGGEEHE@8JJJIJIIJJJJJIJJJJJJJIHIIHJJIJJJJJJJIJJJJJIHIIGEJJJJJHHHHHFFFFFBCC'), ('UQ', 0)]
C0FJ4ACXX120306:7:1306:5189:150683 83 6 140453062 60 76M 6 140452961 76 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [35, 31, 31, 33, 34, 35, 29, 40, 36, 27, 34, 40, 41, 32, 33, 40, 41, 31, 41, 34, 34, 33, 31, 34, 39, 39, 33, 33, 39, 41, 36, 40, 31, 41, 33, 32, 41, 34, 36, 36, 34, 40, 34, 33, 31, 40, 34, 39, 31, 34, 37, 38, 38, 32, 39, 39, 40, 31, 39, 33, 40, 41, 31, 33, 32, 39, 35, 39, 32, 35, 35, 32, 38, 32, 37, 31]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '==:HG@7HC78FIGFHF;JJIIHGHGIHFIJIHJIHIIEJIIJIGIIIIJIIG@HFCAGIJJIHHHHHFFFDD@@@'), ('UQ', 0)]
D0MUKACXX120302:8:1104:17662:43353 83 6 140453062 60 76M 6 140453007 76 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [39, 31, 41, 35, 30, 33, 35, 40, 36, 29, 29, 41, 41, 32, 33, 41, 41, 32, 41, 34, 34, 34, 32, 34, 38, 40, 32, 33, 40, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 36, 34, 41, 34, 34, 33, 41, 34, 40, 32, 34, 39, 39, 39, 31, 40, 40, 39, 32, 41, 33, 40, 40, 31, 33, 31, 39, 35, 40, 31, 36, 36, 33, 40, 31, 38, 32]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C>CGCA@DC=7JIIHIIGJJJJJJJJJJJJJJJJJIJJJJJJJJJJIJJJJJHFJIGFJIJJJHHHHHFFFFF@CC'), ('UQ', 0)]
C0FJ4ACXX120306:8:1102:20976:38233 163 6 140453063 60 68M8S 6 140453181 68 TCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTT array('B', [23, 36, 31, 32, 29, 29, 35, 32, 30, 28, 31, 11, 29, 30, 27, 25, 20, 36, 31, 37, 29, 35, 30, 27, 28, 23, 23, 35, 26, 27, 40, 32, 27, 33, 35, 37, 34, 35, 30, 26, 34, 27, 34, 29, 22, 35, 36, 32, 31, 39, 18, 34, 34, 37, 39, 9, 34, 28, 36, 34, 27, 32, 33, 33, 26, 33, 38, 2, 2, 2, 2, 2, 2, 2, 2, 2]) [('MD', '68'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDBDAH??+<C::2CEC;FD:<34A99CA7EHG??:D?9B:0B?DEB3BFFF(B7==7==;;E@#########'), ('UQ', 0)]
D0MUKACXX120302:7:2107:9365:181919 99 6 140453063 60 76M 6 140453119 76 TCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTG array('B', [31, 36, 34, 32, 30, 31, 30, 35, 30, 30, 36, 38, 33, 27, 36, 36, 31, 37, 32, 35, 35, 35, 29, 33, 37, 33, 32, 39, 35, 33, 40, 33, 38, 33, 35, 37, 36, 40, 32, 34, 39, 34, 34, 34, 35, 33, 39, 33, 32, 40, 32, 34, 33, 37, 30, 38, 35, 37, 36, 39, 38, 28, 29, 38, 25, 31, 39, 33, 30, 34, 33, 39, 34, 39, 35, 34]) [('MD', '76'), ('PG', 'bwa.7'), ('RG', 'D0MUK.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@DDD;BFFDDD>FE>BGGGG??FGIHEIGIIGGGIIIIGIBBBDDFGG>BFF;DCFGGF7;C;>DEAEHHHHF>'), ('UQ', 0)]
D0N3RACXX120302:5:2305:12454:137469 83 6 140453063 60 5S71M 6 140452998 71 CAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCCCTCCATCGAGATTT array('B', [2, 2, 2, 2, 2, 2, 35, 31, 30, 32, 30, 28, 12, 21, 20, 32, 30, 14, 12, 33, 38, 32, 38, 31, 30, 29, 26, 21, 30, 31, 29, 34, 33, 39, 36, 36, 30, 38, 27, 28, 11, 31, 13, 10, 27, 13, 8, 17, 18, 35, 27, 38, 30, 32, 35, 34, 28, 17, 23, 20, 2, 23, 34, 19, 22, 34, 28, 28, 25, 31, 33, 37, 30, 32, 31, 28]) [('MD', '56A14'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '######AA@>;7).)?7))ADC@@;=7.87@EAEEBBB=9)B**9**00??DBED?0):8);A28AA=;>DDD???'), ('UQ', 23)]
D0MUKACXX120302:8:2101:2243:31893 163 6 140453064 60 76M 6 140453103 76 CAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGT array('B', [23, 34, 35, 30, 29, 31, 32, 29, 28, 35, 34, 30, 28, 33, 37, 32, 37, 32, 35, 34, 35, 31, 40, 40, 33, 30, 38, 37, 33, 40, 33, 37, 32, 34, 37, 36, 40, 29, 30, 38, 34, 31, 35, 37, 36, 40, 32, 31, 41, 38, 37, 34, 31, 37, 37, 32, 37, 35, 40, 37, 33, 31, 37, 31, 34, 39, 34, 30, 33, 33, 35, 33, 38, 36, 39, 32]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFAEDBFB>DDGIEEFCGGIJGIGGIIIIB@GHIBFCH>GEHGDFHCBH;DDECFHGGE@@@DCAEHAEEEEE'), ('UQ', 0)]
D0N3RACXX120302:3:2302:5103:52147 163 6 140453064 60 76M 6 140453178 76 CAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGT array('B', [23, 34, 35, 30, 30, 35, 33, 30, 29, 33, 34, 31, 31, 37, 36, 32, 38, 32, 34, 35, 35, 29, 37, 33, 33, 31, 38, 36, 32, 34, 31, 37, 33, 36, 34, 35, 34, 32, 34, 37, 34, 35, 36, 39, 36, 38, 31, 31, 37, 37, 38, 33, 37, 37, 37, 33, 37, 35, 40, 38, 34, 32, 40, 31, 34, 40, 33, 31, 32, 32, 38, 32, 38, 36, 36, 31]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@FFFFFHFBFHGIJJIGGIGIGJGIGGGIGIIEGGJJGGIGJJIEHIIHIGGFGGIJJJJJJJJGIHHFFEFC@'), ('UQ', 0)]
D0N3RACXX120302:3:2203:16959:165674 1107 6 140453064 60 2S74M 6 140452961 74 CTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACT array('B', [2, 2, 2, 31, 21, 29, 25, 27, 36, 26, 21, 25, 36, 31, 16, 29, 33, 30, 33, 34, 33, 32, 32, 32, 37, 40, 31, 28, 31, 33, 35, 36, 30, 32, 31, 34, 38, 34, 37, 32, 33, 38, 31, 33, 32, 34, 34, 36, 24, 32, 36, 35, 36, 28, 36, 31, 35, 29, 37, 34, 36, 35, 32, 33, 29, 37, 35, 38, 32, 36, 31, 29, 33, 32, 32, 31]) [('MD', '74'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###@7=;;C=/?F@.ADCCJIHGCHHG?ECHEHEGBIIG@IIGHEGGG?GGEG@HEFFIIHHJHHGHHEFDDD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2205:17332:54473 163 6 140453066 60 76M 6 140453123 76 ATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAG array('B', [23, 30, 26, 36, 32, 29, 29, 35, 35, 31, 29, 38, 37, 32, 37, 33, 35, 35, 35, 31, 40, 39, 32, 31, 38, 38, 33, 39, 33, 37, 35, 34, 36, 35, 41, 27, 30, 34, 32, 33, 35, 30, 36, 39, 32, 30, 39, 37, 36, 33, 37, 36, 37, 34, 38, 35, 40, 38, 34, 32, 40, 32, 34, 42, 32, 31, 32, 33, 40, 33, 37, 36, 41, 32, 31, 36]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDFFFGFFHHGIJJJIGHIGIGIHGHGCGGIIECFGGH>GHFFHGCCDEHIGGIJFGIJJI=EHIGHFHFCH?'), ('UQ', 0)]
D0N3RACXX120302:7:2304:12571:141374 147 6 140453066 60 76M 6 140453001 76 ATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAG array('B', [32, 35, 34, 39, 35, 31, 29, 41, 42, 32, 34, 41, 41, 33, 41, 34, 35, 34, 32, 33, 39, 40, 33, 35, 40, 40, 36, 40, 31, 41, 32, 31, 41, 34, 39, 36, 34, 40, 33, 33, 32, 41, 34, 40, 32, 33, 38, 38, 40, 31, 40, 39, 38, 30, 40, 33, 39, 40, 31, 32, 31, 39, 35, 39, 31, 34, 33, 31, 38, 29, 39, 31, 35, 31, 34, 23]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHCGE=7JJJIJJIJJJJJIJJJIHGJJIIHGJJIJIIJJJJJJJJJJHHJIGBJJJJJJJJJHHHHHFEFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2302:10215:139491 163 6 140453067 60 76M 6 140453153 76 TTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGC array('B', [23, 31, 36, 33, 30, 29, 35, 36, 31, 29, 38, 36, 32, 37, 32, 35, 35, 34, 31, 39, 40, 33, 31, 38, 38, 33, 40, 33, 38, 32, 36, 39, 36, 39, 31, 33, 40, 34, 35, 35, 38, 36, 41, 33, 32, 40, 40, 38, 33, 38, 38, 38, 34, 39, 36, 40, 38, 34, 32, 40, 32, 35, 41, 31, 32, 33, 34, 41, 34, 37, 36, 40, 32, 31, 41, 37]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CC@FFFFFHGHGHJGIGGIIJIGGJIIJIGIJJFHJIIIGIJJJJJHFHIGIIJIJJJJJGJJ=GIIIHGGFHHHB'), ('UQ', 0)]
C0FJ4ACXX120306:4:2106:13055:193225 1171 6 140453068 60 76M 6 140452998 76 TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT array('B', [32, 38, 33, 24, 18, 40, 40, 33, 34, 41, 43, 33, 41, 33, 34, 34, 32, 33, 38, 40, 33, 34, 39, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 35, 33, 39, 33, 34, 32, 41, 34, 40, 32, 33, 39, 39, 39, 31, 40, 38, 39, 28, 40, 33, 40, 40, 32, 33, 32, 39, 35, 39, 31, 34, 34, 32, 39, 29, 37, 31, 34, 29, 33, 36, 36, 23]) [('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EC?7)FGGDJIHJJJJJIIIJIIIGHIJJIJJJIHGJIIJJJJIJJIIJHGDJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:7:1203:10375:150536 147 6 140453068 60 76M 6 140452998 76 TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT array('B', [30, 36, 34, 24, 18, 37, 41, 32, 34, 40, 39, 32, 41, 34, 34, 33, 32, 34, 39, 41, 32, 34, 40, 41, 36, 37, 32, 40, 33, 31, 40, 33, 39, 36, 34, 39, 34, 34, 32, 41, 34, 40, 32, 33, 38, 39, 41, 31, 40, 39, 39, 30, 41, 33, 39, 41, 31, 33, 32, 39, 35, 39, 30, 34, 34, 32, 39, 29, 38, 31, 34, 29, 33, 37, 38, 23]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=A?7.GGGFGGIIJJJJJJJJHJIHFIIIHIIJIGGJJJJJJIGJJJIJIGCJIJJJIJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:8:2307:5211:74086 1107 6 140453068 60 76M 6 140453045 76 TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT array('B', [33, 37, 36, 23, 19, 40, 41, 29, 35, 40, 41, 32, 40, 34, 32, 33, 32, 33, 36, 40, 32, 34, 38, 38, 37, 39, 31, 40, 31, 29, 41, 34, 39, 36, 34, 41, 32, 33, 31, 41, 33, 39, 31, 29, 38, 37, 36, 31, 39, 38, 39, 31, 40, 33, 38, 40, 30, 33, 31, 39, 35, 39, 32, 35, 35, 34, 41, 31, 41, 33, 36, 31, 34, 37, 38, 32]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AA?4)JHECGHHGGHEGDEIGGGBIHFCF<JGIIGHDIHHIHF>HG@?HGC<GCGHCIJIGJJHFHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:3:2104:15433:30528 147 6 140453068 60 76M 6 140453011 76 TCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT array('B', [30, 36, 35, 24, 30, 40, 41, 34, 34, 40, 41, 32, 40, 34, 34, 34, 31, 33, 37, 39, 33, 34, 41, 41, 36, 37, 31, 41, 30, 32, 39, 32, 38, 36, 33, 40, 33, 33, 32, 41, 34, 39, 32, 33, 38, 36, 38, 32, 40, 40, 39, 30, 34, 32, 40, 40, 31, 32, 31, 38, 35, 38, 31, 34, 34, 32, 38, 30, 37, 31, 34, 29, 33, 36, 37, 23]) [('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';??4=JJGHIIIIJIJIGIJIIJIHGGHDGGGJJIIJJJJIIJIJIHEIHF?JGJJIFJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:5:1201:8666:39990 83 6 140453068 60 76M 6 140453045 76 TCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCT array('B', [33, 36, 34, 15, 6, 39, 41, 31, 34, 41, 39, 32, 40, 33, 33, 34, 32, 33, 39, 40, 32, 33, 40, 41, 36, 40, 32, 41, 32, 31, 41, 33, 38, 36, 33, 40, 33, 33, 33, 41, 33, 40, 32, 34, 38, 39, 40, 31, 40, 38, 37, 31, 41, 34, 40, 40, 32, 33, 32, 39, 36, 40, 32, 35, 35, 33, 40, 31, 38, 33, 37, 31, 35, 38, 38, 32]) [('MD', '4A71'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'E?=)(IHCDIGHGJJJIGJIIIJJJIGIGGIGIIJIJJIJJJIJJJIGIHFEJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 6)]
C0FJ4ACXX120306:3:2301:8334:182439 99 6 140453069 60 76M 6 140453134 76 CTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTA array('B', [31, 34, 26, 30, 36, 38, 33, 31, 37, 38, 33, 38, 34, 34, 34, 35, 30, 40, 30, 33, 31, 38, 37, 33, 40, 32, 38, 33, 36, 38, 35, 40, 31, 30, 39, 33, 36, 35, 38, 36, 40, 34, 29, 40, 40, 40, 33, 38, 38, 39, 34, 39, 35, 38, 39, 34, 33, 40, 32, 34, 40, 33, 32, 32, 34, 39, 33, 39, 36, 40, 32, 31, 40, 37, 35, 30]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@?DDFFFDHGHGEHIEF>FBGGHGHIGIGEHCFIGGIIIGCDHIIIGGIGIDHIIIIIGIIEHGIIIHEEEHFDD'), ('UQ', 0)]
C0FH2ACXX120312:7:2208:18211:44140 1619 6 140453069 60 8S68M 6 140452995 68 CCTCAATTCTTCCCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGCCCCACTCCATCGAGATTTCAC array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 36, 35, 6, 31, 37, 30, 36, 12, 35, 32, 30, 32, 30, 33, 30, 30, 37, 36, 32, 34, 37, 36, 33, 32, 15, 39, 32, 31, 37, 31, 36, 35, 32, 36, 31, 32, 32, 38, 25, 32, 31, 32, 36, 37, 20, 4, 37, 30, 39, 31, 26, 23, 21, 28, 32, 33, 31, 36, 33, 35, 30, 34, 34, 32, 31, 30, 29]) [('MD', '3A42A21'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '#########C=(A@A@1AA:CAC=9DDD@DBD9*DDBB9?ADBDCDC3;DAEC1)F=FE:38:DDBDDABDDD<?<'), ('UQ', 10)]
D0N3RACXX120302:6:1203:10699:130634 147 6 140453069 60 76M 6 140452954 76 CTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTA array('B', [39, 31, 19, 21, 39, 41, 31, 34, 40, 41, 31, 41, 34, 34, 34, 33, 33, 39, 38, 32, 34, 40, 40, 35, 39, 31, 41, 33, 30, 39, 33, 39, 36, 33, 41, 33, 33, 32, 41, 33, 39, 32, 33, 38, 38, 41, 31, 39, 38, 38, 28, 40, 34, 39, 40, 30, 32, 31, 37, 34, 37, 31, 34, 34, 32, 37, 30, 38, 31, 35, 29, 33, 36, 38, 30, 23]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EA7)GHD@IHDIJJJJIIGJHIIHFEIGDGGJJIHIIIJIIJIJJHGHFG<HDJIGHIGIGJIHGGHHFFFFFCCC'), ('UQ', 0)]
C0FH2ACXX120312:7:2203:15923:122451 1187 6 140453071 60 76M 6 140453224 76 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA array('B', [23, 29, 36, 36, 31, 29, 35, 36, 31, 36, 31, 34, 35, 35, 30, 40, 39, 32, 31, 39, 38, 33, 41, 34, 37, 34, 36, 38, 36, 40, 30, 32, 40, 34, 36, 35, 38, 36, 41, 34, 31, 41, 40, 40, 33, 39, 39, 38, 33, 38, 35, 39, 38, 34, 32, 40, 32, 34, 40, 34, 32, 34, 34, 40, 34, 38, 37, 41, 33, 32, 42, 40, 35, 31, 40, 33]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHHIJJJJJJJIJIJJJIIGGIIIIIJIJJJJJGJJIIJIIJJJJJJJGJJJJJJJJHHHHHHHF'), ('UQ', 0)]
D0MUKACXX120302:5:2205:18195:186196 99 6 140453071 60 76M 6 140453166 76 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA array('B', [32, 30, 36, 38, 33, 32, 37, 37, 33, 38, 33, 35, 35, 35, 32, 41, 40, 33, 32, 39, 38, 33, 41, 34, 38, 33, 36, 38, 36, 40, 32, 33, 40, 33, 36, 36, 39, 36, 40, 33, 32, 40, 41, 40, 34, 39, 38, 38, 34, 38, 37, 40, 39, 33, 32, 40, 33, 34, 41, 33, 33, 33, 33, 40, 34, 39, 37, 41, 32, 32, 41, 39, 36, 31, 41, 33]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJIJJJJJIJJJJHHHHHHH>'), ('UQ', 0)]
D0N3RACXX120302:2:2302:4867:46185 99 6 140453071 60 76M 6 140453110 76 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA array('B', [32, 31, 37, 38, 32, 31, 37, 38, 32, 38, 33, 35, 36, 35, 30, 40, 40, 33, 32, 40, 37, 34, 41, 34, 38, 33, 35, 39, 37, 42, 32, 34, 40, 34, 36, 35, 39, 36, 38, 33, 32, 41, 40, 40, 33, 38, 39, 39, 33, 39, 37, 40, 39, 33, 31, 40, 32, 34, 41, 34, 33, 34, 33, 41, 34, 40, 38, 42, 32, 32, 41, 39, 37, 31, 41, 34]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIHIJJJJIJJIIJJJJJIJJJJJJIGHIJJJIJJJJJJJJJIIJJJJJJJJJJJJHFHHHHHC'), ('UQ', 0)]
D0N3RACXX120302:2:2303:12308:118148 163 6 140453071 60 76M 6 140453224 76 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA array('B', [23, 31, 36, 36, 31, 29, 36, 36, 31, 36, 31, 34, 34, 34, 31, 40, 39, 33, 31, 39, 37, 33, 40, 33, 38, 33, 35, 38, 36, 41, 32, 33, 40, 33, 35, 36, 39, 36, 41, 34, 31, 40, 40, 40, 34, 39, 39, 38, 34, 39, 36, 40, 39, 33, 32, 39, 32, 34, 40, 35, 32, 34, 34, 40, 34, 39, 37, 41, 32, 31, 40, 39, 35, 31, 40, 33]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJIJIJEHIJJJJJJGIJJJJJJJHHHHHHHF'), ('UQ', 0)]
D0N3RACXX120302:4:1206:18391:166630 1699 6 140453071 60 70M6S 6 140453224 70 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGGTGGGACCCCCTCCATCGAGATTTCACTGTAGCTAGA array('B', [23, 31, 33, 12, 25, 18, 31, 12, 20, 32, 31, 34, 27, 27, 23, 36, 22, 30, 20, 33, 36, 30, 32, 19, 11, 10, 9, 24, 35, 33, 19, 9, 14, 23, 33, 33, 36, 23, 30, 7, 22, 29, 28, 29, 25, 34, 33, 33, 10, 19, 34, 26, 29, 32, 12, 31, 13, 27, 33, 10, 26, 29, 26, 31, 24, 34, 35, 35, 33, 2, 2, 2, 2, 2, 2, 2]) [('MD', '39A8A21'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '=@?+:2A+2AFF;<<C9<3AF@E3+++<E?1**1CBD3?*0??A?@?;(-7-;@)8-7@(57.77=?@?#######'), ('UQ', 17)]
C0FJ4ACXX120306:3:2308:11562:195428 83 6 140453071 60 76M 6 140453038 76 TACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGA array('B', [30, 31, 35, 40, 32, 35, 40, 41, 32, 41, 33, 34, 33, 32, 33, 37, 40, 32, 33, 40, 41, 37, 40, 32, 41, 34, 32, 41, 37, 38, 36, 34, 40, 34, 34, 32, 42, 34, 39, 32, 33, 39, 39, 39, 31, 41, 39, 40, 33, 40, 33, 40, 41, 31, 33, 31, 40, 36, 40, 32, 35, 35, 33, 40, 31, 41, 33, 38, 31, 35, 38, 40, 32, 35, 37, 32]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EAEIIGIHFJJJJIGGJIGJJJIIJIHHCJGHIIJJJJIIIJIHHIHF@IGJJJJJJJIJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1203:17036:61731 99 6 140453072 60 76M 6 140453207 76 ACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGAC array('B', [32, 36, 37, 33, 31, 37, 38, 32, 38, 33, 35, 35, 35, 31, 40, 40, 33, 32, 40, 38, 33, 41, 33, 39, 33, 36, 40, 36, 41, 32, 33, 41, 34, 36, 35, 39, 35, 41, 34, 33, 41, 40, 40, 34, 39, 39, 39, 33, 39, 37, 41, 38, 34, 32, 40, 32, 34, 41, 34, 32, 34, 34, 41, 34, 40, 36, 41, 33, 30, 40, 38, 36, 32, 39, 33, 36]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJIJJJJJJJJJJJIJJJJIJJJJJJJIIJJJJJIJJJJJIJJJIIGFEHFEFB'), ('UQ', 0)]
C0FJ4ACXX120306:4:2102:11733:148978 147 6 140453072 60 2S74M 6 140453000 74 TTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAG array('B', [2, 2, 2, 33, 39, 31, 28, 29, 37, 31, 31, 34, 33, 32, 33, 24, 38, 37, 32, 33, 28, 32, 34, 30, 30, 35, 30, 18, 34, 13, 35, 25, 28, 39, 34, 31, 31, 33, 27, 35, 31, 32, 31, 34, 39, 32, 39, 39, 39, 30, 38, 33, 29, 36, 29, 28, 23, 35, 35, 39, 29, 35, 28, 32, 34, 30, 32, 30, 17, 28, 33, 36, 32, 27, 33, 23]) [('MD', '74'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###@G@7;@8;GGBB3FDF?;>B<???0B*B9:GGBD?9@FF?@GGIHGEGF?DCA?EIHEG>FBH==3EDD?<B@'), ('UQ', 0)]
C0FJ4ACXX120306:6:1108:9868:95295 99 6 140453073 60 76M 6 140453134 76 CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTGACTGTAGCTAGACC array('B', [31, 35, 34, 31, 37, 37, 33, 36, 33, 35, 35, 35, 32, 39, 37, 34, 32, 39, 37, 35, 39, 34, 37, 34, 36, 36, 35, 39, 31, 33, 37, 34, 36, 36, 38, 35, 39, 32, 31, 41, 30, 37, 34, 37, 38, 38, 35, 37, 36, 35, 38, 34, 33, 39, 32, 35, 39, 34, 33, 33, 34, 35, 33, 38, 35, 39, 32, 31, 41, 38, 36, 32, 38, 32, 34, 34]) [('MD', '61C14'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFFHGHHHGGIIJJJJDHIJIGIHGGIIJIEG>DC>DHIJIIJGAGIIIGIJEGGI;DHEGDHGGGHHFED'), ('UQ', 35)]
C0FJ4ACXX120306:7:1306:11314:126944 147 6 140453073 60 76M 6 140453002 76 CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC array('B', [40, 41, 32, 33, 38, 41, 33, 40, 33, 34, 34, 32, 34, 39, 41, 32, 33, 40, 41, 36, 38, 32, 41, 33, 32, 40, 33, 38, 36, 34, 40, 33, 33, 32, 39, 33, 39, 32, 33, 39, 38, 39, 30, 38, 38, 39, 33, 40, 33, 39, 40, 31, 33, 32, 37, 35, 38, 32, 35, 35, 32, 40, 31, 39, 31, 37, 29, 33, 36, 37, 28, 33, 35, 31, 36, 23]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HFIGGHGIGJJIIJJIGJJIGHHHGFIIIIJIIIIIIHGHHHAGGFBIGIIGIIEGHHGIIHFHHHHHFEDDD@C@'), ('UQ', 0)]
D0MUKACXX120302:8:1106:3148:189526 83 6 140453074 60 9S67M 6 140452966 67 AATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTA array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 33, 36, 41, 39, 33, 41, 31, 33, 33, 32, 34, 39, 37, 30, 34, 37, 40, 35, 37, 31, 40, 34, 31, 39, 30, 38, 34, 34, 39, 32, 30, 30, 31, 24, 38, 30, 33, 36, 38, 36, 30, 38, 33, 38, 28, 37, 33, 39, 39, 28, 32, 30, 29, 34, 36, 31, 35, 35, 31, 37, 31, 40, 33, 34, 30, 31]) [('MD', '67'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '##########E@FBBCAGHBGHFDGEGD??GGHG>GEIEEFD:3EFECF@?G@EAEIHGC@E9FDHHHDBBFF@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2105:20561:16760 83 6 140453075 60 76M 6 140453005 76 ATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAA array('B', [29, 34, 40, 40, 32, 42, 33, 34, 33, 32, 33, 38, 40, 32, 34, 41, 41, 36, 40, 32, 41, 34, 32, 41, 34, 39, 36, 34, 40, 33, 33, 32, 40, 34, 40, 32, 33, 38, 38, 40, 31, 41, 40, 40, 31, 41, 33, 40, 41, 32, 34, 32, 40, 36, 40, 31, 36, 35, 33, 40, 31, 40, 33, 38, 31, 36, 39, 41, 31, 35, 37, 31, 39, 40, 29, 32]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EJHHJIJGJIJJIJJJJIHJJJJIJJIGIIIJJJJIJIHHJIHHIGJJIIJJJJJJJJHGJIHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:8:1202:14511:169975 147 6 140453075 60 2S74M 6 140452942 74 CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC array('B', [2, 2, 2, 34, 35, 28, 32, 40, 31, 33, 33, 31, 32, 35, 25, 32, 29, 39, 40, 36, 37, 32, 39, 33, 30, 39, 33, 36, 34, 24, 35, 30, 33, 32, 41, 32, 36, 33, 32, 37, 37, 36, 27, 39, 39, 40, 32, 41, 23, 37, 40, 32, 33, 30, 37, 36, 38, 31, 35, 34, 33, 38, 31, 39, 32, 36, 20, 32, 36, 38, 21, 33, 35, 31, 34, 23]) [('MD', '74'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '###E@7=IHGGCF=3=<GCHFHCGDBEFB4?FCIFBGF@GGE8IHFCH3GHHFGGJIGHGFGFFFC8ADD<DD?BB'), ('UQ', 0)]
D0N3RACXX120302:2:1202:12151:149316 147 6 140453075 60 76M 6 140452988 76 ATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAA array('B', [31, 32, 39, 40, 32, 40, 34, 35, 34, 33, 34, 39, 40, 33, 34, 39, 41, 36, 40, 32, 40, 32, 32, 41, 33, 39, 35, 33, 40, 34, 34, 32, 41, 33, 39, 33, 33, 38, 38, 39, 31, 39, 39, 39, 30, 40, 33, 40, 40, 32, 33, 31, 40, 35, 40, 31, 35, 35, 33, 39, 31, 39, 32, 37, 29, 34, 37, 38, 29, 33, 36, 30, 37, 37, 31, 23]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'FEIHGIJJJJJJJJJJJJJJIHFHHDHHIJJJJJJJIJJIHJIGFJJJJJJJJIIJJJJIIJIHHHHHFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:1:2107:21310:100685 1171 6 140453076 60 3S73M 6 140452942 73 CCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACC array('B', [2, 2, 2, 2, 33, 36, 32, 39, 33, 32, 33, 33, 34, 39, 38, 31, 29, 23, 39, 36, 38, 31, 35, 32, 32, 39, 33, 34, 34, 34, 38, 31, 32, 31, 38, 33, 35, 30, 33, 36, 36, 37, 32, 31, 29, 39, 30, 35, 30, 24, 40, 31, 27, 31, 37, 34, 38, 26, 35, 34, 31, 39, 30, 39, 32, 36, 29, 31, 36, 38, 29, 33, 35, 30, 33, 23]) [('MD', '73'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '####AACFGDGHHHFB<<GHBBAHHEGFB@DDBGFHCCIGFC?B@FABA<IF>GEGHAJIGJIHHHHDFFFFDBBB'), ('UQ', 0)]
D0MUKACXX120302:6:2208:11072:169724 163 6 140453077 60 76M 6 140453153 76 CCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAA array('B', [23, 34, 34, 34, 30, 33, 34, 32, 27, 38, 38, 32, 31, 38, 35, 31, 37, 32, 36, 33, 36, 37, 34, 38, 32, 31, 38, 33, 35, 34, 37, 35, 39, 33, 32, 40, 34, 38, 32, 37, 37, 36, 33, 34, 36, 40, 38, 32, 29, 37, 31, 33, 38, 32, 31, 33, 32, 38, 31, 34, 35, 37, 30, 31, 37, 36, 35, 31, 33, 33, 38, 39, 33, 36, 36, 35]) [('MD', '76'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<@@DDFFDDHHHHIGDGGIICHGGCEHIGDHHH@GHBGEIIGIJIJJG<GDDDAGGECA@F@8CEEDE>EHHEEHD'), ('UQ', 0)]
D0N3RACXX120302:8:1207:6714:98330 1187 6 140453077 60 76M 6 140453155 76 CCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCAACTCCATCGAGATTTCACTGTAGCTAGACCAAAA array('B', [23, 32, 31, 35, 30, 32, 32, 30, 28, 35, 37, 34, 30, 37, 36, 32, 37, 32, 37, 32, 35, 36, 34, 11, 29, 21, 38, 33, 35, 35, 37, 36, 39, 33, 31, 38, 39, 23, 30, 34, 34, 11, 32, 29, 29, 37, 39, 33, 32, 39, 21, 32, 13, 10, 25, 11, 28, 33, 21, 35, 35, 33, 30, 32, 39, 39, 35, 30, 38, 35, 35, 34, 33, 35, 34, 35]) [('MD', '41C34'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?=?DDDDBDBCCFGGIEGIGEBC+A4FFHIEGGGGEG9?@@)?89BFHGG6;((-)8<4=@==CCHHCE@AA?EEE'), ('UQ', 11)]
C0FJ4ACXX120306:1:2303:10726:22006 163 6 140453078 60 76M 6 140453144 76 CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT array('B', [23, 34, 36, 32, 33, 33, 34, 30, 38, 38, 31, 31, 38, 37, 32, 40, 32, 38, 33, 35, 38, 35, 40, 31, 33, 40, 33, 36, 35, 39, 37, 40, 33, 31, 40, 40, 40, 34, 39, 38, 38, 34, 39, 36, 40, 38, 34, 32, 40, 32, 34, 40, 33, 32, 32, 33, 40, 34, 39, 37, 42, 32, 31, 42, 40, 36, 31, 42, 35, 40, 38, 34, 36, 36, 36, 32]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@CFFFFFHHGHHJJJJIJJJJJIJHIJJJJIJIIJJJJJJJJJJJJJJJHIJJIIJJJJJIJJJJJJJIHHHFHE'), ('UQ', 0)]
C0FJ4ACXX120306:4:2105:6959:13520 1187 6 140453078 60 76M 6 140453144 76 CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT array('B', [23, 30, 33, 30, 33, 32, 32, 20, 36, 35, 29, 28, 35, 36, 32, 35, 31, 35, 26, 33, 35, 34, 39, 26, 23, 34, 29, 35, 32, 36, 35, 40, 27, 20, 31, 39, 39, 28, 33, 37, 8, 25, 33, 31, 34, 37, 34, 29, 37, 30, 34, 39, 34, 31, 32, 33, 38, 32, 38, 35, 38, 30, 32, 39, 36, 36, 32, 41, 34, 38, 36, 34, 36, 35, 30, 25]) [('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=;=DBDD=CD?<ACEEDBADEBG:<AAFACFH94?HH;?F)8?;?FFDDBFFHI@CFGHGD=CG@EDHIG??EE;7'), ('UQ', 0)]
C0FJ4ACXX120306:4:1204:20238:3059 595 6 140453078 60 13S63M 6 140452941 63 AATTCTTACCATCCACAAAATGGATCCAGACAACCGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTA array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 32, 40, 33, 33, 33, 32, 25, 37, 37, 25, 34, 36, 38, 35, 38, 32, 30, 10, 19, 16, 6, 34, 28, 32, 39, 27, 21, 31, 34, 31, 39, 28, 32, 37, 29, 38, 32, 9, 36, 30, 25, 24, 11, 32, 37, 32, 32, 30, 37, 35, 36, 29, 34, 34, 35, 33, 28, 37, 31, 33, 29, 15]) [('MD', '21T41'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '##############AECC@=3DBACDCED@8)80):9@D:1<A>E9?C=CC+C<33+DEEEBEDDDDD===DB??1'), ('UQ', 6)]
C0FJ4ACXX120306:8:1308:3301:106883 147 6 140453078 60 76M 6 140452997 76 CACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAT array('B', [39, 32, 39, 33, 32, 31, 32, 27, 31, 39, 33, 34, 39, 39, 35, 39, 32, 40, 33, 29, 38, 34, 35, 28, 26, 37, 31, 31, 31, 39, 33, 36, 28, 32, 38, 37, 26, 20, 39, 32, 35, 18, 40, 22, 37, 40, 26, 33, 30, 39, 34, 39, 31, 36, 33, 32, 34, 20, 39, 28, 36, 29, 34, 36, 38, 27, 33, 34, 29, 37, 37, 29, 30, 27, 30, 23]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHEEAD@7;GF@GGGEIF=8GFB8<??D?GGD>GHD?1C??1C3EC9@GHFHGHBFA3C<GGIFDAHADDDD?;<B'), ('UQ', 0)]
C0FJ4ACXX120306:2:1106:14202:137461 163 6 140453079 60 76M 6 140453110 76 ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC array('B', [23, 34, 33, 34, 33, 33, 29, 39, 38, 32, 30, 37, 36, 32, 39, 33, 37, 32, 29, 37, 36, 40, 31, 32, 36, 33, 35, 35, 38, 37, 40, 34, 31, 40, 40, 41, 34, 38, 38, 38, 34, 38, 36, 39, 37, 33, 32, 39, 32, 33, 41, 34, 32, 33, 33, 40, 34, 38, 37, 41, 32, 30, 41, 39, 35, 31, 41, 33, 39, 38, 34, 36, 36, 35, 32, 38]) [('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFFFFHHHHHJJJJGIJJJHHGIJJJIIIIIJJJJJJJJJJJJIIJJHHIJJJJJJJHIJIIJIIJJIHHHHF'), ('UQ', 0)]
D0MUKACXX120302:5:1301:19119:190492 1187 6 140453079 60 76M 6 140453172 76 ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC array('B', [23, 35, 34, 34, 35, 32, 29, 38, 27, 32, 30, 37, 32, 32, 38, 32, 27, 32, 34, 38, 32, 36, 31, 31, 35, 33, 34, 35, 34, 33, 38, 29, 30, 34, 31, 32, 32, 33, 36, 29, 33, 36, 34, 39, 38, 34, 33, 37, 31, 34, 41, 33, 32, 32, 30, 35, 33, 38, 35, 32, 34, 26, 31, 36, 35, 27, 35, 32, 38, 39, 33, 35, 36, 32, 28, 38]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@FFDDF?HHG>CGB=BEH@BHHBHGG@BC<???@F?D;BFDGGGHDFHFEHBDAHGE=@78@F;==DHGEH?>C'), ('UQ', 0)]
D0MUKACXX120302:8:2103:19332:163957 1187 6 140453079 60 76M 6 140453110 76 ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC array('B', [23, 35, 33, 34, 34, 33, 29, 38, 38, 31, 30, 38, 37, 32, 39, 32, 38, 33, 34, 39, 36, 40, 31, 34, 40, 32, 35, 35, 39, 36, 39, 32, 31, 41, 40, 40, 33, 39, 37, 38, 32, 39, 35, 41, 38, 33, 32, 38, 33, 33, 41, 33, 30, 32, 33, 40, 33, 40, 37, 41, 32, 26, 39, 38, 36, 31, 39, 33, 38, 38, 33, 37, 36, 37, 32, 36]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFDEHGHHHJJIJJJJJJJJJIJJJJEGIJJJJJGIIJJJJJJGJJHIEHIJJJJJJ;CFGIGGIIIHHHHB'), ('UQ', 0)]
D0N3RACXX120302:1:2207:6561:39985 163 6 140453079 60 76M 6 140453172 76 ACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATC array('B', [23, 33, 31, 34, 34, 34, 29, 37, 38, 31, 30, 38, 37, 32, 39, 32, 38, 32, 34, 38, 35, 40, 32, 32, 40, 33, 35, 35, 39, 36, 40, 33, 32, 40, 39, 39, 34, 39, 39, 39, 28, 37, 36, 39, 38, 33, 33, 40, 31, 33, 37, 34, 32, 33, 34, 40, 34, 39, 36, 41, 32, 31, 41, 40, 36, 31, 42, 34, 40, 39, 33, 36, 35, 36, 31, 37]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@BFFFFFHFHHHJFHIIIJJJGIJJJJJJJGGIJIHJJJ;GHGIJJIIJECGIIJJJJJHIJJJJJFIJJHHEHF'), ('UQ', 0)]
C0FH2ACXX120312:7:1206:4181:158777 99 6 140453081 60 76M 6 140453143 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [32, 34, 35, 36, 31, 40, 38, 33, 31, 38, 37, 33, 41, 33, 38, 33, 36, 38, 36, 41, 32, 33, 40, 34, 36, 36, 39, 35, 41, 32, 32, 40, 41, 40, 33, 38, 38, 37, 33, 38, 36, 40, 36, 34, 31, 39, 32, 34, 40, 34, 32, 34, 34, 40, 34, 39, 36, 41, 33, 31, 41, 39, 36, 31, 41, 34, 38, 39, 34, 37, 37, 35, 32, 39, 33, 36]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'BCCFFFFFHHHHHJJJJJJJJJJJJJJIJFIEIJGGCGHIIIEIIIJJIJJJIIIJJJJJJIJJJJGIIIFHHHFD'), ('UQ', 0)]
C0FJ4ACXX120306:1:1206:11701:42451 163 6 140453081 60 76M 6 140453118 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [23, 35, 35, 34, 29, 38, 37, 30, 28, 38, 36, 32, 38, 32, 37, 33, 34, 38, 35, 41, 31, 33, 40, 33, 35, 35, 39, 36, 41, 33, 31, 42, 36, 39, 33, 39, 39, 38, 34, 39, 36, 40, 38, 34, 32, 39, 32, 33, 41, 34, 32, 33, 33, 40, 32, 39, 36, 41, 30, 31, 40, 39, 36, 31, 41, 34, 39, 38, 35, 37, 36, 36, 33, 39, 34, 37]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFDDHHHGJJJIHIIJJJJJJIJIEEHGIJJJJJJJJJJJIJJJIHIJJIIJIHIGIJJJJJIJJHGHEHF'), ('UQ', 0)]
D0N3RACXX120302:5:2107:2516:43946 1187 6 140453081 60 76M 6 140453124 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [22, 29, 25, 24, 28, 37, 24, 29, 28, 34, 37, 32, 38, 32, 38, 33, 34, 37, 35, 40, 31, 33, 31, 32, 33, 33, 37, 30, 38, 30, 32, 42, 39, 38, 33, 38, 37, 36, 32, 33, 34, 39, 37, 26, 28, 30, 30, 32, 38, 33, 32, 31, 32, 37, 34, 36, 36, 40, 22, 24, 38, 38, 32, 33, 34, 33, 38, 34, 27, 37, 33, 33, 29, 38, 32, 34]) [('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<<8:DD;;DFHHFHHIGIJJJJ>ECBB<AABFHGGIGEB@@DF999DAEGFDHGI@GI47@F>@ADD=7C=?=E>@'), ('UQ', 0)]
D0MUKACXX120302:4:1208:5178:187313 1171 6 140453081 60 76M 6 140452960 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [33, 32, 35, 33, 32, 39, 41, 33, 33, 33, 40, 36, 40, 32, 40, 32, 32, 38, 33, 39, 35, 34, 41, 34, 34, 31, 40, 32, 40, 30, 33, 38, 37, 39, 31, 40, 39, 41, 31, 39, 35, 41, 41, 32, 33, 31, 36, 36, 40, 32, 35, 35, 33, 40, 31, 40, 32, 37, 29, 35, 38, 39, 29, 34, 38, 30, 37, 38, 29, 29, 29, 29, 31, 37, 31, 23]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHJIGHHHA@IGIGHFCGDIJIJIIJIHHCHIGIIJIHGGCJJIHGDJJJIIFIIIJIGGJJIGHHFHFFFDD@@B'), ('UQ', 0)]
D0MUKACXX120302:5:2301:10869:3400 147 6 140453081 60 76M 6 140452960 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [32, 32, 34, 32, 33, 39, 39, 33, 34, 40, 39, 36, 41, 32, 41, 33, 31, 41, 34, 38, 36, 34, 39, 32, 33, 31, 39, 35, 38, 32, 33, 38, 38, 38, 30, 41, 40, 40, 31, 41, 34, 41, 40, 32, 34, 32, 40, 36, 40, 32, 36, 35, 32, 37, 32, 40, 32, 37, 30, 35, 38, 39, 30, 34, 38, 29, 37, 38, 30, 29, 29, 30, 32, 37, 30, 23]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'FHIHEIIGHHEIIHHGGJHJHHGHGIG@GJJIGG@JIIFJIJJJJJJIJJJJIGHJJIJJJJJHHFHHFFFFFBBB'), ('UQ', 0)]
D0N3RACXX120302:7:1307:10834:147529 659 6 140453081 60 76M 6 140453048 76 AAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCAC array('B', [33, 32, 31, 31, 27, 29, 38, 32, 30, 29, 40, 35, 38, 32, 39, 34, 33, 39, 34, 36, 33, 34, 37, 32, 32, 30, 40, 34, 33, 32, 32, 38, 38, 36, 26, 32, 40, 40, 31, 36, 33, 39, 40, 31, 27, 29, 34, 33, 40, 30, 35, 35, 33, 36, 30, 39, 32, 37, 28, 33, 37, 34, 29, 33, 36, 30, 38, 37, 29, 28, 29, 30, 31, 36, 31, 23]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHD@77@@;<GFEFEGCGFF?GBAFDF?;H@HF?6=FDDB?EFC9A@EHIGGHBEGEGEFE@ADFFHGFDFFDB?@'), ('UQ', 0)]
C0FJ4ACXX120306:3:1207:3887:10798 1187 6 140453082 60 76M 6 140453141 76 AAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACC array('B', [23, 35, 31, 29, 39, 37, 32, 30, 37, 36, 31, 39, 33, 37, 32, 34, 38, 32, 39, 28, 31, 38, 32, 32, 35, 34, 32, 38, 32, 31, 41, 33, 29, 30, 37, 31, 38, 32, 36, 30, 37, 32, 31, 18, 33, 29, 32, 39, 31, 32, 27, 21, 36, 32, 36, 34, 41, 32, 30, 39, 38, 35, 33, 41, 34, 37, 36, 34, 36, 36, 34, 29, 39, 33, 36, 30]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@;DFFFFHHHDFHIGDCCAEHIHJEEHGICE@>EBCHA@B???B@GGDHA?DGFAHCEC@@FHGG@D@@A?CE@;'), ('UQ', 0)]
D0MUKACXX120302:4:1308:7450:196775 99 6 140453082 60 76M 6 140453141 76 AAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACC array('B', [30, 31, 36, 30, 40, 39, 33, 32, 39, 38, 33, 40, 33, 39, 33, 35, 38, 35, 40, 31, 34, 39, 34, 36, 36, 39, 36, 40, 34, 31, 40, 39, 39, 33, 39, 38, 38, 34, 39, 36, 39, 38, 34, 32, 40, 32, 34, 41, 34, 32, 34, 33, 41, 34, 39, 36, 41, 31, 31, 38, 40, 36, 30, 41, 34, 38, 37, 33, 36, 37, 37, 32, 38, 32, 38, 34]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@BCDFFFFHHHHHJJJJHJHJIJJJJGGIIIIIIJJIIJIIGIIIIJJIGIJIJJJJGIGIJGIGGEHIGHHGHHE'), ('UQ', 0)]
C0FJ4ACXX120306:5:1307:8654:23840 163 6 140453083 60 76M 6 140453191 76 AATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCT array('B', [23, 35, 30, 30, 14, 9, 30, 31, 36, 30, 37, 32, 35, 32, 34, 34, 34, 37, 27, 31, 34, 32, 33, 26, 37, 34, 40, 21, 29, 31, 27, 20, 26, 37, 37, 37, 32, 37, 34, 38, 35, 33, 25, 37, 31, 32, 40, 30, 29, 31, 31, 35, 32, 37, 35, 41, 32, 31, 40, 38, 35, 29, 40, 35, 35, 38, 34, 35, 35, 35, 30, 37, 33, 36, 37, 35]) [('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@71+B=FBFBDHHBGE?E@DE:CFF3?<<89EBFGE>GDA<DCDGBDF@?DFDF=FFGG=@FAFHGDC>EECEB'), ('UQ', 0)]
D0N3RACXX120302:2:1205:4517:131741 83 6 140453084 60 76M 6 140452993 76 ATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTA array('B', [31, 34, 38, 39, 32, 33, 40, 42, 38, 40, 32, 39, 34, 33, 41, 34, 39, 36, 34, 41, 34, 35, 32, 41, 34, 40, 32, 33, 39, 39, 38, 31, 40, 40, 40, 31, 40, 33, 39, 41, 32, 33, 31, 40, 37, 41, 32, 36, 36, 33, 40, 31, 41, 34, 38, 30, 36, 39, 40, 31, 36, 37, 31, 40, 40, 32, 32, 32, 31, 32, 38, 30, 39, 33, 28, 20]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHHIIIIJJIIGGGJJJJJJJJJJJJJIJJHHJIHFHGIJJIIJJJGJJJIHJJIIJJJIJHGHHHHHFEDAFBB;'), ('UQ', 0)]
D0N3RACXX120302:8:2201:1749:176613 83 6 140453084 60 76M 6 140453058 76 ATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTA array('B', [33, 33, 38, 40, 32, 35, 39, 41, 37, 40, 32, 41, 33, 32, 41, 34, 39, 36, 35, 40, 33, 34, 33, 42, 34, 41, 32, 34, 39, 38, 39, 32, 39, 39, 41, 32, 41, 33, 40, 42, 32, 34, 32, 40, 36, 40, 32, 35, 36, 34, 40, 31, 41, 33, 39, 31, 36, 40, 41, 31, 36, 39, 31, 40, 40, 32, 31, 32, 31, 33, 39, 30, 39, 39, 31, 32]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?HHJJJIJJIIIGFIIJJIIIJIJJJJJJJIGIIHGIIIJJJJIJJJJJJIHJJJJJJJJJJIHHHHHFFDBFC@B'), ('UQ', 0)]
D0MUKACXX120302:8:2304:7366:69876 659 6 140453087 60 76M 6 140453055 76 GATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTT array('B', [35, 23, 32, 40, 42, 36, 38, 33, 38, 28, 32, 37, 33, 33, 22, 31, 31, 33, 33, 31, 32, 28, 31, 32, 30, 30, 21, 38, 30, 38, 38, 37, 31, 37, 32, 34, 40, 29, 30, 30, 37, 36, 38, 32, 35, 30, 27, 36, 15, 40, 35, 36, 27, 35, 38, 40, 29, 35, 27, 31, 37, 40, 29, 31, 31, 28, 31, 38, 27, 29, 32, 28, 27, 28, 27, 23]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=3>GHC@=@;=@F=4=:GC==89?<92GDDDB:EDACD<CFIGHF<9A+FCF>HCIAI:GGHFC?A<CA??DB:8?'), ('UQ', 0)]
C0FJ4ACXX120306:6:1307:2148:51912 659 6 140453088 60 28S48M 6 140452993 48 GCCTCAATTCTTCCCATCCTCAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCA array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 30, 35, 28, 31, 22, 27, 18, 12, 19, 28, 30, 30, 23, 10, 10, 24, 28, 28, 16, 24, 24, 20, 22, 28, 18, 28, 30, 37, 37, 35, 16, 37, 33, 3, 34, 27, 31, 27, 11, 10, 22, 19, 11, 30, 31, 24, 20]) [('MD', '48'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 23), ('NM', 0), ('SM', 23), ('MQ', 60), ('OQ', '#############################GD<B0B001;D?1**?DC19222<2:FIGA2GC)?<D=,,22+A:11'), ('UQ', 0)]
D0N3RACXX120302:1:1107:19002:45996 147 6 140453088 60 76M 6 140453061 76 ATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTT array('B', [30, 34, 41, 41, 36, 41, 33, 41, 32, 33, 41, 33, 39, 36, 33, 39, 33, 31, 32, 41, 33, 40, 31, 34, 38, 38, 38, 32, 40, 40, 37, 32, 41, 34, 40, 40, 31, 35, 31, 40, 35, 40, 31, 36, 35, 33, 39, 27, 40, 31, 39, 31, 34, 38, 40, 30, 34, 36, 30, 36, 38, 32, 31, 30, 28, 32, 32, 27, 36, 37, 29, 29, 34, 35, 32, 23]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '>EJJJIIHF@IGIJIGIHFIIIGHGDGHIHD?JIJJIIIIGIIGGHF9IIIIGIIJIGIGIIHFDFA:DFFDFC@@'), ('UQ', 0)]
D0MUKACXX120302:5:2103:12861:42694 1123 6 140453089 60 76M 6 140453190 76 TCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTT array('B', [32, 37, 38, 33, 39, 34, 36, 32, 35, 38, 35, 40, 32, 33, 40, 34, 35, 35, 38, 36, 40, 33, 32, 40, 40, 40, 33, 38, 38, 38, 34, 38, 36, 40, 38, 33, 32, 40, 32, 33, 41, 33, 32, 33, 34, 40, 33, 39, 37, 40, 33, 31, 41, 40, 36, 31, 41, 34, 39, 38, 34, 36, 36, 36, 33, 40, 34, 39, 39, 37, 32, 33, 33, 33, 31, 33]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJIIIJIJJIJJJJJIJJJJJJJJJIJJJJIJJIJIJJJJJJJJIJJJJIJJJHFHGF?'), ('UQ', 0)]
D0N3RACXX120302:5:1105:17281:19920 99 6 140453089 60 76M 6 140453190 76 TCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTT array('B', [31, 37, 38, 33, 39, 34, 36, 33, 35, 38, 35, 40, 32, 34, 40, 33, 35, 36, 39, 36, 40, 33, 32, 41, 40, 40, 33, 39, 39, 39, 33, 39, 36, 40, 39, 34, 33, 40, 33, 34, 41, 33, 33, 33, 34, 40, 34, 40, 37, 41, 31, 31, 42, 40, 36, 31, 42, 34, 39, 39, 34, 36, 36, 36, 32, 41, 33, 39, 39, 36, 32, 33, 33, 31, 33, 32]) [('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJIJJJJJJJJJIJJJJJJJJJJJJJJJJJJJIJJJIJJJJJJJGJJJJJJJHHHHHA'), ('UQ', 0)]
C0FJ4ACXX120306:1:2303:15292:24105 83 6 140453090 60 76M 6 140453028 76 CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTA array('B', [31, 34, 36, 33, 32, 41, 33, 30, 25, 32, 38, 34, 21, 15, 32, 32, 32, 40, 34, 39, 33, 34, 38, 37, 33, 31, 38, 30, 40, 30, 37, 33, 40, 39, 32, 33, 31, 39, 34, 33, 32, 33, 31, 34, 40, 31, 40, 33, 38, 31, 36, 38, 37, 30, 35, 37, 31, 33, 36, 32, 30, 31, 30, 30, 38, 30, 36, 34, 29, 30, 29, 34, 33, 35, 31, 31]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=??;CG@@7:C=.)FC=IGHHGFB>FG=GFCGHEGG@HF<DD<GHHGIGIGHEHBEG@@GFEC>DDDAAB:BD@@?'), ('UQ', 0)]
D0N3RACXX120302:7:1205:20198:183692 83 6 140453091 60 76M 6 140452942 76 CAGACAACTGTTCAAACTGATGGGACCCTCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTAC array('B', [35, 34, 35, 32, 41, 34, 31, 41, 34, 38, 32, 35, 33, 31, 13, 32, 36, 32, 37, 31, 33, 39, 38, 39, 31, 31, 29, 23, 10, 39, 30, 19, 38, 29, 28, 33, 38, 35, 39, 27, 34, 33, 34, 39, 30, 36, 33, 35, 30, 35, 37, 38, 29, 32, 30, 29, 39, 34, 31, 32, 33, 31, 33, 31, 31, 39, 40, 28, 30, 33, 33, 33, 33, 31, 30, 31]) [('MD', '28A47'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '=AAIIGIIGC>C;=)=A@ECGIIHD@?0*D:6FC<DDGG>E?CEE@EAGHACF<<?GAEEIHD<FFFDDDDDD@@@'), ('UQ', 10)]
C0FJ4ACXX120306:7:1105:21087:61818 1187 6 140453092 60 74M2S 6 140453195 74 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGCTTTCACTGTAGCTAGACCAAAATCACCTATTTTTTCT array('B', [23, 38, 31, 31, 31, 30, 34, 33, 38, 28, 30, 37, 30, 33, 27, 35, 34, 37, 31, 27, 23, 38, 39, 22, 28, 38, 34, 29, 38, 36, 38, 39, 30, 26, 36, 15, 28, 33, 7, 12, 7, 7, 12, 17, 10, 21, 28, 31, 23, 12, 28, 35, 20, 11, 20, 29, 22, 32, 29, 35, 11, 28, 35, 29, 36, 39, 35, 29, 28, 31, 33, 33, 33, 2, 2, 2]) [('MD', '38A34A0'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '@@;=BADDH<CCDB<FEDDC9FH3<F@?HBGC?9?1:?))***0*09D9*9B4*.8.==F(==;DCD:=AHEH###'), ('UQ', 9)]
D0MUKACXX120302:5:2108:16989:35544 163 6 140453092 60 76M 6 140453126 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [23, 37, 34, 35, 31, 32, 35, 33, 37, 30, 30, 38, 31, 34, 34, 37, 35, 39, 33, 31, 38, 39, 41, 34, 38, 39, 38, 33, 38, 36, 39, 37, 31, 28, 38, 31, 32, 40, 35, 31, 32, 33, 34, 32, 38, 35, 41, 32, 30, 39, 37, 36, 30, 40, 34, 39, 38, 33, 36, 36, 35, 33, 38, 35, 37, 35, 37, 30, 33, 32, 34, 33, 32, 30, 39, 36]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'B@@FADDFGHHHFIJJJJIGGIJJIJJIIJIGD>GFFHCDEGBBGHHIIGEHGCHIIIGIGDDCGAEEGGIHHGHH'), ('UQ', 0)]
D0N3RACXX120302:4:2303:7656:133024 163 6 140453092 60 76M 6 140453195 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [23, 35, 34, 35, 31, 33, 34, 33, 37, 30, 29, 38, 32, 34, 34, 37, 35, 38, 32, 31, 37, 39, 37, 32, 37, 38, 38, 32, 38, 36, 40, 38, 33, 32, 37, 30, 32, 35, 33, 32, 33, 34, 36, 33, 37, 36, 34, 31, 31, 40, 38, 37, 31, 36, 33, 39, 38, 34, 36, 35, 35, 33, 40, 34, 38, 39, 36, 30, 32, 32, 33, 33, 33, 31, 39, 34]) [('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CC@FFFFFHHFHHIIIHIGIIJIDIIIIIJJJIIGHGGIJJJDIIJEIIHGIIGIHHJJJJJJJIJEEHIGHHHGG'), ('UQ', 0)]
C0FH2ACXX120312:7:2204:19338:186085 83 6 140453092 60 76M 6 140453032 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [35, 39, 32, 41, 33, 33, 42, 34, 38, 37, 34, 42, 32, 33, 32, 41, 34, 40, 32, 34, 39, 39, 40, 32, 40, 40, 38, 32, 40, 34, 39, 40, 32, 33, 32, 40, 36, 40, 32, 36, 36, 34, 41, 31, 41, 33, 39, 31, 35, 39, 40, 31, 36, 38, 29, 40, 41, 34, 33, 33, 31, 32, 38, 32, 40, 40, 30, 32, 36, 35, 34, 35, 29, 32, 35, 31]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHIGHIHHIGHHGGIJJIJIIIGIHGBIIIIGEJJJJIIIIHEJJJJIGHCGE=JJJJIIGGCHHGGFFDFD@@@'), ('UQ', 0)]
D0N3RACXX120302:1:1207:18604:193884 83 6 140453092 60 76M 6 140453010 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [35, 39, 33, 41, 31, 32, 38, 34, 39, 36, 35, 40, 34, 34, 33, 40, 33, 39, 33, 33, 38, 39, 39, 31, 39, 39, 40, 34, 39, 31, 36, 40, 32, 33, 31, 38, 35, 38, 30, 34, 35, 32, 40, 17, 41, 33, 39, 30, 37, 37, 37, 30, 36, 39, 31, 39, 39, 33, 33, 32, 30, 34, 37, 30, 38, 37, 28, 30, 36, 36, 33, 25, 28, 32, 35, 29]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=HGHC=GCIIIIIIIIIGIGIIHFHHFBF>EGHGIHHGC@EEC*IHIGIGGIIGHIIIIHECECFD?BFFDAD@@@'), ('UQ', 0)]
D0N3RACXX120302:3:1306:7934:46361 147 6 140453092 60 76M 6 140453017 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [37, 40, 32, 40, 32, 33, 40, 34, 39, 36, 34, 41, 34, 33, 32, 40, 33, 40, 32, 34, 39, 39, 39, 32, 36, 35, 35, 28, 40, 33, 40, 40, 32, 33, 31, 40, 36, 39, 31, 35, 35, 33, 38, 31, 39, 33, 39, 30, 36, 39, 40, 30, 36, 38, 30, 37, 39, 33, 33, 32, 30, 32, 37, 30, 37, 36, 29, 30, 34, 34, 34, 34, 30, 32, 33, 23]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHJJIHJIJJJJJIHJIJJJJJIHGDGBJIJJIJJJJIIJJJIGJJJJJJJIJHHIJJJIJJHFHHHHFFFFF@CB'), ('UQ', 0)]
D0N3RACXX120302:8:1107:11631:17787 147 6 140453092 60 76M 6 140452889 76 AGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACT array('B', [34, 38, 32, 42, 32, 32, 41, 33, 37, 35, 33, 42, 32, 33, 31, 37, 33, 40, 31, 34, 39, 37, 39, 33, 39, 37, 40, 31, 40, 34, 38, 40, 33, 34, 32, 39, 35, 39, 32, 36, 35, 33, 39, 30, 40, 33, 37, 29, 36, 39, 41, 30, 35, 35, 31, 39, 39, 33, 32, 31, 29, 32, 37, 30, 39, 38, 27, 28, 32, 32, 33, 32, 28, 31, 34, 23]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEHHEEGGGHAHEGHEIIGIIGIHFBHFFFIGFFIEGGHCIIHEIIGEJJJIHDHIIJIGF@GFHFDFDEEDD@?@'), ('UQ', 0)]
C0FH2ACXX120312:7:1104:13457:67578 163 6 140453093 60 76M 6 140453135 76 GACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTG array('B', [23, 33, 36, 31, 34, 33, 32, 35, 29, 30, 34, 31, 35, 34, 35, 35, 39, 32, 30, 38, 36, 37, 33, 35, 36, 37, 32, 38, 36, 40, 38, 33, 32, 40, 33, 33, 41, 34, 33, 34, 33, 38, 33, 38, 35, 39, 33, 31, 41, 40, 35, 30, 41, 34, 39, 38, 32, 36, 32, 35, 32, 38, 34, 38, 38, 36, 30, 31, 34, 33, 35, 33, 30, 38, 35, 35]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFDEDHHDFHIGIIGEGGGIDFHGIJJJIIJIIJIJJIGGHCFHHIJIIIJIHEGCGGEHIIIGIIJJHHGF?'), ('UQ', 0)]
D0N3RACXX120302:2:2306:20821:34699 99 6 140453093 60 76M 6 140453192 76 GACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCAGTGTAGCTAGACCAAAATCACCTATTTTTACTG array('B', [26, 33, 35, 31, 33, 35, 34, 40, 31, 32, 37, 32, 36, 34, 37, 35, 40, 33, 31, 40, 39, 39, 31, 35, 38, 37, 28, 37, 34, 33, 38, 33, 28, 37, 32, 33, 39, 27, 29, 32, 33, 38, 33, 12, 31, 31, 31, 26, 38, 39, 33, 31, 36, 30, 37, 38, 33, 36, 35, 27, 31, 38, 33, 38, 38, 37, 32, 31, 31, 33, 33, 28, 32, 28, 34, 2]) [('MD', '43C32'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?@@ADBDFFHDDHGIGIIIIIIEEEG?GH>GG@CBGH8BDHDC*??F?GH@FE@FHIGG8@FIGGHCE>EA7C7?#'), ('UQ', 12)]
C0FJ4ACXX120306:1:2305:1397:72364 99 6 140453094 60 76M 6 140453177 76 ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [31, 35, 34, 32, 35, 33, 39, 30, 31, 37, 31, 33, 35, 37, 35, 39, 33, 31, 40, 35, 38, 34, 34, 37, 31, 32, 36, 35, 37, 37, 32, 31, 37, 31, 33, 11, 10, 11, 27, 30, 30, 33, 33, 36, 37, 31, 30, 22, 28, 23, 31, 36, 34, 36, 37, 32, 27, 34, 36, 32, 40, 34, 38, 32, 29, 26, 30, 29, 31, 31, 33, 12, 27, 17, 33, 32]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?@@=DDDADCDDFBGHGBHCHC?@;?EBFE?EC@G))):?9<??B9B494??@@@F9BFGHI@;77C=CAH(7)=A'), ('UQ', 0)]
C0FJ4ACXX120306:2:2304:11465:27253 1123 6 140453094 60 76M 6 140453191 76 ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [32, 34, 33, 35, 35, 35, 40, 32, 32, 38, 33, 35, 35, 38, 36, 41, 33, 31, 41, 40, 41, 33, 38, 38, 38, 33, 36, 36, 39, 37, 34, 32, 38, 33, 33, 40, 35, 32, 34, 33, 39, 34, 38, 36, 41, 32, 31, 42, 39, 37, 31, 41, 34, 38, 37, 33, 35, 36, 35, 32, 41, 34, 38, 39, 37, 31, 32, 34, 33, 34, 35, 31, 37, 35, 41, 31]) [('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFEHHHHHJJJIJJJJJJJJEHGIIIEIJJGIJJIHIJJJFIJJIJIIIJIJJJJJJJJJIGGIJJHHHHF'), ('UQ', 0)]
C0FJ4ACXX120306:3:1201:11909:24566 99 6 140453094 60 76M 6 140453191 76 ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [31, 36, 34, 36, 36, 35, 41, 30, 31, 39, 33, 36, 36, 38, 36, 41, 34, 32, 41, 40, 39, 33, 38, 38, 38, 33, 39, 36, 38, 37, 34, 31, 39, 33, 33, 40, 34, 32, 32, 33, 40, 34, 39, 35, 41, 32, 30, 40, 39, 36, 31, 41, 34, 39, 39, 34, 36, 35, 36, 33, 39, 33, 39, 38, 37, 30, 32, 33, 34, 34, 34, 31, 38, 36, 41, 32]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFFFDHHHHGJJJJIIIJGIJIGJIEHICGIIIIGHIJCHHJGIIIJJIIIIIGGHIHIJJIIIIJJIEFHHH'), ('UQ', 0)]
D0N3RACXX120302:1:2103:18639:59616 163 6 140453094 60 76M 6 140453218 76 ACAACTGTTCAAACTGATTGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [23, 35, 33, 34, 35, 33, 37, 30, 30, 37, 31, 34, 34, 37, 34, 40, 32, 31, 13, 34, 40, 34, 39, 38, 38, 33, 38, 36, 40, 39, 33, 32, 40, 32, 33, 41, 34, 32, 34, 34, 40, 34, 38, 36, 41, 32, 31, 41, 40, 35, 31, 41, 33, 39, 39, 33, 36, 36, 36, 33, 40, 33, 39, 39, 36, 31, 33, 35, 34, 34, 34, 31, 39, 36, 40, 33]) [('MD', '18G57'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJ3AHHIJJJJJJJJJJJJJIJJJJJJJJJJJJJHIJJJJJJJJJJJJJJJJJJJJJHHH'), ('UQ', 13)]
D0N3RACXX120302:7:1306:16646:114795 163 6 140453094 60 76M 6 140453131 76 ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [23, 36, 33, 34, 35, 33, 38, 30, 29, 38, 31, 34, 34, 37, 35, 40, 32, 31, 40, 39, 40, 33, 38, 38, 38, 33, 38, 36, 40, 38, 33, 32, 40, 33, 34, 41, 33, 32, 34, 33, 40, 34, 40, 36, 40, 32, 31, 41, 39, 36, 31, 41, 34, 40, 38, 34, 36, 35, 36, 31, 40, 33, 39, 39, 37, 31, 32, 35, 35, 34, 34, 32, 39, 37, 40, 32]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFFHGHHIJJJIJIJJIJJIJJJIJJJJJJJIJJJJJJIGHJIJGHHHIJJJIIJJJJJJJJJJJHHHHH'), ('UQ', 0)]
C0FJ4ACXX120306:2:2305:5826:69821 83 6 140453094 60 76M 6 140453074 76 ACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGT array('B', [33, 38, 32, 32, 41, 33, 37, 36, 34, 40, 32, 33, 31, 40, 33, 37, 32, 33, 38, 38, 36, 32, 36, 32, 35, 31, 38, 31, 32, 40, 30, 33, 31, 38, 36, 37, 31, 36, 36, 34, 41, 32, 39, 32, 35, 31, 35, 37, 39, 31, 35, 35, 32, 39, 41, 33, 33, 33, 31, 32, 40, 30, 35, 40, 30, 31, 35, 36, 34, 34, 30, 30, 38, 34, 33, 31]) [('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CEC=GDIIHF@C=CGC>DDFB:B??9B;AF@EEHGDCHIGIIGGEHHDEGHBCIIIGIIGGFBHBFFBBDDDD@@@'), ('UQ', 0)]
D0N3RACXX120302:1:1203:4907:146297 163 6 140453096 60 76M 6 140453182 76 AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [23, 35, 36, 33, 38, 29, 29, 35, 31, 34, 34, 37, 34, 39, 33, 30, 40, 39, 39, 33, 38, 38, 38, 33, 39, 35, 39, 38, 33, 31, 40, 32, 33, 41, 33, 32, 34, 34, 40, 34, 38, 36, 40, 32, 31, 41, 39, 36, 31, 40, 34, 40, 39, 33, 36, 36, 36, 32, 39, 34, 39, 38, 36, 31, 33, 34, 34, 35, 34, 32, 39, 36, 39, 32, 40, 34]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJIIJJJJJJJJJJJJJIJJJJJJJJJJJIJIJIIIJJHHIJJJJIIJJJJIJJJJJIJJHHHH'), ('UQ', 0)]
C0FH2ACXX120312:7:1104:8721:134744 1107 6 140453096 60 76M 6 140453052 76 AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [32, 32, 39, 33, 38, 37, 35, 40, 32, 35, 33, 41, 33, 39, 32, 33, 37, 38, 39, 32, 38, 41, 38, 31, 40, 34, 31, 40, 32, 33, 31, 38, 36, 38, 32, 35, 34, 33, 39, 33, 40, 33, 38, 32, 35, 38, 40, 31, 36, 40, 32, 38, 39, 33, 33, 31, 31, 33, 38, 29, 39, 39, 30, 31, 31, 35, 33, 33, 30, 30, 40, 32, 37, 34, 35, 31]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '??EEIIIIHG@GHHGEGIGIGIGHFCBHGHGHGGGGEHGFGIIIIGHGEHFGGIGFHEFAIHFF>FDDDDFFF@@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:1101:12820:196820 83 6 140453096 60 76M 6 140453052 76 AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [31, 31, 41, 33, 39, 37, 34, 41, 33, 33, 31, 41, 33, 40, 32, 34, 38, 38, 40, 32, 38, 41, 41, 31, 41, 34, 40, 41, 32, 33, 32, 40, 36, 41, 32, 35, 37, 34, 40, 33, 41, 34, 39, 31, 36, 39, 41, 31, 36, 40, 30, 40, 41, 33, 33, 33, 32, 32, 40, 30, 40, 39, 30, 32, 36, 35, 35, 35, 31, 32, 40, 32, 37, 34, 37, 31]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EEHHIGIHIJIJJJJJJIHFGIIFJIJIJJJJJJJJJJIGJJJJJJJJJIHJJJJJIHGEJGJHHHHHFFFFFCC@'), ('UQ', 0)]
D0N3RACXX120302:3:2303:1308:147169 83 6 140453096 60 76M 6 140453044 76 AACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [34, 32, 37, 34, 39, 36, 34, 40, 34, 35, 32, 40, 34, 41, 32, 33, 39, 39, 39, 31, 40, 38, 38, 30, 40, 33, 41, 40, 32, 34, 31, 40, 36, 40, 33, 37, 36, 35, 40, 33, 40, 34, 39, 31, 36, 40, 40, 31, 36, 38, 31, 40, 40, 33, 34, 33, 32, 33, 37, 29, 40, 40, 30, 32, 35, 35, 35, 35, 31, 32, 36, 33, 36, 35, 36, 31]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?EHIJJJJJJJJJJJJJJIHJIHGJJJJJJJJJJJJJJJJJJJJJJJJJHHJJJJJJIHEJJJHGHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:1:2308:2748:9973 147 6 140453097 60 76M 6 140453040 76 ACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAG array('B', [31, 19, 34, 21, 36, 27, 33, 33, 32, 32, 41, 33, 39, 32, 33, 39, 35, 36, 33, 40, 35, 24, 17, 29, 27, 6, 28, 22, 33, 32, 36, 35, 38, 30, 24, 35, 33, 26, 32, 37, 33, 36, 30, 36, 38, 40, 30, 35, 30, 25, 39, 39, 31, 32, 26, 31, 22, 22, 16, 4, 26, 26, 30, 34, 34, 33, 34, 29, 29, 33, 31, 34, 29, 33, 29, 23]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=3=3C7=CHIIGGHHF@B<FB9*99)93HDFDC?9G@9GCCC@HCHHC<FHHEE<A3<++:>FHHGHHDDFDD=?@'), ('UQ', 0)]
D0N3RACXX120302:8:1306:19567:183510 147 6 140453098 60 76M 6 140452989 76 CTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGG array('B', [38, 31, 37, 36, 33, 32, 32, 33, 28, 38, 33, 41, 31, 32, 29, 34, 36, 30, 28, 39, 35, 30, 39, 33, 20, 38, 32, 33, 32, 35, 35, 37, 31, 35, 34, 32, 29, 31, 39, 33, 34, 24, 34, 37, 38, 28, 33, 36, 30, 39, 38, 32, 31, 29, 30, 31, 39, 27, 38, 38, 29, 27, 27, 25, 33, 29, 31, 27, 37, 26, 29, 30, 36, 33, 14, 23]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'E?CCB;EC@EFHC@8==;;D?8FD6?GGF@FDGDDB9FGE?<BDE??FEHDIHDF<C<GFGA<:B?C:D;;DD?+B'), ('UQ', 0)]
C0FH2ACXX120312:7:2101:16995:86256 163 6 140453099 37 73M3S 6 140453099 73 TGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAAGA array('B', [23, 36, 29, 28, 36, 31, 30, 32, 35, 33, 35, 31, 30, 39, 38, 39, 33, 37, 36, 37, 29, 38, 36, 39, 36, 32, 31, 38, 32, 32, 38, 32, 32, 32, 34, 36, 34, 39, 34, 39, 30, 30, 39, 38, 35, 31, 42, 34, 38, 37, 34, 35, 36, 36, 32, 39, 34, 38, 36, 36, 31, 32, 34, 34, 34, 34, 32, 36, 37, 41, 32, 40, 33, 35, 39, 33]) [('MD', '73G1T0'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 37), ('OQ', 'B@?DFFBDHHDBFIIIIIIIEHGGGHGHHGGEHGIFHIEGDFGGGIJIIGGGIIIIJGGEIIJIIICDHIEGCEEE'), ('UQ', 0)]
C0FH2ACXX120312:7:2101:16995:86256 83 6 140453099 37 3S73M 6 140453099 73 TCTTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [34, 40, 36, 33, 37, 35, 35, 40, 32, 32, 32, 42, 33, 39, 31, 33, 37, 38, 35, 30, 29, 39, 32, 28, 32, 34, 37, 41, 33, 34, 33, 39, 36, 41, 32, 36, 35, 33, 39, 32, 41, 34, 38, 31, 35, 39, 40, 32, 35, 39, 32, 39, 40, 34, 33, 33, 32, 34, 39, 30, 40, 41, 31, 32, 35, 35, 35, 34, 31, 32, 40, 32, 37, 33, 37, 32]) [('MD', '0A0A0C73'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 37), ('OQ', 'CHHCGDIIHFGHEIHDFC=6=F?9>GGJJIJIIJJIGHGBIJIJIIHDHGFIIJJJJIHFJIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:7:1307:9217:164847 163 6 140453102 60 76M 6 140453192 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [23, 37, 33, 34, 34, 35, 33, 38, 31, 30, 38, 38, 36, 32, 38, 37, 37, 32, 38, 35, 39, 37, 33, 31, 39, 31, 32, 41, 34, 31, 33, 34, 39, 33, 39, 36, 40, 31, 31, 34, 38, 36, 31, 39, 32, 38, 39, 33, 35, 36, 35, 31, 41, 34, 39, 39, 34, 29, 32, 31, 31, 33, 34, 31, 38, 35, 38, 31, 38, 34, 39, 37, 32, 38, 36, 32]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFFDFFHHFHGIJJJJIGIIJGIIGJHIIJGIJJGGGAGHICEHIJJJHIIJJJGEGFHIJJI@ADEHGEHCFH'), ('UQ', 0)]
C0FJ4ACXX120306:1:1106:2337:118212 1107 6 140453102 60 76M 6 140453005 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [34, 40, 33, 33, 33, 41, 35, 40, 32, 34, 38, 38, 39, 30, 41, 37, 40, 31, 41, 34, 38, 41, 32, 34, 32, 39, 36, 40, 32, 35, 36, 34, 41, 31, 41, 34, 39, 31, 37, 40, 41, 31, 35, 39, 31, 40, 41, 33, 34, 33, 32, 33, 40, 31, 39, 40, 30, 31, 35, 35, 35, 35, 30, 31, 40, 32, 38, 32, 38, 35, 37, 36, 33, 37, 34, 31]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'AHHEGGJIIIIGHAHGGDIIGIIJIGJJJJJJJIJIJJJJJGIHFJJIIJJIGEIIJIJJJIHDHHHHFFFFF@CC'), ('UQ', 0)]
D0MUKACXX120302:5:2101:9596:25754 1171 6 140453102 60 76M 6 140453005 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [34, 39, 32, 32, 32, 41, 34, 39, 33, 34, 39, 38, 41, 32, 40, 39, 38, 31, 41, 33, 40, 40, 32, 33, 32, 39, 36, 40, 32, 36, 35, 33, 40, 32, 41, 34, 38, 31, 35, 40, 41, 31, 36, 40, 32, 40, 40, 33, 34, 33, 32, 33, 38, 31, 40, 40, 30, 31, 35, 34, 34, 34, 30, 30, 39, 32, 37, 31, 35, 33, 36, 35, 32, 38, 35, 23]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HGHHIJJJJJJJIIJIGDJJJJJJIIJJJIJJJJJJJJJJJJIHHIJJJIJHFCJJIJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:2:2307:15728:181423 1171 6 140453102 60 76M 6 140453025 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [34, 37, 32, 32, 32, 41, 34, 41, 32, 33, 37, 38, 41, 32, 40, 37, 41, 31, 40, 34, 39, 41, 30, 33, 32, 39, 36, 39, 31, 36, 36, 33, 41, 32, 40, 34, 39, 31, 36, 40, 41, 30, 36, 40, 31, 39, 40, 34, 33, 33, 32, 33, 38, 32, 39, 37, 30, 31, 35, 34, 34, 33, 29, 31, 36, 31, 36, 31, 36, 33, 36, 35, 30, 37, 35, 23]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HGHHHGIJJIGGIGIEFDIIJICJHHIHIIJIJJJJJJJJJJJIHIIJJJJHGCIGIJJJJIIHGHHHFFFFDCCC'), ('UQ', 0)]
D0N3RACXX120302:3:1104:20776:193084 1171 6 140453102 60 76M 6 140453025 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [33, 38, 32, 33, 31, 38, 34, 35, 26, 34, 23, 35, 37, 31, 38, 38, 36, 29, 37, 33, 38, 37, 32, 33, 30, 39, 35, 34, 32, 34, 35, 32, 26, 21, 31, 33, 35, 30, 35, 37, 38, 29, 36, 40, 32, 36, 38, 33, 32, 33, 31, 31, 34, 30, 39, 39, 30, 31, 34, 34, 34, 34, 31, 30, 36, 31, 31, 32, 35, 33, 36, 29, 32, 32, 35, 23]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EHHFHHD@;@6@GAIHF?IIIHJJIHIEIHFF?1CDBIHHIGHHEIIIHGHBF?JJIIJIJIHFHFBGFFFAF@C@'), ('UQ', 0)]
D0N3RACXX120302:4:1105:19762:114976 83 6 140453102 60 76M 6 140453014 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCGCCTATTTTTACTGTGAGGTCTT array('B', [32, 27, 28, 33, 29, 32, 19, 34, 28, 30, 38, 37, 35, 31, 31, 38, 37, 31, 31, 35, 21, 36, 31, 27, 24, 24, 33, 34, 31, 34, 34, 29, 33, 19, 28, 22, 29, 21, 34, 30, 23, 31, 35, 30, 21, 29, 9, 29, 26, 32, 28, 32, 25, 9, 37, 36, 27, 25, 34, 24, 19, 34, 26, 30, 37, 31, 35, 32, 35, 30, 35, 34, 32, 33, 34, 31]) [('MD', '53A22'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', ';;;?7?.A;>ED@;AFCFAB:CB994EDFFF<B0?0:9D?9FD:1?*<;EFF@+FF?:E:9F<FFFFFD?DBD@@@'), ('UQ', 9)]
D0N3RACXX120302:6:1308:9261:137144 147 6 140453102 60 76M 6 140453025 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [34, 41, 33, 32, 32, 42, 34, 41, 32, 34, 39, 39, 39, 32, 36, 40, 41, 32, 41, 33, 40, 41, 31, 34, 32, 40, 35, 40, 32, 36, 36, 34, 41, 31, 41, 34, 39, 30, 35, 40, 41, 31, 35, 38, 31, 37, 39, 32, 33, 32, 31, 33, 39, 32, 40, 37, 30, 31, 35, 34, 34, 34, 29, 31, 39, 31, 36, 31, 35, 33, 36, 35, 32, 38, 35, 23]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHIJJJJJJJIIEIIHIJJJIIIHGJJJIJJIJJJIGJJIIGFEGIJGHCGCIGIGIIJIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:1207:17091:99164 83 6 140453102 60 76M 6 140453005 76 TCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTT array('B', [33, 40, 32, 31, 31, 43, 34, 40, 33, 33, 39, 39, 40, 32, 40, 40, 40, 31, 42, 34, 40, 41, 33, 33, 31, 41, 36, 40, 32, 35, 35, 33, 40, 32, 41, 34, 39, 31, 37, 40, 41, 31, 36, 40, 31, 40, 41, 34, 34, 34, 32, 33, 40, 30, 40, 41, 30, 32, 35, 36, 35, 35, 30, 31, 41, 33, 38, 32, 37, 35, 38, 36, 33, 39, 35, 31]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHIJJJJJJJIJJIHFJJJJJHIJJIJJJJIIJJJJJJJJJIHJJJJJJIGAJIJJJJJJIFHHHFFFFFFCCC'), ('UQ', 0)]
C0FJ4ACXX120306:5:1105:5457:182756 83 6 140453103 60 76M 6 140453037 76 CAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTC array('B', [40, 32, 32, 31, 39, 34, 40, 32, 34, 38, 39, 40, 32, 32, 39, 41, 31, 40, 33, 40, 42, 32, 33, 33, 40, 36, 40, 32, 36, 36, 34, 40, 32, 41, 34, 39, 31, 35, 40, 42, 30, 35, 38, 31, 40, 42, 34, 34, 34, 31, 33, 40, 31, 40, 42, 31, 30, 35, 35, 35, 36, 31, 31, 40, 33, 38, 33, 38, 35, 37, 37, 33, 40, 36, 32, 32]) [('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HEE>ECIIGIHGA=GDBHGJJIGFIJJIJIIIIIJJIGJJIIHGJJJIIHHCEJJIHGIJIIIHHHGHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:2101:2243:31893 83 6 140453103 60 76M 6 140453064 76 CAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTC array('B', [41, 32, 32, 31, 39, 34, 38, 32, 34, 39, 40, 38, 32, 40, 41, 40, 32, 40, 33, 39, 41, 32, 34, 32, 40, 36, 40, 32, 35, 35, 34, 40, 31, 41, 33, 38, 29, 36, 38, 38, 27, 34, 38, 32, 38, 41, 34, 33, 34, 32, 33, 39, 30, 38, 38, 32, 31, 32, 34, 34, 36, 29, 30, 38, 32, 36, 31, 36, 33, 34, 36, 31, 38, 28, 33, 31]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GHHHEC@EIIHFEFIHFGGGIIIIHIHDBGBHFHGHEIHD>HGHGIIIIGHFAGFDEAGHGEHDFDDFDADAD<@@'), ('UQ', 0)]
C0FJ4ACXX120306:8:1108:12474:182042 83 6 140453105 60 76M 6 140453032 76 AACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT array('B', [32, 31, 41, 33, 40, 32, 34, 37, 39, 38, 32, 39, 39, 40, 32, 41, 34, 40, 41, 32, 33, 32, 39, 36, 40, 31, 35, 35, 33, 39, 31, 41, 34, 39, 31, 34, 41, 41, 31, 36, 39, 31, 39, 40, 33, 34, 33, 31, 33, 39, 31, 40, 41, 30, 32, 35, 36, 35, 35, 30, 31, 41, 33, 38, 33, 39, 35, 38, 37, 33, 41, 35, 33, 40, 29, 32]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHHIJIIIFFGGGFJIIJIGHHCJIJIHCFJJJIEJIGHGEIJJJIHHDAIJGJIJJJHGIJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:3:1203:10562:169856 147 6 140453105 60 76M 6 140453047 76 AACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT array('B', [31, 32, 26, 31, 30, 27, 34, 35, 38, 30, 33, 30, 28, 26, 29, 33, 33, 31, 34, 33, 29, 14, 40, 36, 36, 32, 36, 34, 32, 31, 32, 34, 33, 36, 26, 36, 39, 28, 31, 32, 37, 29, 32, 39, 32, 24, 33, 26, 32, 9, 21, 34, 34, 21, 25, 25, 26, 30, 31, 28, 28, 29, 32, 32, 31, 38, 34, 36, 34, 31, 29, 32, 31, 30, 30, 23]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CA>;@7DAD;FAA==E=EGE88HGDEBIHEFGCEEIHADFBFBHBDECC+3GF9A::B@EFEFBDHHFDDBDD?B?'), ('UQ', 0)]
C0FH2ACXX120312:7:2106:11118:161212 147 6 140453106 60 76M 6 140452978 76 ACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATG array('B', [31, 39, 30, 38, 28, 35, 37, 38, 40, 32, 17, 17, 28, 17, 25, 28, 27, 38, 28, 35, 31, 37, 35, 32, 32, 36, 33, 35, 36, 31, 40, 29, 38, 31, 35, 40, 38, 30, 33, 31, 13, 34, 26, 21, 17, 26, 28, 26, 33, 31, 35, 34, 20, 29, 31, 25, 24, 32, 30, 25, 32, 31, 24, 31, 23, 30, 34, 26, 25, 35, 28, 28, 26, 30, 30, 23]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'EE;E>GGCHF258)8;<D;FFBD<GGAHDBGAHBIHFDB?)E:94A?<BAEC4B??<@FAAF;C3AC=;DA?A@?B'), ('UQ', 0)]
C0FJ4ACXX120306:3:2108:16634:66706 147 6 140453106 29 76M 6 140452977 76 ACTGATGGGACCCACTCCATCGAGATTTAACTGTAGCTAGACCAAAATAAAATATTTTTACTGTGAGGTCTTCATG array('B', [31, 32, 31, 38, 30, 33, 30, 38, 35, 31, 25, 36, 41, 32, 40, 34, 29, 39, 31, 34, 17, 39, 36, 38, 31, 36, 30, 31, 5, 30, 34, 20, 8, 31, 29, 28, 7, 24, 30, 38, 21, 36, 24, 7, 28, 29, 17, 12, 6, 21, 5, 15, 25, 28, 33, 35, 35, 34, 30, 30, 38, 30, 37, 31, 37, 34, 36, 32, 31, 38, 34, 31, 38, 30, 34, 23]) [('MD', '28C19C1C0C24'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 29), ('NM', 4), ('SM', 29), ('MQ', 29), ('OQ', 'C;:DC=9D=;9EHGGD>ED?2CIGGGB?0H?:*F?:*<@E?C<2FB<2+A,<EFCFCEIHG>HDDBF?AFEDD@@<'), ('UQ', 31)]
C0FJ4ACXX120306:5:1306:6352:4254 147 6 140453107 60 76M 6 140453022 76 CTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGA array('B', [31, 33, 38, 30, 34, 37, 38, 38, 33, 34, 34, 29, 17, 40, 32, 38, 39, 31, 33, 32, 40, 36, 39, 32, 34, 34, 31, 40, 29, 39, 32, 34, 30, 35, 36, 37, 25, 33, 34, 28, 39, 35, 30, 33, 32, 30, 10, 30, 17, 24, 26, 30, 31, 32, 32, 33, 35, 30, 29, 39, 31, 32, 32, 36, 35, 25, 36, 31, 37, 32, 29, 38, 29, 34, 36, 23]) [('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';EC>CGHDE@@8)FBGDGGIJIHFDDDGDEDBDF@D<??:G?FEFA+<29<H@@BGIJ?HF@HFC;HHDD;FD@@8'), ('UQ', 0)]
D0N3RACXX120302:7:2208:9680:137856 83 6 140453107 60 76M 6 140453042 76 CTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGA array('B', [39, 33, 40, 33, 34, 39, 38, 41, 33, 40, 41, 39, 31, 41, 35, 41, 41, 32, 34, 32, 40, 36, 41, 33, 36, 35, 34, 41, 31, 41, 35, 39, 31, 36, 40, 41, 31, 36, 40, 31, 40, 41, 34, 34, 35, 32, 33, 39, 30, 40, 41, 31, 32, 35, 35, 35, 35, 31, 31, 40, 33, 39, 33, 40, 36, 38, 38, 33, 40, 36, 33, 40, 31, 34, 37, 31]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHHJIIIIIIGEJIJJJJIIJJJJJIHGJJJJJJJJJJIJJJJJIHFAJJJIJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:2307:2506:121342 163 6 140453108 60 76M 6 140453185 76 TGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAA array('B', [23, 34, 29, 29, 37, 37, 36, 31, 36, 35, 34, 31, 35, 34, 39, 34, 32, 31, 39, 31, 33, 40, 33, 31, 31, 32, 37, 34, 38, 35, 40, 32, 31, 41, 38, 35, 31, 40, 33, 37, 39, 33, 35, 35, 36, 32, 40, 33, 37, 38, 36, 32, 33, 33, 34, 33, 32, 31, 38, 35, 36, 32, 40, 34, 40, 39, 32, 36, 34, 33, 40, 33, 31, 37, 32, 33]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '<?;DDFDFHGBFFHHBHIJJIIIGHGEHIIFIIIGGJJCGHIIJJIIGCHGHIIJJGFHHAGHCHC==@EHDE?>?'), ('UQ', 0)]
D0N3RACXX120302:6:1207:8241:164964 99 6 140453108 60 76M 6 140453191 76 TGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAA array('B', [31, 34, 34, 31, 40, 39, 39, 33, 39, 38, 38, 32, 36, 35, 38, 37, 33, 31, 40, 32, 33, 40, 34, 32, 33, 34, 40, 33, 38, 34, 39, 32, 30, 39, 38, 35, 31, 41, 34, 34, 35, 32, 35, 36, 35, 32, 37, 34, 39, 39, 35, 31, 31, 32, 32, 33, 32, 30, 38, 36, 42, 33, 42, 34, 41, 40, 32, 40, 37, 34, 39, 33, 32, 40, 32, 34]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFFFFGHFDDGGHHIJIIJIJIIJGG@GGHGHIJJJ?BGHJGHGIJIHBHHHCHGIGIIIIJIDHIGGHHHAA'), ('UQ', 0)]
C0FH2ACXX120312:7:2108:8829:171349 1123 6 140453109 29 76M 6 140453185 76 GATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG array('B', [24, 27, 30, 34, 33, 27, 32, 35, 21, 30, 32, 31, 35, 31, 35, 32, 31, 38, 31, 33, 39, 35, 27, 29, 33, 37, 30, 22, 24, 21, 32, 32, 30, 36, 32, 31, 40, 33, 36, 38, 34, 35, 32, 32, 30, 38, 33, 35, 36, 33, 31, 33, 27, 33, 32, 32, 31, 38, 35, 40, 32, 37, 30, 27, 18, 31, 38, 35, 32, 39, 35, 30, 39, 34, 33, 35]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 29), ('NM', 0), ('SM', 29), ('MQ', 29), ('OQ', '88?BB=?B1<A;D:A@?CF?F@;AED9114?E<B>GFFFIBG?;BGFBBB?D<CFF=DEG;@:727@DFFICECA?'), ('UQ', 0)]
C0FJ4ACXX120306:3:2307:1703:125755 611 6 140453109 60 76M 6 140453134 76 GATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG array('B', [30, 13, 26, 39, 36, 37, 32, 36, 23, 27, 34, 30, 34, 37, 34, 33, 31, 24, 30, 33, 40, 33, 28, 31, 31, 14, 16, 38, 34, 39, 29, 31, 39, 24, 36, 30, 38, 32, 38, 37, 33, 36, 31, 37, 27, 37, 31, 36, 37, 35, 32, 30, 31, 33, 31, 32, 31, 38, 36, 40, 32, 40, 33, 39, 37, 30, 39, 35, 33, 40, 35, 32, 41, 32, 32, 37]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?+:DDDDD12C;AC;CC4CEF8AFF**@EE<<C1C?BDEEBD>@<?BDDD@BDIEEDCBDCC:ACACEIIIDC>=='), ('UQ', 0)]
D0N3RACXX120302:4:2306:17439:25442 1689 6 140453109 17 41S35M 6 140453109 35 TGTTACCATGCTCAAAATGGATCCAGACAAGTGTTCTACCTGATGGGACCCAGTCCATCGAGATTTCAGTGTAGCT array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 31, 34, 26, 17, 13, 11, 7, 11, 27, 30, 29, 4, 31, 13, 30, 10, 19, 18, 22, 16, 13, 12, 17, 34, 28, 31, 32, 33, 23]) [('MD', '11C15C7'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 17), ('NM', 2), ('SM', 17), ('OQ', '###############################################AC<2+++1?F<+<,A,2222++3DB?<@='), ('UQ', 23)]
C0FJ4ACXX120306:2:1106:14202:137461 83 6 140453110 60 76M 6 140453079 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [31, 33, 37, 38, 39, 33, 41, 42, 41, 32, 41, 34, 41, 41, 33, 35, 33, 40, 37, 39, 32, 35, 36, 34, 41, 31, 41, 34, 39, 31, 35, 39, 40, 31, 37, 39, 31, 41, 41, 34, 34, 33, 32, 33, 41, 31, 41, 41, 31, 32, 36, 36, 36, 35, 30, 31, 40, 33, 38, 33, 40, 35, 37, 37, 34, 40, 35, 33, 40, 32, 33, 37, 32, 35, 35, 32]) [('MD', '76'), ('PG', 'bwa.10'), ('RG', 'C0FJ4.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHJIIJJIGIJJIIJIJIJJJJIIHJIJJIIGJJIIJJIJIHGC<JJJJIJJJJIJJJIJIJHGHHHFFFFF@@C'), ('UQ', 0)]
C0FJ4ACXX120306:3:1304:10517:85470 1171 6 140453110 60 76M 6 140452978 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [33, 33, 38, 39, 38, 33, 41, 41, 41, 32, 40, 33, 40, 41, 30, 34, 33, 41, 36, 40, 33, 35, 35, 33, 40, 32, 41, 34, 39, 31, 36, 37, 38, 31, 35, 40, 30, 40, 41, 33, 34, 33, 32, 31, 37, 30, 37, 40, 30, 32, 35, 35, 35, 35, 30, 31, 40, 31, 38, 33, 40, 35, 36, 37, 32, 39, 34, 31, 39, 29, 31, 36, 29, 34, 37, 23]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHHCIJJIHIIHHBIIIIIIGHHGGJJJIHGGGHGFIJIJIHFEAGIGJIJIIHHHEJJJIGHGHHFFFFFD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:5:1304:6335:190059 83 6 140453110 60 76M 6 140452929 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [31, 33, 39, 39, 41, 32, 41, 40, 41, 32, 41, 34, 40, 42, 32, 33, 32, 39, 36, 40, 33, 36, 36, 34, 41, 32, 42, 34, 39, 31, 37, 39, 41, 31, 36, 40, 32, 40, 42, 34, 34, 33, 31, 33, 41, 32, 40, 41, 31, 32, 36, 35, 35, 36, 31, 31, 42, 33, 39, 33, 40, 35, 38, 38, 35, 40, 35, 32, 40, 31, 33, 37, 32, 35, 36, 32]) [('MD', '76'), ('PG', 'bwa.2'), ('RG', 'C0FJ4.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHJJJJJHGIIIJJJJIJJJJJIIIJIJJJJJIIJIJJJJIHGFCJJIJJJJJJJJJJJJJJHGHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1303:8173:106713 147 6 140453110 60 76M 6 140452978 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [32, 33, 40, 40, 40, 33, 41, 40, 40, 32, 41, 34, 39, 42, 32, 34, 33, 41, 37, 40, 32, 36, 36, 35, 40, 32, 41, 32, 39, 31, 35, 39, 42, 30, 36, 40, 31, 39, 40, 33, 33, 32, 31, 33, 40, 30, 40, 40, 29, 32, 36, 35, 36, 35, 30, 31, 40, 32, 39, 32, 39, 34, 37, 37, 32, 39, 34, 31, 38, 29, 30, 35, 29, 35, 36, 23]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHJIHHGF=IHIJJJJJJJJJJJHIJGJJIJJJJHGIIJIGGIHDJJIJJJJJJIJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:2103:19332:163957 1107 6 140453110 60 76M 6 140453079 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [31, 33, 39, 40, 41, 32, 41, 41, 40, 33, 41, 33, 41, 41, 33, 34, 34, 40, 36, 40, 32, 36, 36, 34, 41, 31, 41, 34, 38, 31, 34, 40, 41, 31, 36, 40, 32, 40, 41, 33, 34, 34, 31, 33, 41, 30, 40, 40, 30, 32, 35, 35, 36, 35, 30, 31, 39, 33, 38, 32, 39, 35, 38, 38, 33, 40, 35, 33, 39, 32, 33, 37, 31, 34, 36, 31]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CEHIIHIIHFHGJJIIGIJJJJIJHHIIGIEIJJJJJJIIJIGHHFJIGIIJJJHHEGHEIJJHHHGHFFFFF@@@'), ('UQ', 0)]
D0N3RACXX120302:2:2302:4867:46185 147 6 140453110 60 76M 6 140453071 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [32, 33, 38, 38, 40, 32, 41, 41, 41, 32, 39, 34, 39, 41, 33, 33, 32, 40, 36, 40, 32, 35, 35, 33, 41, 30, 40, 33, 39, 31, 37, 40, 41, 30, 36, 40, 32, 40, 41, 32, 34, 33, 31, 33, 38, 32, 39, 41, 30, 32, 35, 35, 35, 35, 30, 31, 40, 33, 38, 33, 39, 35, 37, 37, 32, 38, 33, 31, 38, 29, 31, 36, 29, 35, 37, 23]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HHHJJIJJHFIHJJJIJIJJJJJJIIIGJJJJJJJJHJJIJIIGGCIJIJJJJJJIJJJIJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:6:2101:21126:43869 83 6 140453110 60 76M 6 140453022 76 ATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA array('B', [32, 33, 36, 29, 40, 31, 39, 39, 40, 32, 39, 34, 40, 39, 31, 32, 27, 39, 36, 38, 30, 33, 36, 33, 39, 30, 37, 32, 36, 14, 36, 37, 38, 32, 35, 36, 29, 25, 35, 31, 33, 33, 29, 10, 23, 17, 21, 11, 26, 29, 33, 37, 36, 31, 33, 30, 39, 29, 26, 29, 16, 13, 14, 34, 32, 38, 22, 32, 39, 30, 32, 34, 30, 32, 31, 18]) [('MD', '76'), ('PG', 'bwa.1'), ('RG', 'D0N3R.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=DA9IDDDCCCCIEB<;EIEADIIEDDDB4CEDCD?8:?BEE?*2+9+<CDCC?CFFA2<+++ABD4BDDD?D??8'), ('UQ', 0)]
C0FJ4ACXX120306:4:1305:13055:48022 147 6 140453112 60 76M 6 140452983 76 GGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAA array('B', [38, 35, 35, 17, 38, 20, 36, 31, 39, 30, 23, 33, 29, 33, 30, 37, 35, 39, 32, 37, 33, 33, 38, 31, 35, 30, 35, 26, 36, 39, 26, 31, 29, 31, 18, 30, 38, 32, 32, 32, 26, 10, 37, 18, 36, 28, 30, 29, 24, 35, 31, 34, 23, 27, 37, 28, 35, 25, 40, 35, 36, 28, 31, 37, 34, 31, 36, 29, 25, 35, 27, 33, 26, 23, 30, 22]) [('MD', '76'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C?=/C5B8C87==<GFCEFB>ADB@>B<HF9H::1>DFCC:*C2E<EA9F>E:?DAF?HGB;GDFDDD?D?A:8<;'), ('UQ', 0)]
C0FJ4ACXX120306:4:2102:13953:161699 83 6 140453113 60 76M 6 140452979 76 GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGNAGAAAT array('B', [37, 39, 31, 41, 40, 41, 33, 41, 34, 40, 40, 32, 33, 34, 41, 36, 41, 33, 36, 36, 35, 41, 32, 41, 34, 39, 31, 36, 40, 41, 31, 36, 40, 32, 40, 41, 34, 34, 34, 31, 33, 40, 32, 40, 41, 31, 31, 36, 35, 36, 35, 30, 32, 40, 33, 39, 33, 40, 35, 38, 39, 33, 41, 35, 33, 40, 30, 33, 32, 2, 35, 37, 31, 33, 30, 32]) [('MD', '69A6'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', 'EHHHJIHIIJJJGJJJJJJJJJIJJJJJJJJJJJJJJJJHHGCJJJIJJJJJJJJJJJJJJJJHHHFC2#FFFCCC'), ('UQ', 2)]
D0MUKACXX120302:3:1204:14877:161615 83 6 140453113 60 76M 6 140453019 76 GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT array('B', [37, 39, 33, 41, 38, 41, 33, 42, 34, 40, 41, 33, 34, 32, 40, 37, 39, 33, 37, 36, 33, 40, 32, 42, 34, 37, 31, 36, 37, 41, 31, 36, 40, 33, 41, 41, 34, 34, 34, 31, 33, 39, 31, 40, 41, 31, 32, 35, 36, 36, 36, 30, 33, 41, 33, 37, 33, 39, 36, 38, 37, 33, 41, 36, 33, 39, 32, 32, 37, 31, 35, 37, 31, 32, 30, 32]) [('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CHHIDHFHEFIJIJIJJJJIIIHJIJJJIJJJJJJJJJJIIGHJJIJJJJJGJJJJIJJJJJJHHHGHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:3:2304:11491:27029 83 6 140453113 60 76M 6 140452933 76 GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT array('B', [36, 35, 27, 28, 40, 41, 32, 42, 34, 39, 39, 31, 35, 32, 40, 37, 39, 31, 30, 35, 33, 40, 32, 31, 35, 34, 30, 36, 37, 40, 30, 36, 38, 31, 37, 38, 33, 33, 33, 29, 34, 37, 30, 40, 40, 31, 32, 35, 35, 35, 36, 30, 31, 38, 35, 28, 31, 38, 34, 36, 35, 33, 40, 36, 34, 34, 30, 31, 37, 31, 34, 37, 31, 31, 30, 30]) [('MD', '76'), ('PG', 'bwa.5'), ('RG', 'D0MUK.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=A5<IHGIIGGECIIEHD>HBGF>@CDGGIEHGHGEGGGECE?IHHGGGGIHHEEABIHGGEIHFAFAFFDFF@C@'), ('UQ', 0)]
D0MUKACXX120302:4:2307:21149:101091 1107 6 140453113 60 76M 6 140452933 76 GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT array('B', [20, 23, 31, 41, 39, 38, 24, 36, 33, 40, 40, 32, 33, 30, 38, 36, 39, 31, 35, 36, 31, 40, 32, 41, 33, 33, 27, 35, 38, 37, 30, 36, 38, 31, 35, 40, 31, 29, 30, 31, 34, 40, 29, 38, 39, 31, 31, 36, 35, 35, 36, 30, 33, 40, 32, 34, 32, 39, 35, 36, 38, 32, 39, 33, 33, 39, 31, 32, 38, 31, 35, 36, 30, 32, 30, 24]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '63HHD@3AGIGHHEGHHFBD<GGHFA>HEBHGGFBGBF@C@HEGGIGHGGIGGIHAEIHBHEHDHGHHFFFDD@@<'), ('UQ', 0)]
D0MUKACXX120302:8:1307:1546:28511 1107 6 140453113 60 76M 6 140452933 76 GGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAAT array('B', [34, 32, 32, 39, 39, 41, 32, 41, 35, 30, 40, 32, 34, 33, 33, 36, 40, 31, 35, 35, 34, 40, 31, 39, 35, 29, 22, 37, 40, 40, 28, 35, 40, 31, 18, 41, 33, 33, 29, 29, 13, 40, 31, 29, 40, 31, 33, 34, 35, 37, 35, 31, 31, 39, 31, 36, 32, 34, 35, 38, 32, 33, 39, 36, 32, 38, 29, 30, 36, 31, 35, 36, 30, 30, 29, 31]) [('MD', '76'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '?>AEGFDHF>EGHF>GHF@DBGFFB94IIG>CHF6GGGFC*C:<IIIGHCHIHHFF?AHFACHBFDD<DFFDD@@?'), ('UQ', 0)]
C0FJ4ACXX120306:1:2108:12052:21457 1187 6 140453116 60 76M 6 140453155 76 CCCACTCCAGCGAGATTGCACTGTAGCTAGACGAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA array('B', [23, 33, 34, 32, 34, 23, 34, 35, 31, 19, 7, 11, 7, 31, 31, 28, 31, 9, 31, 29, 37, 35, 40, 29, 30, 40, 39, 36, 30, 40, 34, 39, 3, 30, 35, 34, 36, 32, 39, 33, 39, 37, 34, 30, 31, 33, 33, 34, 33, 31, 37, 36, 41, 30, 40, 34, 19, 33, 27, 37, 37, 34, 40, 32, 31, 40, 33, 36, 38, 30, 36, 35, 31, 31, 32, 31]) [('MD', '9T7T14C43'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 3), ('SM', 37), ('MQ', 60), ('OQ', '@<BFD3ADH3+0)>@FH+ACHIJEHIIJJIJJ):@GHHHJJIEGIGJIIIFHIAFG4@@EHIIGEHACE7@DEFFF'), ('UQ', 31)]
D0N3RACXX120302:3:2307:15322:119022 99 6 140453116 60 76M 6 140453164 76 CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA array('B', [31, 36, 38, 33, 36, 35, 37, 38, 32, 32, 39, 29, 33, 38, 32, 32, 34, 33, 39, 33, 38, 37, 40, 31, 29, 37, 40, 36, 31, 38, 33, 39, 38, 33, 36, 36, 36, 32, 41, 34, 40, 39, 36, 30, 32, 34, 34, 34, 33, 31, 39, 37, 41, 32, 40, 34, 41, 38, 32, 39, 36, 33, 39, 34, 32, 40, 34, 37, 36, 34, 36, 35, 33, 30, 34, 30]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIIJIJJJJJJIHIJJJIIJIJJJIIJJJJJJJJJJJJJJJIJGJIHHIJIEIIIGGJJJIJGA'), ('UQ', 0)]
D0N3RACXX120302:7:1108:18863:147062 163 6 140453116 60 76M 6 140453155 76 CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA array('B', [23, 35, 36, 31, 35, 33, 36, 35, 31, 30, 38, 31, 32, 39, 32, 31, 32, 33, 39, 31, 38, 35, 40, 33, 31, 38, 38, 33, 30, 40, 33, 39, 39, 33, 36, 35, 32, 31, 39, 31, 38, 38, 36, 30, 30, 32, 34, 34, 34, 30, 36, 36, 40, 33, 41, 33, 40, 41, 32, 39, 36, 33, 40, 33, 31, 41, 33, 35, 41, 33, 35, 35, 32, 31, 32, 29]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFFDHHHHHJIGGIIDHIICF@HEIIIJJIJIBGGAHGIFEHIGIHDHGHHIHHIIIIJGIIGEHIIEGIID'), ('UQ', 0)]
C0FJ4ACXX120306:7:2205:1115:80726 1113 6 140453116 37 76M 6 140453116 76 CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA array('B', [34, 33, 41, 31, 39, 33, 40, 34, 31, 32, 31, 38, 35, 39, 32, 36, 34, 34, 40, 33, 41, 33, 38, 31, 36, 39, 41, 31, 35, 38, 30, 39, 40, 32, 33, 31, 32, 35, 41, 30, 38, 41, 30, 32, 35, 35, 30, 32, 30, 30, 40, 33, 37, 32, 36, 35, 30, 36, 31, 40, 34, 33, 40, 30, 32, 36, 32, 35, 37, 30, 30, 30, 29, 30, 28, 31]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 0), ('NM', 0), ('SM', 37), ('OQ', '@AC=@HF>F=EFCCGFDCGIIGCGHDIGHFDGGHGFGCC9GGHGHF<<EHHIGHFC9F>GHFFFFFHHDDDDD@<@'), ('UQ', 0)]
C0FJ4ACXX120306:8:1302:7027:47625 147 6 140453116 60 76M 6 140453039 76 CCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATA array('B', [42, 39, 42, 32, 40, 34, 40, 42, 33, 35, 32, 40, 36, 40, 33, 36, 36, 34, 41, 32, 42, 34, 39, 31, 36, 39, 41, 31, 36, 39, 31, 40, 40, 34, 34, 33, 31, 33, 40, 32, 40, 41, 31, 32, 35, 35, 35, 35, 31, 32, 41, 33, 39, 33, 39, 36, 38, 38, 33, 40, 35, 32, 39, 31, 31, 37, 30, 33, 35, 29, 29, 30, 29, 29, 30, 23]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIHEJJJJJJJJJJIIJJJIJJJJIJJJJIHJIJJJIHGCJJJJIJJIJJJJJJJJJJJJJIJHGHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:8:1208:15795:144587 83 6 140453116 60 20S56M 6 140452951 56 ATCTGTTCAAACTGATGGGACCCTCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGA array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 32, 30, 13, 36, 32, 19, 33, 29, 25, 21, 37, 29, 30, 11, 35, 33, 30, 33, 18, 29, 33, 37, 31, 35, 38, 39, 18, 34, 37, 31, 30, 15, 30, 31, 32, 29, 33, 39, 30, 39, 40, 30, 31, 35, 35, 35, 35, 29, 30, 40, 33, 36, 33, 36, 31]) [('MD', '3A52'), ('PG', 'bwa.14'), ('RG', 'D0MUK.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#####################?7*?D6::33D9:*CD::19GEECBF4BFF?,HCHAICAGIIFHHFFDDFFF@@@'), ('UQ', 13)]
C0FJ4ACXX120306:8:2206:8037:177929 99 6 140453117 60 76M 6 140453180 76 CCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGGCTTCATGAAGAAATATAT array('B', [30, 32, 15, 35, 35, 30, 29, 32, 29, 36, 26, 33, 39, 32, 30, 32, 32, 37, 31, 37, 35, 38, 31, 29, 39, 37, 33, 25, 13, 11, 30, 37, 33, 35, 35, 34, 23, 31, 33, 37, 37, 30, 32, 27, 31, 33, 32, 32, 29, 30, 35, 38, 31, 38, 34, 37, 34, 5, 31, 35, 33, 26, 16, 28, 31, 35, 33, 38, 31, 36, 36, 29, 28, 29, 31, 31]) [('MD', '57T18'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?<+B?:=BAD:DDIEBEE?DEEBBEEF9++<C;EED39BDD<@9DCDDA9BBE@BA?(7BC3)77@A@CEI:;>C='), ('UQ', 5)]
D0N3RACXX120302:7:1208:14483:71038 163 6 140453118 60 76M 6 140453167 76 CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAAGTCTTCATGAAGAAATATATC array('B', [23, 33, 36, 34, 36, 13, 29, 25, 35, 31, 30, 37, 32, 31, 32, 32, 39, 33, 38, 35, 36, 31, 26, 30, 31, 35, 27, 39, 34, 38, 38, 33, 35, 36, 36, 32, 36, 32, 38, 38, 35, 31, 32, 33, 35, 34, 34, 28, 37, 34, 39, 32, 42, 34, 33, 38, 22, 31, 34, 34, 39, 33, 32, 38, 33, 36, 41, 33, 37, 37, 32, 30, 31, 31, 32, 38]) [('MD', '54G21'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '?@@FF+A;CFDBFHJJJCIIBH<<<E@FHIIJHJJJ@GIIGJIIJJJ?GBDHHIDG49DGEHHEEGHGFGGIIIIG'), ('UQ', 33)]
C0FJ4ACXX120306:1:1206:11701:42451 83 6 140453118 60 76M 6 140453081 76 CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATC array('B', [35, 31, 41, 33, 41, 41, 32, 33, 32, 40, 36, 40, 32, 36, 35, 34, 41, 31, 41, 34, 39, 32, 37, 40, 40, 31, 36, 40, 32, 40, 40, 34, 34, 33, 31, 34, 40, 32, 40, 40, 31, 32, 36, 35, 36, 35, 31, 32, 41, 34, 38, 34, 40, 36, 37, 38, 33, 40, 35, 33, 40, 32, 33, 39, 32, 35, 39, 32, 32, 31, 31, 31, 31, 30, 33, 31]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=EGIIGIGIJJIJJJJJIIIJJJJIJJIIJIIIIHCE@IIIJJJJIJJJJIJJIIJJIJJIJJGHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:4:1304:18933:23139 163 6 140453119 60 76M 6 140453163 76 ACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCT array('B', [23, 35, 35, 36, 35, 30, 30, 36, 29, 32, 37, 32, 31, 28, 30, 39, 32, 36, 34, 35, 30, 28, 34, 37, 36, 30, 36, 32, 38, 38, 33, 35, 36, 35, 31, 36, 33, 35, 36, 37, 29, 32, 33, 33, 33, 33, 28, 38, 35, 39, 32, 36, 33, 34, 34, 33, 38, 34, 33, 37, 33, 33, 40, 34, 35, 39, 32, 36, 35, 31, 30, 33, 31, 32, 40, 34]) [('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@CCFDDFFHHHDHDHIIGEGGDGGJJGIIJJJJGHBHFEHAGGIJGDGGIHDGCGBFFHGGHJGIIAFHIIJJJIG'), ('UQ', 0)]
D0MUKACXX120302:6:2106:9910:116898 1683 6 140453119 60 13S63M 6 140452978 63 ACTGATGGGACCCGCTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATGTTTACTGTGAGGTCTTCATG array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 38, 33, 38, 34, 10, 23, 7, 34, 25, 23, 30, 29, 35, 33, 38, 32, 28, 34, 27, 30, 29, 35, 12, 32, 32, 27, 33, 13, 22, 31, 31, 30, 10, 23, 34, 17, 14, 10, 17, 20, 26, 9, 35, 27, 26, 27, 25, 25, 34, 30, 21, 12, 32, 17, 11, 28, 29, 29, 36, 30, 28, 12]) [('MD', '0A41T20'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 2), ('SM', 37), ('MQ', 60), ('OQ', '##############CGF?*0(?04?<EIG?9CDC9?*B?9C14BFA+2A23+33<+F<?<::CA2+A2+=;;DB;+'), ('UQ', 11)]
D0MUKACXX120302:7:2107:9365:181919 147 6 140453119 60 76M 6 140453063 76 ACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCT array('B', [29, 38, 33, 33, 38, 32, 34, 32, 38, 35, 31, 31, 34, 35, 34, 40, 32, 38, 33, 40, 31, 36, 38, 40, 30, 36, 40, 32, 41, 37, 33, 33, 34, 31, 32, 38, 30, 38, 39, 30, 31, 31, 28, 33, 34, 25, 32, 41, 32, 37, 31, 39, 31, 26, 33, 32, 37, 31, 32, 39, 30, 32, 39, 29, 34, 36, 29, 29, 30, 29, 29, 28, 29, 27, 35, 23]) [('MD', '76'), ('PG', 'bwa.7'), ('RG', 'D0MUK.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '=GG@@HFDCF:BEIGDB?EGEHGFDGJJHBIIGDDD?CFGF><?F>CHDEAHA:@AE>GIGJHDHFBFBBDDB;?@'), ('UQ', 0)]
C0FJ4ACXX120306:7:1108:1990:199223 99 6 140453122 60 76M 6 140453147 76 CCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAG array('B', [29, 31, 34, 28, 36, 31, 32, 40, 33, 30, 30, 32, 36, 32, 38, 36, 40, 30, 30, 39, 38, 35, 31, 40, 34, 37, 38, 33, 35, 36, 35, 31, 37, 32, 38, 36, 34, 32, 31, 34, 32, 33, 34, 30, 38, 36, 41, 32, 40, 33, 40, 38, 33, 38, 34, 31, 38, 33, 31, 40, 34, 35, 40, 33, 36, 37, 33, 32, 32, 30, 32, 38, 36, 41, 32, 35]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ';=@?DDDFFDFHFEIIGFIFF@FFEGIGIICEBAEBBCFICIIFIII?DFHD??DDFGGCHBDHCFHHGGHF@C;='), ('UQ', 0)]
D0MUKACXX120302:6:1107:19198:26461 83 6 140453122 60 76M 6 140453036 76 CCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAG array('B', [33, 42, 32, 33, 32, 40, 38, 41, 33, 36, 35, 34, 41, 32, 41, 34, 38, 31, 36, 40, 42, 31, 37, 40, 32, 40, 41, 33, 33, 34, 32, 34, 41, 31, 40, 42, 31, 32, 36, 36, 36, 36, 31, 31, 41, 33, 38, 33, 40, 36, 38, 38, 33, 40, 36, 33, 41, 32, 33, 40, 33, 36, 40, 32, 32, 32, 31, 31, 31, 32, 33, 39, 33, 37, 34, 32]) [('MD', '76'), ('PG', 'bwa.13'), ('RG', 'D0MUK.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GIIHDIJJIGIGIIIIIJIJIJJJIIJJJJJJIHJJJJIJJJIIJIJJJJJJJIJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:1206:14087:187089 1619 6 140453122 60 31S45M 6 140452942 45 CAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTAC array('B', [2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 35, 25, 29, 28, 16, 21, 29, 23, 28, 10, 29, 14, 31, 36, 32, 24, 22, 27, 25, 28, 8, 16, 34, 32, 9, 35, 28, 13, 24, 29, 28, 29, 18, 35, 38, 33, 25, 28, 28, 20, 32, 23, 30, 23]) [('MD', '45'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '################################?7>?*471:*:*BB@77=7<+,AA0@>,2=<<+BC@=<<1A=:='), ('UQ', 0)]
C0FJ4ACXX120306:7:2106:15175:63094 99 6 140453123 60 76M 6 140453186 76 CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG array('B', [32, 33, 30, 37, 32, 33, 40, 32, 31, 32, 32, 38, 33, 38, 36, 41, 30, 29, 39, 38, 36, 30, 39, 33, 38, 37, 34, 35, 35, 36, 31, 38, 33, 37, 38, 35, 33, 31, 33, 34, 33, 33, 30, 37, 36, 40, 30, 40, 34, 39, 39, 32, 40, 37, 34, 40, 34, 32, 41, 34, 36, 41, 33, 35, 35, 32, 32, 32, 31, 33, 38, 36, 40, 32, 41, 37]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'C@CFFFFDHHHGHIIIEGHGGIGEHIJIJIGEHGGECEHJIIGGIGDFEFGHJJJIGHIIGHAHEHIIJIGHGEHD'), ('UQ', 0)]
C0FJ4ACXX120306:3:2205:17332:54473 83 6 140453123 60 76M 6 140453066 76 CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG array('B', [39, 28, 34, 30, 34, 37, 39, 33, 36, 35, 33, 42, 31, 40, 33, 39, 32, 36, 39, 41, 32, 36, 37, 31, 35, 40, 34, 34, 32, 32, 33, 40, 31, 41, 40, 31, 33, 35, 36, 36, 35, 30, 32, 40, 34, 39, 33, 40, 36, 38, 37, 32, 40, 35, 33, 39, 32, 33, 39, 32, 35, 39, 33, 32, 33, 31, 32, 30, 30, 32, 40, 32, 38, 35, 37, 31]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@;H@:IHGIGIGEIGIIIIIGGFDEGIIHGHGCIIIGGGGGIIIIIIIHIHDHGIHIIGIIIIHGHHHDAFFFCC@'), ('UQ', 0)]
D0N3RACXX120302:1:1107:6701:81808 595 6 140453123 29 76M 6 140452995 76 CATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGG array('B', [33, 28, 34, 26, 13, 17, 36, 26, 25, 29, 33, 39, 31, 37, 32, 35, 30, 34, 38, 27, 25, 34, 37, 33, 40, 38, 31, 34, 31, 30, 32, 33, 22, 5, 34, 9, 30, 20, 34, 33, 35, 31, 21, 32, 11, 30, 11, 29, 31, 13, 30, 31, 24, 34, 13, 34, 24, 31, 25, 32, 32, 32, 32, 30, 15, 26, 27, 29, 30, 32, 24, 26, 33, 29, 31, 24]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 29), ('NM', 0), ('SM', 29), ('MQ', 29), ('OQ', '==@=))@44:DC=EDAEDB99DD;IDBBDBD?1*?*:3EDEC2A+<+:<+;<<A,A3A4EB>EC,A:BD?:?B;<?'), ('UQ', 0)]
D0N3RACXX120302:1:2107:11120:27129 163 6 140453124 60 76M 6 140453185 76 ATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGT array('B', [23, 29, 37, 30, 32, 37, 31, 30, 30, 30, 37, 33, 37, 34, 39, 30, 30, 40, 39, 35, 30, 40, 33, 38, 38, 33, 35, 35, 36, 32, 40, 33, 38, 39, 35, 31, 33, 34, 34, 34, 33, 31, 38, 36, 41, 32, 40, 34, 41, 40, 35, 40, 37, 33, 40, 33, 32, 41, 34, 36, 41, 33, 36, 37, 33, 31, 33, 32, 33, 40, 36, 41, 33, 41, 39, 32]) [('MD', '76'), ('PG', 'bwa.3'), ('RG', 'D0N3R.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHGHJJIJJJJJJJJIJJJJJJJJJJJJJJJJJJJJIIJJJJIHIJJJJJJJJJJJJJJJJJJJJJC'), ('UQ', 0)]
D0MUKACXX120302:5:1303:4376:135167 83 6 140453124 60 76M 6 140452916 76 ATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGT array('B', [30, 36, 33, 40, 36, 39, 34, 35, 36, 35, 39, 32, 41, 33, 38, 30, 36, 39, 41, 31, 34, 35, 30, 36, 40, 32, 33, 34, 33, 33, 40, 33, 38, 38, 30, 32, 35, 36, 36, 36, 30, 32, 41, 34, 38, 34, 40, 36, 38, 38, 33, 41, 36, 33, 40, 32, 33, 40, 33, 36, 40, 33, 33, 32, 31, 31, 30, 31, 32, 39, 33, 37, 35, 38, 35, 32]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DGJJJIGGJIGHIJJIJIJIFB;BIGJIIHF?HHCJJIIIIJJJJJIIIJGJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:5:2107:2516:43946 1107 6 140453124 60 6S70M 6 140453081 70 CACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCGCCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATC array('B', [2, 2, 2, 2, 2, 2, 2, 34, 30, 31, 37, 36, 30, 35, 22, 34, 39, 31, 38, 35, 34, 32, 35, 39, 40, 31, 35, 32, 33, 29, 31, 31, 31, 32, 26, 9, 23, 10, 23, 38, 29, 28, 33, 34, 33, 33, 30, 30, 41, 33, 37, 34, 39, 35, 36, 38, 33, 40, 35, 32, 39, 31, 32, 36, 32, 34, 29, 30, 30, 30, 29, 30, 28, 30, 33, 30]) [('MD', '31A38'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '#######C@;G@@@4BCBCC@CHGFBD>G:<???0):*9ED>DHBHEAIIGIIHEHBGIHCGGFHF<>ADDDD@@@'), ('UQ', 10)]
C0FJ4ACXX120306:7:2106:7109:75175 147 6 140453125 60 76M 6 140453056 76 TCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTG array('B', [22, 30, 38, 35, 36, 23, 33, 33, 13, 31, 32, 31, 30, 37, 29, 32, 37, 38, 31, 34, 37, 30, 39, 41, 31, 31, 31, 31, 30, 23, 13, 23, 36, 32, 30, 35, 35, 35, 31, 33, 31, 39, 33, 38, 35, 32, 31, 38, 29, 23, 37, 35, 33, 23, 31, 23, 38, 26, 30, 38, 31, 31, 30, 23, 30, 29, 30, 31, 38, 31, 35, 33, 35, 34, 31, 23]) [('MD', '76'), ('PG', 'bwa.9'), ('RG', 'C0FJ4.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '3>EC=7=>)<F<ACB?BCHFB8FFAFDH90*9EHEIGFAC?FECC@<C<4EHC:I:HA>GHFG<FBHHFFFDD???'), ('UQ', 0)]
C0FH2ACXX120312:7:1206:13203:124056 163 6 140453126 60 76M 6 140453201 76 CGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGT array('B', [23, 28, 33, 34, 32, 26, 25, 29, 35, 30, 34, 34, 36, 25, 26, 35, 33, 32, 30, 33, 29, 35, 36, 34, 35, 35, 34, 31, 38, 31, 34, 38, 32, 28, 32, 29, 33, 34, 34, 22, 34, 34, 33, 17, 23, 32, 39, 33, 20, 36, 35, 28, 36, 33, 33, 39, 29, 29, 37, 34, 34, 35, 30, 31, 30, 31, 31, 37, 35, 39, 35, 38, 37, 27, 31, 30]) [('MD', '76'), ('PG', 'bwa.20'), ('RG', 'C0FH2.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@DFAADFDFHDA@CBEJCDEEHIGEGGDEHBDHBHII;BC?1:?FC3??<BFEC<8D@DG@FCCGFFGHDG7=='), ('UQ', 0)]
D0MUKACXX120302:5:2108:16989:35544 83 6 140453126 60 76M 6 140453092 76 CGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGT array('B', [31, 39, 35, 40, 32, 35, 37, 34, 39, 33, 42, 34, 39, 31, 36, 39, 39, 31, 35, 38, 31, 40, 40, 33, 33, 34, 32, 34, 39, 31, 37, 39, 29, 32, 35, 34, 32, 36, 30, 32, 38, 31, 38, 33, 39, 36, 37, 37, 33, 38, 36, 34, 36, 31, 33, 39, 33, 36, 39, 30, 30, 30, 28, 32, 31, 31, 33, 40, 32, 37, 34, 36, 35, 34, 34, 31]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DIIHGIGGGHIIIHHDGFBDBIHGIIGEGBGGDIHGBIGIEDGHGGEGIGIHBBIIIIIHDGBHFHHHFFDDD@@@'), ('UQ', 0)]
C0FJ4ACXX120306:4:2105:14262:47111 1635 6 140453127 60 76M 6 140453155 76 GAGATTNCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTA array('B', [30, 31, 33, 32, 30, 31, 2, 32, 33, 33, 25, 33, 24, 29, 36, 36, 29, 29, 32, 34, 38, 38, 33, 34, 35, 32, 31, 24, 33, 36, 38, 35, 30, 31, 29, 31, 33, 32, 26, 37, 34, 38, 32, 27, 33, 36, 38, 31, 34, 36, 28, 37, 24, 29, 30, 30, 34, 39, 34, 36, 35, 32, 31, 31, 30, 32, 38, 34, 38, 33, 41, 37, 32, 37, 32, 31]) [('MD', '6T69'), ('PG', 'bwa.15'), ('RG', 'C0FJ4.4'), ('AM', 37), ('NM', 1), ('SM', 37), ('MQ', 60), ('OQ', '???D??#2=<1A2AEB:CEFIDCEF>F3CBEAEB:DCD;DBD?BDEDB??<D?998?DDCDEICEDCDEIIC@CIC'), ('UQ', 2)]
D0N3RACXX120302:5:2307:8953:61063 99 6 140453127 60 76M 6 140453154 76 GAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTA array('B', [31, 33, 39, 33, 31, 31, 31, 37, 33, 38, 35, 40, 32, 31, 41, 39, 36, 31, 41, 33, 39, 39, 33, 35, 36, 36, 32, 40, 34, 39, 38, 36, 31, 32, 34, 34, 34, 34, 31, 38, 36, 41, 32, 41, 34, 42, 41, 31, 40, 36, 33, 40, 34, 32, 41, 34, 36, 41, 34, 36, 36, 33, 31, 33, 31, 33, 40, 37, 41, 35, 42, 41, 31, 40, 31, 33]) [('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJJJIJJJIJJJJJJJJIJJIIJJJHIJJJJJJJJJIIJJJJJJJIJIJJEGEC'), ('UQ', 0)]
C0FJ4ACXX120306:1:1202:13169:44559 99 6 140453128 60 76M 6 140453163 76 AGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAG array('B', [31, 36, 34, 32, 31, 31, 37, 33, 37, 36, 40, 31, 31, 41, 39, 36, 30, 41, 33, 38, 38, 33, 36, 36, 35, 32, 40, 34, 39, 38, 36, 30, 32, 34, 33, 34, 34, 31, 39, 36, 41, 31, 41, 34, 42, 40, 31, 37, 35, 33, 39, 33, 32, 41, 34, 36, 41, 33, 36, 36, 32, 30, 32, 32, 33, 39, 36, 41, 34, 39, 39, 32, 40, 31, 32, 35]) [('MD', '76'), ('PG', 'bwa.4'), ('RG', 'C0FJ4.1'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHJJJJJJJJJJJIJIIIJJIJJJJJIJGIDHJJJBFGGIIJIHIIFGIIJIIGGGGIGG=F@@='), ('UQ', 0)]
D0N3RACXX120302:8:2305:4402:136981 99 6 140453129 60 76M 6 140453160 76 GATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGT array('B', [32, 30, 31, 31, 31, 37, 33, 36, 35, 40, 31, 30, 41, 38, 36, 29, 39, 32, 38, 38, 33, 35, 35, 36, 32, 40, 34, 39, 38, 36, 30, 32, 34, 34, 34, 33, 31, 39, 36, 41, 32, 40, 32, 40, 40, 31, 38, 36, 34, 40, 34, 33, 41, 34, 36, 41, 33, 36, 36, 32, 31, 32, 30, 33, 41, 37, 41, 34, 40, 39, 31, 39, 31, 30, 41, 32]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'BBCFFFFFHHFFHIGHGHGIJJJJJJIJJJIIJJJIJJIIIGGIJGGIJJIJIJJJGIJJJJJJJJIGIIFGFHIG'), ('UQ', 0)]
D0MUKACXX120302:5:1208:18766:114279 99 6 140453130 60 76M 6 140453260 76 ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA array('B', [31, 30, 32, 31, 37, 33, 36, 34, 40, 31, 29, 37, 38, 34, 29, 40, 33, 38, 38, 33, 36, 35, 36, 32, 39, 33, 38, 38, 36, 31, 32, 33, 34, 34, 33, 29, 38, 35, 39, 29, 39, 33, 38, 40, 30, 39, 36, 34, 40, 32, 31, 40, 33, 35, 39, 34, 36, 36, 32, 30, 33, 31, 32, 40, 37, 41, 34, 39, 40, 34, 41, 32, 30, 39, 34, 31]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFFFHHFDFHGIIJJJJJJGGIJJJIIJJJIEGHGBCHHIFHEIIEHGGGGIIJJIJIJJJIGFHCF@DGG@'), ('UQ', 0)]
D0N3RACXX120302:3:2201:21289:121967 99 6 140453130 60 76M 6 140453197 76 ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA array('B', [16, 29, 30, 30, 19, 11, 34, 32, 18, 24, 2, 7, 31, 35, 25, 19, 16, 15, 9, 31, 32, 32, 25, 27, 36, 22, 27, 14, 29, 22, 28, 32, 30, 30, 28, 22, 33, 38, 10, 25, 10, 21, 33, 26, 21, 31, 35, 29, 35, 32, 28, 20, 32, 20, 20, 32, 33, 34, 23, 19, 32, 29, 23, 19, 17, 17, 29, 34, 5, 25, 30, 27, 23, 28, 33, 2]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', ':??D:2BD<=,,ABE:22+AFE;BA:A3A9C@>E>;?C*1*:C>0?DDDEC<D49??D:8D?4///=B(8@8;AC#'), ('UQ', 0)]
D0N3RACXX120302:2:1307:14096:92571 1171 6 140453130 60 76M 6 140453052 76 ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA array('B', [32, 34, 35, 32, 39, 32, 41, 35, 39, 31, 37, 40, 41, 30, 36, 39, 31, 39, 40, 29, 31, 32, 31, 32, 40, 32, 35, 41, 31, 32, 35, 35, 35, 36, 30, 32, 37, 32, 39, 32, 39, 35, 33, 36, 19, 37, 35, 33, 40, 32, 32, 37, 31, 35, 40, 32, 31, 30, 29, 31, 30, 31, 32, 39, 32, 37, 34, 36, 35, 30, 35, 27, 32, 35, 31, 23]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GGIGGEIJJJJJIGHEIHF<EHDDFHBIJJIIGIGFDIHGHGAB4GJGJHBGHCIGFEIJIJJHHHHDDDDDB@@@'), ('UQ', 0)]
D0N3RACXX120302:2:2207:10930:105773 147 6 140453130 60 76M 6 140453052 76 ATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTA array('B', [34, 36, 35, 34, 39, 31, 41, 35, 37, 31, 37, 39, 36, 30, 37, 40, 33, 40, 41, 33, 30, 32, 33, 33, 40, 32, 41, 41, 31, 32, 36, 35, 35, 35, 31, 31, 40, 33, 39, 32, 39, 35, 37, 39, 32, 37, 35, 33, 39, 32, 33, 39, 32, 35, 40, 33, 33, 30, 28, 31, 30, 31, 32, 39, 31, 37, 34, 36, 35, 30, 35, 29, 33, 35, 31, 23]) [('MD', '76'), ('PG', 'bwa.16'), ('RG', 'D0N3R.2'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIJIG@FCGHFBEGJIGJHHFF??FEJJIJJHGJIGIJJIIIIHGEIIIJJJIIJJJGEIIJJHGGHHFDDFF@@B'), ('UQ', 0)]
C0FJ4ACXX120306:8:1203:3075:44765 163 6 140453131 60 76M 6 140453291 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [23, 31, 31, 36, 31, 35, 32, 38, 29, 29, 38, 37, 35, 29, 40, 33, 38, 37, 32, 35, 35, 35, 32, 39, 33, 39, 38, 36, 31, 32, 33, 33, 33, 33, 31, 39, 36, 41, 31, 39, 33, 41, 41, 31, 39, 35, 34, 40, 33, 32, 40, 33, 36, 41, 33, 36, 36, 32, 31, 32, 31, 32, 40, 36, 41, 34, 42, 41, 32, 40, 31, 31, 42, 32, 31, 36]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHHHHIJJJJIJJJJJJJJJJJJJJJJJIJGIJJJFHIJJJJIIJJIIJIJJIJJJJJJJCFGHJEHI'), ('UQ', 0)]
C0FJ4ACXX120306:8:2306:7294:129815 163 6 140453131 60 76M 6 140453196 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [23, 31, 31, 36, 31, 35, 33, 38, 29, 28, 38, 37, 35, 29, 40, 33, 36, 38, 33, 35, 35, 35, 31, 37, 33, 36, 38, 36, 31, 31, 33, 33, 33, 33, 31, 39, 35, 39, 31, 39, 33, 38, 39, 31, 36, 35, 31, 39, 33, 32, 39, 33, 36, 41, 33, 34, 34, 33, 31, 31, 31, 32, 40, 36, 41, 33, 40, 39, 28, 36, 31, 32, 39, 31, 31, 35]) [('MD', '76'), ('PG', 'bwa.8'), ('RG', 'C0FJ4.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@CFFFDDFDHHHJIEGHJIIIGEEFHHJIIIJIJJGFIIDCHBDBFHIIEGGIIEGHIGIJJJGEGH7=8CGDDE'), ('UQ', 0)]
D0N3RACXX120302:3:2108:20826:32731 1123 6 140453131 60 76M 6 140453198 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [31, 32, 33, 37, 33, 37, 33, 36, 25, 26, 32, 27, 33, 30, 35, 30, 35, 36, 30, 34, 36, 34, 32, 34, 31, 38, 37, 36, 27, 33, 33, 34, 33, 33, 31, 35, 36, 38, 31, 32, 35, 30, 32, 30, 38, 36, 34, 39, 30, 32, 36, 33, 29, 35, 32, 35, 35, 30, 30, 30, 30, 32, 38, 36, 38, 34, 36, 37, 33, 36, 31, 23, 36, 32, 31, 30]) [('MD', '76'), ('PG', 'bwa.6'), ('RG', 'D0N3R.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@@@FFFDF?DF?FGHBFGEHIHIEHIIICHIIGIIGIIH@GDEHHIGIBIGCBGBHHEIEDHGGHEFFCFA=FGH;'), ('UQ', 0)]
D0N3RACXX120302:4:1303:4608:65724 99 6 140453131 60 76M 6 140453198 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [32, 31, 33, 38, 33, 37, 35, 38, 32, 30, 35, 39, 36, 31, 40, 32, 38, 38, 33, 35, 35, 36, 32, 40, 33, 39, 38, 37, 31, 32, 33, 34, 34, 34, 31, 39, 36, 41, 32, 39, 33, 39, 40, 31, 40, 36, 33, 41, 33, 32, 40, 33, 36, 40, 33, 36, 36, 33, 31, 33, 31, 33, 41, 36, 40, 34, 41, 41, 32, 38, 32, 30, 38, 32, 31, 32]) [('MD', '76'), ('PG', 'bwa.21'), ('RG', 'D0N3R.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'CCCFFFFFHHGHHJJJIJJJJJJJIJJJJJJJJJJIIJIIIIJHIJJJJJJJIJIJJIJJJJJJJIJJCFFHIIID'), ('UQ', 0)]
D0MUKACXX120302:5:2207:16829:143643 659 6 140453131 60 76M 6 140453024 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [34, 35, 32, 40, 33, 32, 33, 38, 31, 36, 38, 41, 32, 36, 38, 32, 39, 38, 33, 33, 32, 32, 33, 38, 23, 37, 37, 30, 32, 35, 35, 35, 35, 31, 32, 39, 33, 37, 33, 36, 33, 37, 39, 34, 38, 34, 33, 40, 29, 33, 40, 32, 35, 33, 31, 33, 31, 29, 31, 29, 31, 31, 39, 32, 38, 33, 35, 36, 30, 34, 29, 33, 35, 31, 31, 23]) [('MD', '76'), ('PG', 'bwa.19'), ('RG', 'D0MUK.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'DD>CC;DEGGGHIHGHHDIGHGFB4DBIHBHBJJIDGGHF@GIIGGIIDIJGH@GJHGIGGEIHHBDHDFFFD@@@'), ('UQ', 0)]
D0N3RACXX120302:7:1306:16646:114795 83 6 140453131 60 76M 6 140453094 76 TTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAA array('B', [35, 35, 34, 41, 32, 42, 34, 41, 31, 36, 40, 40, 31, 37, 41, 33, 40, 41, 34, 33, 34, 32, 34, 40, 30, 40, 41, 31, 32, 36, 37, 36, 36, 31, 31, 41, 34, 39, 34, 39, 36, 39, 39, 34, 42, 36, 34, 41, 32, 34, 40, 34, 36, 40, 33, 33, 32, 31, 31, 30, 32, 33, 41, 33, 40, 35, 38, 38, 33, 37, 31, 35, 37, 32, 31, 31]) [('MD', '76'), ('PG', 'bwa.12'), ('RG', 'D0N3R.7'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'HJJJHJJJJIJJIIJJJJJJIIHD?IJJJJJIIIHJJJJIJJJJJIJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0MUKACXX120302:4:1304:13977:36981 1171 6 140453133 60 76M 6 140453030 76 TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT array('B', [34, 39, 32, 41, 34, 39, 31, 37, 40, 41, 31, 36, 40, 32, 40, 41, 34, 34, 34, 31, 34, 40, 32, 40, 41, 30, 31, 35, 35, 35, 34, 32, 31, 40, 33, 38, 33, 40, 36, 37, 37, 33, 38, 36, 33, 41, 32, 32, 38, 33, 36, 37, 33, 32, 31, 29, 31, 30, 31, 32, 40, 32, 38, 35, 36, 36, 31, 36, 27, 33, 35, 28, 30, 34, 35, 23]) [('MD', '76'), ('PG', 'bwa'), ('RG', 'D0MUK.4'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GCCHIJJJJJIGGGIJJJJJIGIIIGHGGGGHEHGIIIIGGGGJIJIGGIHEJGGEJIJJIHIHGHHHDFFDF@CC'), ('UQ', 0)]
D0N3RACXX120302:5:1304:9653:65296 147 6 140453133 60 76M 6 140453030 76 TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT array('B', [34, 39, 30, 43, 33, 39, 32, 37, 40, 41, 31, 37, 40, 33, 40, 41, 33, 34, 34, 33, 33, 39, 31, 40, 40, 29, 32, 36, 35, 35, 35, 31, 32, 41, 33, 39, 34, 40, 36, 38, 39, 34, 41, 36, 33, 41, 32, 33, 40, 34, 36, 39, 33, 33, 31, 30, 31, 30, 31, 32, 40, 32, 38, 34, 37, 37, 31, 36, 29, 33, 34, 28, 30, 34, 35, 23]) [('MD', '76'), ('PG', 'bwa.17'), ('RG', 'D0N3R.5'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'JIGJIJJIJJJJJJJJJJJJIGFJIIJJJJJJIJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC'), ('UQ', 0)]
D0N3RACXX120302:8:2205:15260:28841 83 6 140453133 60 76M 6 140452930 76 TCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGT array('B', [34, 42, 31, 39, 32, 38, 32, 34, 36, 38, 31, 35, 39, 32, 38, 41, 31, 34, 32, 31, 32, 40, 32, 39, 41, 31, 32, 35, 35, 36, 35, 31, 30, 38, 33, 39, 32, 36, 35, 34, 38, 33, 40, 36, 33, 39, 33, 33, 40, 34, 36, 40, 34, 34, 32, 31, 31, 30, 31, 33, 38, 33, 39, 35, 37, 36, 32, 38, 31, 35, 36, 31, 31, 36, 34, 31]) [('MD', '76'), ('PG', 'bwa.11'), ('RG', 'D0N3R.8'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '@IIGGGHC@EGDGHGIDIHGFF?HFDHHDDDD?GGHHFHAIGIIIGIIIJJJJIJIHHIGGIIHFDHHFFFFFC@@'), ('UQ', 0)]
C0FJ4ACXX120306:3:2301:8334:182439 147 6 140453134 60 76M 6 140453069 76 CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA array('B', [39, 31, 40, 34, 40, 31, 36, 39, 38, 32, 35, 39, 32, 40, 41, 31, 32, 31, 29, 33, 33, 28, 39, 39, 30, 29, 33, 34, 35, 31, 30, 23, 34, 33, 37, 31, 37, 30, 34, 37, 32, 40, 32, 33, 40, 32, 34, 39, 31, 35, 37, 29, 24, 28, 30, 28, 30, 29, 33, 39, 32, 38, 34, 37, 36, 31, 34, 29, 33, 35, 29, 28, 33, 35, 30, 23]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', 'GHGGIHGGEGGGFHHCGD?@?9HFF?@EGDB?DCGFGCEEGGDIIIJIGIGHDDGCHEHGGGGHGHFFFDFBD?<B'), ('UQ', 0)]
C0FJ4ACXX120306:3:2307:1703:125755 659 6 140453134 60 76M 6 140453109 76 CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA array('B', [25, 31, 42, 34, 38, 32, 35, 39, 42, 30, 35, 39, 33, 40, 41, 31, 31, 32, 31, 33, 37, 33, 37, 40, 30, 31, 30, 33, 35, 35, 31, 32, 39, 32, 36, 31, 37, 35, 36, 40, 32, 42, 35, 31, 40, 32, 29, 36, 29, 35, 37, 32, 28, 26, 26, 27, 30, 25, 32, 37, 32, 38, 34, 37, 28, 31, 35, 28, 33, 35, 28, 28, 32, 35, 31, 23]) [('MD', '76'), ('PG', 'bwa.18'), ('RG', 'C0FJ4.3'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '7HIGEIHGHEGEIHCFDGDBB?FHGBBBGJJIHEEFGGGHGHGEHHDEHIGIHC?BE?FEGGGC;DDBDDDDBB?@'), ('UQ', 0)]
C0FJ4ACXX120306:6:1108:9868:95295 147 6 140453134 60 76M 6 140453073 76 CACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTA array('B', [2, 34, 39, 33, 36, 29, 33, 36, 36, 29, 33, 36, 29, 35, 36, 30, 31, 31, 29, 32, 34, 20, 36, 35, 29, 28, 32, 33, 31, 32, 28, 29, 35, 31, 34, 30, 35, 33, 34, 35, 31, 37, 33, 28, 36, 29, 13, 36, 31, 34, 35, 31, 33, 28, 28, 31, 31, 31, 34, 37, 32, 37, 34, 36, 36, 31, 35, 30, 33, 34, 29, 29, 32, 34, 30, 22]) [('MD', '76'), ('PG', 'bwa.22'), ('RG', 'C0FJ4.6'), ('AM', 37), ('NM', 0), ('SM', 37), ('MQ', 60), ('OQ', '#CGHEEAFCGGIHEGEIGEF?0DBCFFHAFCGIIIGHEEIIHC?CA+HGGGIJDACIIIHGJHDHGHHFFEDD@@<'), ('UQ', 0)]
In [0]:
samfile = pysam.AlignmentFile('gs://isb-ccle-open/gdc/0a109993-2d5b-4251-bcab-9da4a611f2b1/C836.Calu-3.2.bam', "rb")
fetchedreads = pysam.AlignmentFile("test.bam", "wb", template=samfile)
for read in samfile.fetch('7', 140453130, 140453135):
fetchedreads.write(read)
fetchedreads.close()
samfile.close()
In [0]:
!ls -lha
total 5.7M
drwxr-xr-x 1 root root 4.0K Jan 29 23:20 .
drwxr-xr-x 1 root root 4.0K Jan 29 23:14 ..
-rw-r--r-- 1 root root 2.6K Jan 29 23:16 adc.json
-rw-r--r-- 1 root root 5.6M Jan 29 23:20 C836.Calu-3.2.bam.bai
drwxr-xr-x 1 root root 4.0K Jan 29 23:16 .config
drwxr-xr-x 1 root root 4.0K Jan 28 17:05 sample_data
-rw-r--r-- 1 root root 28K Jan 29 23:20 test.bam
In [0]:
#if you don't already have a google cloud storage bucket, you can make one using the following command:
#The mb command creates a new bucket.
#gsutil mb gs://your_bucket
In [0]:
#to see what's in the bucket..
#!gsutil ls gs://your_bucket/
In [0]:
# then we can copy over the file
!gsutil cp gs://bam_bucket_1/test.bam test_dl.bam
Copying gs://bam_bucket_1/test.bam...
/ [1 files][ 27.5 KiB/ 27.5 KiB]
Operation completed over 1 objects/27.5 KiB.
In [0]:
# and it made it?
!gsutil ls gs://bam_bucket_1/
gs://bam_bucket_1/test.bam
gs://bam_bucket_1/test_2.bam
gs://bam_bucket_1/test_3.bam
In [0]:
newsamfile = pysam.AlignmentFile('gs://bam_bucket_1/test.bam', 'rb')
for r in newsamfile.fetch(until_eof=True):
print(r)
#
#
# No. But maybe soon. #
---------------------------------------------------------------------------
PermissionError Traceback (most recent call last)
<ipython-input-15-2ba9acdc4ae9> in <module>()
----> 1 newsamfile = pysam.AlignmentFile('gs://bam_bucket_1/test.bam', 'rb')
2 for r in newsamfile.fetch(until_eof=True):
3 print(r)
4 #
5 #
pysam/libcalignmentfile.pyx in pysam.libcalignmentfile.AlignmentFile.__cinit__()
pysam/libcalignmentfile.pyx in pysam.libcalignmentfile.AlignmentFile._open()
PermissionError: [Errno 13] could not open alignment file `gs://bam_bucket_1/test.bam`: Permission denied
In [0]:
!gsutil ls gs://bam_bucket_1/
In [0]:
!gsutil cp gs://bam_bucket_1/test.bam test_dl.bam
The Alignment file is read as a pysam.AlignedSegment, which is a python class. The methods and class variables can be found here: https://pysam.readthedocs.io/en/latest/api.html#pysam.AlignedSegment
In [0]:
import numpy as np
# first we'll open our bam-slice
dlsamfile = pysam.AlignmentFile('test_dl.bam', 'rb')
# and we'll save the read quality scores in a list
quality = []
for read in dlsamfile:
quality.append(read.mapping_quality)
# then we can compute statistics on them
print("Average quality score")
print(np.mean(quality))
Average quality score
58.861111111111114
In [0]:
# again open our bam-slice
dlsamfile = pysam.AlignmentFile('test_dl.bam', 'rb')
# here, we'll extract the sequences to process
seqs = []
for read in dlsamfile:
seqs.append(read.query_sequence)
# let's count the number of times nucleotide bases are read.
baseCount = dict()
baseCount['A'] = 0
baseCount['C'] = 0
baseCount['G'] = 0
baseCount['T'] = 0
baseCount['N'] = 0
totalCount = 0
for si in seqs:
for base in si:
baseCount[base] += 1
totalCount +=1
for bi in ['A', 'G', 'C', 'T']:
baseCount[bi] /= totalCount
print("Percent bases")
print(baseCount)
Percent bases
{'A': 0.3117690058479532, 'C': 0.24978070175438596, 'G': 0.16564327485380118, 'T': 0.27266081871345027, 'N': 2}
Content source: isb-cgc/examples-Python
Similar notebooks: