CG_StringBasics



In [1]:
'A'


Out[1]:
'A'

In [2]:
'ACGT'


Out[2]:
'ACGT'

In [3]:
st = 'ACGT'

In [4]:
len(st) # getting the length of a string


Out[4]:
4

In [5]:
'' # empty string (epsilon)


Out[5]:
''

In [6]:
len('')


Out[6]:
0

In [7]:
import random
random.choice('ACGT') # generating a random nucleotide


Out[7]:
'C'

In [8]:
random.choice('ACGT') # repeated invocations might yield different nucleotides


Out[8]:
'C'

In [9]:
random.choice('ACGT') # repeated invocations might yield different nucleotides


Out[9]:
'T'

In [10]:
random.choice('ACGT') # repeated invocations might yield different nucleotides


Out[10]:
'A'

In [11]:
random.choice('ACGT') # repeated invocations might yield different nucleotides


Out[11]:
'G'

In [12]:
# now I'll make a random nucleotide string by concatenating random nucleotides
st = ''.join([random.choice('ACGT') for _ in range(40)])
st


Out[12]:
'GTCACATAATGCTGTAGATTAAGCGAGAAGACCTTAGGTC'

In [13]:
st[1:3] # substring, starting at position 1 and extending up to but not including position 3
# note that the first position is numbered 0


Out[13]:
'TC'

In [14]:
st[0:3] # prefix of length 3


Out[14]:
'GTC'

In [15]:
st[:3] # another way of getting the prefix of length 3


Out[15]:
'GTC'

In [16]:
st[len(st)-3:len(st)] # suffix of length 3


Out[16]:
'GTC'

In [17]:
st[-3:] # another way of getting the suffix of length 3


Out[17]:
'GTC'

In [18]:
st1, st2 = 'CAT', 'ATAC'

In [19]:
st1


Out[19]:
'CAT'

In [20]:
st2


Out[20]:
'ATAC'

In [21]:
st1 + st2 # concatenation of 2 strings


Out[21]:
'CATATAC'