In [1]:

    

import analysis
import cooldb

cooldb=cooldb.loaddb()


    

In [2]:

    

exp = analysis.load('./georg/georg.clean.single.min50.withtax.biom.txt',
                    mapname='./georg/georg.map.corrected.derep.txt',
                    studyname='georg')


    

    




('Loading biom table',)
('Loading mapping file',)
('number of samples in map is 768',)
('number of samples in table is 1143',)
('Table sample 10149.1381.N not found in mapping file',)
('Table sample 10149.1494.N not found in mapping file',)
('Table sample 10149.1537.N not found in mapping file',)
('Table sample 10149.1849.N not found in mapping file',)
('Table sample 10149.BLANK.12.11H not found in mapping file',)
('Table sample 10149.2018.N not found in mapping file',)
('Table sample 10149.1286.N not found in mapping file',)
('Table sample 10149.1574.N not found in mapping file',)
('Table sample 10149.1783.N not found in mapping file',)
('Table sample 10149.1620.N not found in mapping file',)
('Table sample 10149.1261.N not found in mapping file',)
('Table sample 10149.1032.N not found in mapping file',)
('Table sample 10149.1641.N not found in mapping file',)
('Table sample 10149.1515.N not found in mapping file',)
('Table sample 10149.1307.N not found in mapping file',)
('Table sample 10149.1053.N not found in mapping file',)
('Table sample 10149.1746.N not found in mapping file',)
('Table sample 10149.1875.N not found in mapping file',)
('Table sample 10149.1412.N not found in mapping file',)
('Table sample 10149.1109.N not found in mapping file',)
('Table sample 10149.1995.N not found in mapping file',)
('Table sample 10149.1361.N not found in mapping file',)
('Table sample 10149.2042.N not found in mapping file',)
('Table sample 10149.1196.N not found in mapping file',)
('Table sample 10149.1683.N not found in mapping file',)
('Table sample 10149.1720.N not found in mapping file',)
('Table sample 10149.1573.N not found in mapping file',)
('Table sample 10149.1091.N not found in mapping file',)
('Table sample 10149.1850.N not found in mapping file',)
('Table sample 10149.1437.N not found in mapping file',)
('Table sample 10149.1281.N not found in mapping file',)
('Table sample 10149.1076.N not found in mapping file',)
('Table sample 10149.1386.N not found in mapping file',)
('Table sample 10149.1398.N not found in mapping file',)
('Table sample 10149.1225.N not found in mapping file',)
('Table sample 10149.1949.N not found in mapping file',)
('Table sample 10149.1831.N not found in mapping file',)
('Table sample 10149.1017.N not found in mapping file',)
('Table sample 10149.1009.N not found in mapping file',)
('Table sample 10149.1343.N not found in mapping file',)
('Table sample 10149.1928.N not found in mapping file',)
('Table sample 10149.2023.N not found in mapping file',)
('Table sample 10149.1054.N not found in mapping file',)
('Table sample 10149.1646.N not found in mapping file',)
('Table sample 10149.1975.N not found in mapping file',)
('Table sample 10149.1658.N not found in mapping file',)
('Table sample 10149.1612.N not found in mapping file',)
('Table sample 10149.1441.N not found in mapping file',)
('Table sample 10149.1826.N not found in mapping file',)
('Table sample 10149.1985.N not found in mapping file',)
('Table sample 10149.1883A.N not found in mapping file',)
('Table sample 10149.1210.N not found in mapping file',)
('Table sample 10149.1505.N not found in mapping file',)
('Table sample 10149.1317.N not found in mapping file',)
('Table sample 10149.1125.N not found in mapping file',)
('Table sample 10149.1098.N not found in mapping file',)
('Table sample 10149.1086.N not found in mapping file',)
('Table sample 10149.1793.N not found in mapping file',)
('Table sample 10149.1564.N not found in mapping file',)
('Table sample 10149.1804.N not found in mapping file',)
('Table sample 10149.1694.N not found in mapping file',)
('Table sample 10149.1940.N not found in mapping file',)
('Table sample 10149.1527.N not found in mapping file',)
('Table sample 10149.1391.N not found in mapping file',)
('Table sample 10149.1166.N not found in mapping file',)
('Table sample 10149.1335.N not found in mapping file',)
('Table sample 10149.1288.N not found in mapping file',)
('Table sample 10149.2016.N not found in mapping file',)
('Table sample 10149.1862.N not found in mapping file',)
('Table sample 10149.1310.N not found in mapping file',)
('Table sample 10149.1209.N not found in mapping file',)
('Table sample 10149.1965.N not found in mapping file',)
('Table sample 10149.1656.N not found in mapping file',)
('Table sample 10149.1648.N not found in mapping file',)
('Table sample 10149.1353.N not found in mapping file',)
('Table sample 10149.1007.N not found in mapping file',)
('Table sample 10149.1982.N not found in mapping file',)
('Table sample 10149.1712.N not found in mapping file',)
('Table sample 10149.1541.N not found in mapping file',)
('Table sample 10149.1100.N not found in mapping file',)
('Table sample 10149.2011.N not found in mapping file',)
('Table sample 10149.1332.N not found in mapping file',)
('Table sample 10149.1291.N not found in mapping file',)
('Table sample 10149.1439.N not found in mapping file',)
('Table sample 10149.1427.N not found in mapping file',)
('Table sample 10149.1840.N not found in mapping file',)
('Table sample 10149.1483.N not found in mapping file',)
('Table sample 10149.BLANK.11.11H not found in mapping file',)
('Table sample 10149.1803.N not found in mapping file',)
('Table sample 10149.1186.N not found in mapping file',)
('Table sample 10149.1081.N not found in mapping file',)
('Table sample 10149.1122.N not found in mapping file',)
('Table sample 10149.1629.N not found in mapping file',)
('Table sample 10149.1786.N not found in mapping file',)
('Table sample 10149.1798.N not found in mapping file',)
('Table sample 10149.1916.N not found in mapping file',)
('Table sample 10149.BLANK.12.11F not found in mapping file',)
('Table sample 10149.1093.N not found in mapping file',)
('Table sample 10149.1194.N not found in mapping file',)
('Table sample 10149.2040.N not found in mapping file',)
('Table sample 10149.1476.N not found in mapping file',)
('Table sample 10149.1227.N not found in mapping file',)
('Table sample 10149.1239.N not found in mapping file',)
('Table sample 10149.1173.N not found in mapping file',)
('Table sample 10149.BLANK.11.11C not found in mapping file',)
('Table sample 10149.1666.N not found in mapping file',)
('Table sample 10149.1532.N not found in mapping file',)
('Table sample 10149.1596.N not found in mapping file',)
('Table sample 10149.1074.N not found in mapping file',)
('Table sample 10149.1112.N not found in mapping file',)
('Table sample 10149.BLANK.11.11B not found in mapping file',)
('Table sample 10149.1619.N not found in mapping file',)
('Table sample 10149.1607.N not found in mapping file',)
('Table sample 10149.1889.N not found in mapping file',)
('Table sample 10149.1510.N not found in mapping file',)
('Table sample 10149.1969.N not found in mapping file',)
('Table sample 10149.1977.N not found in mapping file',)
('Table sample 10149.BLANK.12.11G not found in mapping file',)
('Table sample 10149.1205.N not found in mapping file',)
('Table sample 10149.1409.N not found in mapping file',)
('Table sample 10149.1870.N not found in mapping file',)
('Table sample 10149.1743.N not found in mapping file',)
('Table sample 10149.1591.N not found in mapping file',)
('Table sample 10149.1339.N not found in mapping file',)
('Table sample 10149.1383.N not found in mapping file',)
('Table sample 10149.1220.N not found in mapping file',)
('Table sample 10149.2047.N not found in mapping file',)
('Table sample 10149.1193.N not found in mapping file',)
('Table sample 10149.1364.N not found in mapping file',)
('Table sample 10149.BLANK.12.11E not found in mapping file',)
('Table sample 10149.1622.N not found in mapping file',)
('Table sample 10149.1410.N not found in mapping file',)
('Table sample 10149.BLANK.12.11D not found in mapping file',)
('Table sample 10149.1997.N not found in mapping file',)
('Table sample 10149.1453.N not found in mapping file',)
('Table sample 10149.1346.N not found in mapping file',)
('Table sample 10149.BLANK.11.11A not found in mapping file',)
('Table sample 10149.1554.N not found in mapping file',)
('Table sample 10149.1967.N not found in mapping file',)
('Table sample 10149.1654.N not found in mapping file',)
('Table sample 10149.BLANK.12.11A not found in mapping file',)
('Table sample 10149.1407.N not found in mapping file',)
('Table sample 10149.1419.N not found in mapping file',)
('Table sample 10149.2031.N not found in mapping file',)
('Table sample 10149.1543.N not found in mapping file',)
('Table sample 10149.1256.N not found in mapping file',)
('Table sample 10149.BLANK.11.11D not found in mapping file',)
('Table sample 10149.1351.N not found in mapping file',)
('Table sample 10149.1005.N not found in mapping file',)
('Table sample 10149.1980.N not found in mapping file',)
('Table sample 10149.1444.N not found in mapping file',)
('Table sample 10149.1522.N not found in mapping file',)
('Table sample 10149.BLANK.11.11E not found in mapping file',)
('Table sample 10149.1668.N not found in mapping file',)
('Table sample 10149.1676.N not found in mapping file',)
('Table sample 10149.1945.N not found in mapping file',)
('Table sample 10149.1394.N not found in mapping file',)
('Table sample 10149.1064.N not found in mapping file',)
('Table sample 10149.2013.N not found in mapping file',)
('Table sample 10149.1236A.N not found in mapping file',)
('Table sample 10149.1598.N not found in mapping file',)
('Table sample 10149.1425.N not found in mapping file',)
('Table sample 10149.1842.N not found in mapping file',)
('Table sample 10149.1561.N not found in mapping file',)
('Table sample 10149.1796.N not found in mapping file',)
('Table sample 10149.1788.N not found in mapping file',)
('Table sample 10149.1691.N not found in mapping file',)
('Table sample 10149.1184.N not found in mapping file',)
('Table sample 10149.1039.N not found in mapping file',)
('Table sample 10149.1027.N not found in mapping file',)
('Table sample 10149.1356.N not found in mapping file',)
('Table sample 10149.1348.N not found in mapping file',)
('Table sample 10149.1544.N not found in mapping file',)
('Table sample 10149.1880.N not found in mapping file',)
('Table sample 10149.BLANK.11.11G not found in mapping file',)
('Table sample 10149.1867.N not found in mapping file',)
('Table sample 10149.2028.N not found in mapping file',)
('Table sample 10149.1158.N not found in mapping file',)
('Table sample 10149.1507.N not found in mapping file',)
('Table sample 10149.1960.N not found in mapping file',)
('Table sample 10149.1374.N not found in mapping file',)
('Table sample 10149.BLANK.12.11C not found in mapping file',)
('Table sample 10149.1901.N not found in mapping file',)
('Table sample 10149.1791.N not found in mapping file',)
('Table sample 10149.1294.N not found in mapping file',)
('Table sample 10149.1329.N not found in mapping file',)
('Table sample 10149.1063.N not found in mapping file',)
('Table sample 10149.1768.N not found in mapping file',)
('Table sample 10149.1671.N not found in mapping file',)
('Table sample 10149.BLANK.11.11F not found in mapping file',)
('Table sample 10149.1525.N not found in mapping file',)
('Table sample 10149.1486.N not found in mapping file',)
('Table sample 10149.BLANK.10.10D not found in mapping file',)
('Table sample 10149.1501.N not found in mapping file',)
('Table sample 10149.1406.N not found in mapping file',)
('Table sample 10149.1418.N not found in mapping file',)
('Table sample 10149.1313.N not found in mapping file',)
('Table sample 10149.1059.N not found in mapping file',)
('Table sample 10149.2030.N not found in mapping file',)
('Table sample 10149.1257.N not found in mapping file',)
('Table sample 10149.1445.N not found in mapping file',)
('Table sample 10149.1523.N not found in mapping file',)
('Table sample 10149.1677.N not found in mapping file',)
('Table sample 10149.1228.N not found in mapping file',)
('Table sample 10149.1395.N not found in mapping file',)
('Table sample 10149.1065.N not found in mapping file',)
('Table sample 10149.1331.N not found in mapping file',)
('Table sample 10149.1587.N not found in mapping file',)
('Table sample 10149.1275.N not found in mapping file',)
('Table sample 10149.BLANK.10.10E not found in mapping file',)
('Table sample 10149.1789.N not found in mapping file',)
('Table sample 10149.1907.N not found in mapping file',)
('Table sample 10149.1690.N not found in mapping file',)
('Table sample 10149.1372.N not found in mapping file',)
('Table sample 10149.1003.N not found in mapping file',)
('Table sample 10149.1357.N not found in mapping file',)
('Table sample 10149.1708.N not found in mapping file',)
('Table sample 10149.1716.N not found in mapping file',)
('Table sample 10149.1611.N not found in mapping file',)
('Table sample 10149.1922.N not found in mapping file',)
('Table sample 10149.1401.N not found in mapping file',)
('Table sample 10149.1755.N not found in mapping file',)
('Table sample 10149.BLANK.10.10G not found in mapping file',)
('Table sample 10149.1883B.N not found in mapping file',)
('Table sample 10149.1697.N not found in mapping file',)
('Table sample 10149.1734.N not found in mapping file',)
('Table sample 10149.1807.N not found in mapping file',)
('Table sample 10149.1900.N not found in mapping file',)
('Table sample 10149.1633.N not found in mapping file',)
('Table sample 10149.1790.N not found in mapping file',)
('Table sample 10149.BLANK.10.10F not found in mapping file',)
('Table sample 10149.1579.N not found in mapping file',)
('Table sample 10149.1328.N not found in mapping file',)
('Table sample 10149.1062.N not found in mapping file',)
('Table sample 10149.1844.N not found in mapping file',)
('Table sample 10149.1670.N not found in mapping file',)
('Table sample 10149.1487.N not found in mapping file',)
('Table sample 10149.1231.N not found in mapping file',)
('Table sample 10149.1165.N not found in mapping file',)
('Table sample 10149.1917.N not found in mapping file',)
('Table sample 10149.BLANK.10.10C not found in mapping file',)
('Table sample 10149.1362.N not found in mapping file',)
('Table sample 10149.2041.N not found in mapping file',)
('Table sample 10149.1195.N not found in mapping file',)
('Table sample 10149.1036.N not found in mapping file',)
('Table sample 10149.1723.N not found in mapping file',)
('Table sample 10149.1226.N not found in mapping file',)
('Table sample 10149.1385.N not found in mapping file',)
('Table sample 10149.1238.N not found in mapping file',)
('Table sample 10149.1597.N not found in mapping file',)
('Table sample 10149.1075.N not found in mapping file',)
('Table sample 10149.1247.N not found in mapping file',)
('Table sample 10149.1888.N not found in mapping file',)
('Table sample 10149.1935.N not found in mapping file',)
('Table sample 10149.1340.N not found in mapping file',)
('Table sample 10149.1511.N not found in mapping file',)
('Table sample 10149.1645.N not found in mapping file',)
('Table sample 10149.BLANK.10.10B not found in mapping file',)
('Table sample 10149.1150.N not found in mapping file',)
('Table sample 10149.1204.N not found in mapping file',)
('Table sample 10149.1303.N not found in mapping file',)
('Table sample 10149.1408.N not found in mapping file',)
('Table sample 10149.1590.N not found in mapping file',)
('Table sample 10149.1433.N not found in mapping file',)
('Table sample 10149.1285.N not found in mapping file',)
('Table sample 10149.1382.N not found in mapping file',)
('Table sample 10149.1489.N not found in mapping file',)
('Table sample 10149.1809.N not found in mapping file',)
('Table sample 10149.1817.N not found in mapping file',)
('Table sample 10149.1724.N not found in mapping file',)
('Table sample 10149.1780.N not found in mapping file',)
('Table sample 10149.2027.N not found in mapping file',)
('Table sample 10149.1642.N not found in mapping file',)
('Table sample 10149.1971.N not found in mapping file',)
('Table sample 10149.1516.N not found in mapping file',)
('Table sample 10149.BLANK.10.10A not found in mapping file',)
('Table sample 10149.1149.N not found in mapping file',)
('Table sample 10149.1240.N not found in mapping file',)
('Table sample 10149.1114.N not found in mapping file',)
('Table sample 10149.BLANK.9.9H not found in mapping file',)
('Table sample 10149.1555.N not found in mapping file',)
('Table sample 10149.1559.N not found in mapping file',)
('Table sample 10149.1547.N not found in mapping file',)
('Table sample 10149.1920.N not found in mapping file',)
('Table sample 10149.1001.N not found in mapping file',)
('Table sample 10149.BLANK.12.12F not found in mapping file',)
('Table sample 10149.1211.N not found in mapping file',)
('Table sample 10149.1757.N not found in mapping file',)
('Table sample 10149.2035.N not found in mapping file',)
('Table sample 10149.1308.N not found in mapping file',)
('Table sample 10149.BLANK.9.9C not found in mapping file',)
('Table sample 10149.1099.N not found in mapping file',)
('Table sample 10149.1087.N not found in mapping file',)
('Table sample 10149.1902.N not found in mapping file',)
('Table sample 10149.BLANK.9.9B not found in mapping file',)
('Table sample 10149.1462.N not found in mapping file',)
('Table sample 10149.1369.N not found in mapping file',)
('Table sample 10149.1377.N not found in mapping file',)
('Table sample 10149.1180.N not found in mapping file',)
('Table sample 10149.1672.N not found in mapping file',)
('Table sample 10149.1485.N not found in mapping file',)
('Table sample 10149.1538.N not found in mapping file',)
('Table sample 10149.1526.N not found in mapping file',)
('Table sample 10149.1060.N not found in mapping file',)
('Table sample 10149.1846.N not found in mapping file',)
('Table sample 10149.1775.N not found in mapping file',)
('Table sample 10149.BLANK.12.12G not found in mapping file',)
('Table sample 10149.1421.N not found in mapping file',)
('Table sample 10149.1142.N not found in mapping file',)
('Table sample 10149.1657.N not found in mapping file',)
('Table sample 10149.1649.N not found in mapping file',)
('Table sample 10149.1018.N not found in mapping file',)
('Table sample 10149.BLANK.12.12E not found in mapping file',)
('Table sample 10149.1459.N not found in mapping file',)
('Table sample 10149.1884.N not found in mapping file',)
('Table sample 10149.1540.N not found in mapping file',)
('Table sample 10149.1101.N not found in mapping file',)
('Table sample 10149.2010.N not found in mapping file',)
('Table sample 10149.1236B.N not found in mapping file',)
('Table sample 10149.BLANK.12.12D not found in mapping file',)
('Table sample 10149.BLANK.10.10H not found in mapping file',)
('Table sample 10149.1482.N not found in mapping file',)
('Table sample 10149.1675.N not found in mapping file',)
('Table sample 10149.1958.N not found in mapping file',)
('Table sample 10149.1389.N not found in mapping file',)
('Table sample 10149.1465.N not found in mapping file',)
('Table sample 10149.BLANK.9.9A not found in mapping file',)
('Table sample 10149.1692.N not found in mapping file',)
('Table sample 10149.1187.N not found in mapping file',)
('Table sample 10149.1370.N not found in mapping file',)
('Table sample 10149.1123.N not found in mapping file',)
('Table sample 10149.1277.N not found in mapping file',)
('Table sample 10149.1562.N not found in mapping file',)
('Table sample 10149.1628.N not found in mapping file',)
('Table sample 10149.1169.N not found in mapping file',)
('Table sample 10149.1536.N not found in mapping file',)
('Table sample 10149.1662.N not found in mapping file',)
('Table sample 10149.1856.N not found in mapping file',)
('Table sample 10149.1848.N not found in mapping file',)
('Table sample 10149.BLANK.12.12A not found in mapping file',)
('Table sample 10149.1575.N not found in mapping file',)
('Table sample 10149.1621.N not found in mapping file',)
('Table sample 10149.1097.N not found in mapping file',)
('Table sample 10149.2044.N not found in mapping file',)
('Table sample 10149.1379.N not found in mapping file',)
('Table sample 10149.1472.N not found in mapping file',)
('Table sample 10149.1685.N not found in mapping file',)
('Table sample 10149.1514.N not found in mapping file',)
('Table sample 10149.1155.N not found in mapping file',)
('Table sample 10149.BLANK.9.9E not found in mapping file',)
('Table sample 10149.1874.N not found in mapping file',)
('Table sample 10149.1893.N not found in mapping file',)
('Table sample 10149.1930.N not found in mapping file',)
('Table sample 10149.1603.N not found in mapping file',)
('Table sample 10149.1345.N not found in mapping file',)
('Table sample 10149.1011.N not found in mapping file',)
('Table sample 10149.1189.N not found in mapping file',)
('Table sample 10149.BLANK.9.9G not found in mapping file',)
('Table sample 10149.1682.N not found in mapping file',)
('Table sample 10149.1812.N not found in mapping file',)
('Table sample 10149.BLANK.12.10H not found in mapping file',)
('Table sample 10149.1267.N not found in mapping file',)
('Table sample 10149.1133.N not found in mapping file',)
('Table sample 10149.1762.N not found in mapping file',)
('Table sample 10149.1323.N not found in mapping file',)
('Table sample 10149.BLANK.12.12B not found in mapping file',)
('Table sample 10149.1077.N not found in mapping file',)
('Table sample 10149.1399.N not found in mapping file',)
('Table sample 10149.1665.N not found in mapping file',)
('Table sample 10149.1948.N not found in mapping file',)
('Table sample 10149.1492.N not found in mapping file',)
('Table sample 10149.BLANK.12.12C not found in mapping file',)
('Table sample 10149.1457.N not found in mapping file',)
('Table sample 10149.1830.N not found in mapping file',)
('Table sample 10149.1703.N not found in mapping file',)
('Table sample 10149.1342.N not found in mapping file',)
('Table sample 10149.1111.N not found in mapping file',)
('Table sample 10149.1055.N not found in mapping file',)
('Table sample 10149.1301.N not found in mapping file',)
('Table sample 10149.BLANK.9.9F not found in mapping file',)
('Table sample 10149.1218.N not found in mapping file',)
('removing 381 samples',)
('deleted. number of samples in table is now 762',)
('need to remove 6 samples from mapping file',)
Samples with 0 reads: 40

In [3]:

    

analysis.plotexp(exp, usegui=False, showline=False)


    

    




('6800 Bacteria left',)
lala
('Not using gui',)






    
Out[3]:





(<analysis.experiment instance at 0x10a4d59e0>,
 <matplotlib.axes._subplots.AxesSubplot at 0x10bec1e50>)

In [4]:

    

q = analysis.sortsamples(exp, 'Primer_Plate')
qq = analysis.sortsamples(q, 'Is_blank')
qqc = analysis.clusterbacteria(qq, minreads=10)


    

    




('5533 Bacteria left',)

In [18]:

    

analysis.plotexp(qqc, usegui=False, showline=False, cdb=cooldb)


    

    




('5533 Bacteria left',)
lala
('Not using gui',)






    
Out[18]:





(<analysis.experiment instance at 0x137fa9680>,
 <matplotlib.axes._subplots.AxesSubplot at 0x1381028d0>)

In [43]:

    

# load contaminant sequences

with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/combined/putative_contaminants_seq_headers.txt','r') as f:
    q98_all = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_1_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate1 = [x.strip() for x in f.readlines()]

with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_2_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate2 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_3_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate3 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_4_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate4 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_5_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate5 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_6_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate6 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_7_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate7 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_q98/plate_8_out/putative_contaminants_seq_headers.txt','r') as f:
    q98_plate8 = [x.strip() for x in f.readlines()]

with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/combined/putative_contaminants_seq_headers.txt','r') as f:
    max_all = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_1_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate1 = [x.strip() for x in f.readlines()]

with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_2_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate2 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_3_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate3 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_4_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate4 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_5_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate5 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_6_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate6 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_7_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate7 = [x.strip() for x in f.readlines()]
    
with open('/Users/jonsanders/Development/git_sw/pita/georg/20151005_test_max/plate_8_out/putative_contaminants_seq_headers.txt','r') as f:
    max_plate8 = [x.strip() for x in f.readlines()]


    

In [46]:

    

qqcf98 = analysis.filterseqs(qqc,q98_all)
qqcf98_1 = analysis.filterseqs(qqc,q98_plate1)
qqcf98_2 = analysis.filterseqs(qqc,q98_plate2)
qqcf98_3 = analysis.filterseqs(qqc,q98_plate3)
qqcf98_4 = analysis.filterseqs(qqc,q98_plate4)
qqcf98_5 = analysis.filterseqs(qqc,q98_plate5)
qqcf98_6 = analysis.filterseqs(qqc,q98_plate6)
qqcf98_7 = analysis.filterseqs(qqc,q98_plate7)
qqcf98_8 = analysis.filterseqs(qqc,q98_plate8)

qqcfmax = analysis.filterseqs(qqc,max_all)
qqcfmax_1 = analysis.filterseqs(qqc,max_plate1)
qqcfmax_2 = analysis.filterseqs(qqc,max_plate2)
qqcfmax_3 = analysis.filterseqs(qqc,max_plate3)
qqcfmax_4 = analysis.filterseqs(qqc,max_plate4)
qqcfmax_5 = analysis.filterseqs(qqc,max_plate5)
qqcfmax_6 = analysis.filterseqs(qqc,max_plate6)
qqcfmax_7 = analysis.filterseqs(qqc,max_plate7)
qqcfmax_8 = analysis.filterseqs(qqc,max_plate8)


    

    




('sequence not in experiment', 'TACGTAGGGTGTGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTCGTAGGTGGTTGATCGCGTCGGAAGTGTAATCTTGGGGCTTAACCCTGAGCGTGCTTTCGATACGGGTT')
('sequence not in experiment', 'TACGTAGGGTGTGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTCGTAGGTGGTTGATCGCGTCGGAAGTGTAATCTTGGGGCTTAACCCTGAGCGTGCTTTCGATACGGGTT')

In [69]:

    

analysis.plotexp(qqcf98, usegui=False, showline=False, ontofig=True, cdb=cooldb)


    

    




('38 Bacteria left',)
lala
('Not using gui',)






    
Out[69]:





(<analysis.experiment instance at 0x152841e60>,
 <matplotlib.axes._subplots.AxesSubplot at 0x1588a29d0>)

In [ ]:

    




    

In [ ]: